EGFR suppression contributes to growth inhibitory activity of G-quadruplex ligands in non-small cell lung cancers.

Non-small cell lung carcinomas (NSCLCs) commonly harbor activating mutations in the epidermal growth factor receptor (EGFR). Drugs targeting the tyrosine kinase activity of EGFR have shown effectiveness in inhibiting the growth of cancer cells with EGFR mutations. However, the development of additional mutations in cancer cells often leads to the persistence of the disease, necessitating alternative strategies to overcome this challenge. We explored the efficacy of stabilizing the G-quadruplex structure formed in the promoter region of EGFR as a means to suppress its expression and impede the growth of cancer cells with EGFR mutations. We revealed that the carbazole derivative BMVC-8C3O effectively suppressed EGFR expression and demonstrated significant growth inhibition in EGFR-mutated NSCLC cells, both in cell culture and mouse xenograft models. Importantly, the observed repression of EGFR expression and growth inhibition were not exclusive to carbazole derivatives, as several other G-quadruplex ligands exhibited similar effects. The growth-inhibitory activity of BMVC-8C3O is attributed, at least in part, to the repression of EGFR, although it is possible that additional cellular targets are also affected. Remarkably, the growth-inhibitory effect was observed even in osimertinib-resistant cells, indicating that BMVC-8C3O holds promise for treating drug-resistant NSCLC. Our findings present a promising and innovative approach for inhibiting the growth of NSCLC cells with EGFR mutations by effectively suppressing EGFR expression. The demonstrated efficacy of G-quadruplex ligands in this study highlights their potential as candidates for further development in NSCLC therapy.

Suppressing c-FOS expression by G-quadruplex ligands inhibits osimertinib-resistant non-small cell lung cancer.

BACKGROUND: Osimertinib is the first-line therapy for patients with non-small cell lung cancer harboring epidermal growth factor receptor-activating alterations. Although osimertinib has been shown to elicit profound patient responses, cancer cells frequently develop additional alterations that sustain their proliferation capacity. This acquired resistance represents a substantial hurdle in precision medicine for patients with lung cancer. METHODS: The biological and cellular properties of the G-quadruplex ligand BMVC-8C3O and its anticancer activities were evaluated in non-small cell lung carcinomas. In addition, combined treatment with BMVC-8C3O and osimertinib was evaluated for its effects on the growth of osimertinib-resistant tumors in vivo. RESULTS: We demonstrate that BMVC-8C3O effectively suppresses c-FOS expression by stabilizing G-rich sequences located at the c-FOS promoter. The suppression c-FOS expression by BMVC-8C3O increases the sensitivity of acquired resistant cancer cells to osimertinib. Combining BMVC-8C3O and osimertinib has a synergistic effect in inhibiting the growth of acquired resistant cancers both in vitro and in mouse models. The combined inhibitory effect is not limited to BMVC-8C3O, either: several G-quadruplex ligands show varying levels of inhibition activity. We also show that simultaneous inhibition of both the c-FOS and PI3K/AKT pathways by BMVC-8C3O and osimertinib synergistically inhibits the growth of acquired resistant cancer cells. CONCLUSION: These findings unveil a synthetic lethal strategy to prevent and inhibit epidermal growth factor receptor-altered lung cancers with acquired osimertinib resistance. G-quadruplex ligands have the potential to be integrated into current osimertinib-based treatment regimens.

Cyclic anthraquinone derivatives, unique G-quadruplex binders, selectively induce cancer cell apoptosis and inhibit tumor growth.

Cyclic anthraquinone derivatives (cAQs), which link two side chains of 1,5-disubstituted anthraquinone as a threading DNA intercalator, have been developed as G-quartet (G4) DNA-specific ligands. Among the cAQs, cAQ-mBen linked through the 1,3-position of benzene had the strongest affinity for G4 recognition and stabilization in vitro and was confirmed to bind to the G4 structure in vivo, selectively inhibiting cancer cell proliferation in correlation with telomerase expression levels and triggering cell apoptosis. RNA-sequencing analysis further indicated that differentially expressed genes regulated by cAQ-mBen were profiled with more potential quadruplex-forming sequences. In the treatment of the tumor-bearing mouse model, cAQ-mBen could effectively reduce tumor tissue and had less adverse effects on healthy tissue. These results suggest that cAQ-mBen can be a potential cancer therapeutic agent as a G4 binder.

Structural Change from Nonparallel to Parallel G-Quadruplex Structures in Live Cancer Cells Detected in the Lysosomes Using Fluorescence Lifetime Imaging Microscopy.

Time-gated fluorescence lifetime imaging microscopy with the o-BMVC fluorescent probe provides a visualizing method for the study of exogenous G-quadruplexes (G4s) in live cancer cells. Previously, imaging results showed that the parallel G4s are accumulated and that nonparallel G4s are not detected in the lysosomes of CL1-0 live cells. In this work, the detection of the G4 signals from exogenous GTERT-d(FN) G4s in the lysosomes may involve a structural change in live cells from intramolecular nonparallel G4s to intermolecular parallel G4s. Moreover, the detection of the G4 signals in the lysosomes after the 48 h incubation of HT23 G4s with CL1-0 live cells indicates the occurrence of structural conversion from the nonparallel G4s to the parallel G4s of HT23 in the live cells. In addition, the detection of much stronger G4 signals from ss-GTERT-d(FN) than ss-HT23 in the lysosomes of CL1-0 live cells may be explained by the quick formation of the intermolecular parallel G4s of ss-GTERT-d(FN) and the degradation of ss-HT23 before its intramolecular parallel G4 formation. This work provides a new approach to studying G4-lysosome interactions in live cells.

Pilot imaging study of o-BMVC foci for discrimination of indeterminate cytology in diagnosing fine-needle aspiration of thyroid nodules.

Fluorescence lifetime imaging microscopy of a fluorescence probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), provides an objective method for preoperative diagnosis of fine-needle aspiration (FNA) of thyroid nodules. The key of this o-BMVC test of FNA smears is the measurement of the digital number of o-BMVC foci in the nucleus. Thus, there are three categories classified in the o-BMVC test, which are nondiagnostic for unsatisfactory samples, benign for less numbers of o-BMVC foci, and malignant for more numbers of o-BMVC foci. The discrimination of indeterminate (including atypia, follicular neoplasm, suspicious) cytology into benign or malignant cases can reduce diagnostic uncertainty and benefit clinical decision making. This pilot study strongly suggests that the o-BMVC test is an invaluable method for diagnosing FNA samples. Particularly, the combination of FNA cytology and the o-BMVC test holds great promise to improve the efficacy of diagnosis and reduce the healthcare costs.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

Folding and Unfolding of Exogenous G-Rich Oligonucleotides in Live Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Fluorescent Probe.

Guanine-rich oligonucleotides (GROs) can self-associate to form G-quadruplex (G4) structures that have been extensively studied in vitro. To translate the G4 study from in vitro to in live cells, here fluorescence lifetime imaging microscopy (FLIM) of an o-BMVC fluorescent probe is applied to detect G4 structures and to study G4 dynamics in CL1-0 live cells. FLIM images of exogenous GROs show that the exogenous parallel G4 structures that are characterized by the o-BMVC decay times (≥2.4 ns) are detected in the lysosomes of live cells in large quantities, but the exogenous nonparallel G4 structures are hardly detected in the cytoplasm of live cells. In addition, similar results are also observed for the incubation of their single-stranded GROs. In the study of G4 formation by ssHT23 and hairpin WT22, the analyzed binary image can be used to detect very small increases in the number of o-BMVC foci (decay time ≥ 2.4 ns) in the cytoplasm of live cells. However, exogenous ssCMA can form parallel G4 structures that are able to be detected in the lysosomes of live CL1-0 cells in large quantities. Moreover, the photon counts of the o-BMVC signals (decay time ≥ 2.4 ns) that are measured in the FLIM images are used to reveal the transition of the G4 formation of ssCMA and to estimate the unfolding rate of CMA G4s with the addition of anti-CMA into live cells for the first time. Hence, FLIM images of o-BMVC fluorescence hold great promise for the study of G4 dynamics in live cells.

Antisense Oligonucleotides Used to Identify Telomeric G-Quadruplexes in Metaphase Chromosomes and Fixed Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci.

Identification of the existence of G-quadruplex (G4) structure, from a specific G-rich sequence in cells, is critical to the studies of structural biology and drug development. Accumulating evidence supports the existence of G4 structure in vivo. Particularly, time-gated fluorescence lifetime imaging microscopy (FLIM) of a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), was used to quantitatively measure the number of G4 foci, not only in different cell lines, but also in tissue biopsy. Here, circular dichroism spectra and polyacrylamide gel electrophoresis assays show that the use of antisense oligonucleotides unfolds their G4 structures in different percentages. Using antisense oligonucleotides, quantitative measurement of the number of o-BMVC foci in time-gated FLIM images provides a method for identifying which G4 motifs form G4 structures in fixed cells. Here, the decrease of the o-BMVC foci number, upon the pretreatment of antisense sequences, (CCCTAA)3CCCTA, in fixed cells and at the end of metaphase chromosomes, allows us to identify the formation of telomeric G4 structures from TTAGGG repeats in fixed cells.

Custom G4 Microarrays Reveal Selective G-Quadruplex Recognition of Small Molecule BMVC: A Large-Scale Assessment of Ligand Binding Selectivity.

G-quadruplexes (G4) are considered new drug targets for human diseases such as cancer. More than 10,000 G4s have been discovered in human chromatin, posing challenges for assessing the selectivity of a G4-interactive ligand. 3,6-bis(1-Methyl-4-vinylpyridinium) carbazole diiodide (BMVC) is the first fluorescent small molecule for G4 detection in vivo. Our previous structural study shows that BMVC binds to the MYC promoter G4 (MycG4) with high specificity. Here, we utilize high-throughput, large-scale custom DNA G4 microarrays to analyze the G4-binding selectivity of BMVC. BMVC preferentially binds to the parallel MycG4 and selectively recognizes flanking sequences of parallel G4s, especially the 3'-flanking thymine. Importantly, the microarray results are confirmed by orthogonal NMR and fluorescence binding analyses. Our study demonstrates the potential of custom G4 microarrays as a platform to broadly and unbiasedly assess the binding selectivity of G4-interactive ligands, and to help understand the properties that govern molecular recognition.

Spectroscopic coherent Raman imaging of Caenorhabditis elegans reveals lipid particle diversity.

Caenorhabditis elegans serves as a model for understanding adiposity and its connections to aging. Current methodologies do not distinguish between fats serving the energy needs of the parent, akin to mammalian adiposity, from those that are distributed to the progeny, making it difficult to accurately interpret the physiological implications of fat content changes induced by external perturbations. Using spectroscopic coherent Raman imaging, we determine the protein content, chemical profiles and dynamics of lipid particles in live animals. We find fat particles in the adult intestine to be diverse, with most destined for the developing progeny. In contrast, the skin-like epidermis contains fats that are the least heterogeneous, the least dynamic and have high triglyceride content. These attributes are most consistent with stored somatic energy reservoirs. These results challenge the prevailing practice of assessing C. elegans adiposity by measurements that are dominated by the intestinal fat content.

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes.

A G-rich sequence containing three loops to connect four G-tracts with each ≥2 guanines can possibly form G-quadruplex structures. Given that all G-quadruplex structures comprise the stacking of G-quartets, the loop sequence plays a major role on their folding topology and thermal stability. Here circular dichroism, NMR, and PAGE are used to study the effect of loop length and base composition in the middle loop, and a single base difference in loop 1 and 3 on G-quadruplex formation of (G3HG3NmG3HG3) sequences with and without flanking nucleotides, where H is T, A, or C and N is T, A, C, or G. In addition, melting curve for G-quadruplex unfolding was used to provide relatively thermal stability of G-quadruplex structure after the addition of K+ overnight. We further studied the effects of K+ concentration on their stability and found structural changes in several sequences. Such (G3HG3NmG3HG3) configuration can be found in a number of native DNA sequences. The study of structural diversity and similarity from these sequences may allow us to establish the correlation between model sequences and native sequences. Moreover, several sequences upon interaction with a G-quadruplex ligand, BMVC, show similar spectral change, implying that structural similarity is crucial for drug development.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

The antifungal activities and biological consequences of BMVC-12C-P, a carbazole derivative against Candida species.

Fungal infections, particularly Candida species, have increased worldwide and caused high morbidity and mortality rates. The toxicity and development of resistance in present antifungal drugs justify the need of new drugs with different mechanism of action. BMVC-12C-P, a carbazole-type compound, has been found to dysfunction mitochondria. BMVC-12C-P displayed the strongest antifungal activities among all of the BMVC derivatives. The minimal inhibitory concentration (MIC) of BMVC-12C-P against Candida species ranged from 1 to 2 µg/ml. Fluconazole-resistant clinical isolates of Candida species were highly susceptible to BMVC-12C-P. The potent fungicidal activity of BMVC-12C-P relates to its impairing mitochondrial function. Furthermore, we found that the hyphae growth and biofilm formation were suppressed in C. albicans survived from BMVC-12C-P treatment. This study demonstrates the potential of BMVC-12C-P as an antifungal agent for treating Candida infections.

Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition.

BMVC is the first fluorescent probe designed to detect G-quadruplexes (G4s) in vivo. The MYC oncogene promoter forms a G4 (MycG4) which acts as a transcription silencer. Here, we report the high-affinity and specific binding of BMVC to MycG4 with unusual slow-exchange rates on the NMR timescale. We also show that BMVC represses MYC in cancer cells. We determined the solution structures of the 1:1 and 2:1 BMVC-MycG4 complexes. BMVC first binds the 5'-end of MycG4 to form a 1:1 complex with a well-defined structure. At higher ratio, BMVC also binds the 3'-end to form a second complex. In both complexes, the crescent-shaped BMVC recruits a flanking DNA residue to form a BMVC-base plane stacking over the external G-tetrad. Remarkably, BMVC adjusts its conformation to a contracted form to match the G-tetrad for an optimal stacking interaction. This is the first structural example showing the importance of ligand conformational adjustment in G4 recognition. BMVC binds the more accessible 5'-end with higher affinity, whereas sequence specificity is present at the weaker-binding 3'-site. Our structures provide insights into specific recognition of MycG4 by BMVC and useful information for design of G4-targeted anticancer drugs and fluorescent probes.

Comparison and Elucidation of Structural Diversity and Variation of G-Rich Sequences with a Single G-Base Difference.

Previously, we found the structural diversity of a mitochondrial sequence mt10251 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism. In this work, we investigate the diverse G4 topologies of mt10251 and structural variation of its mutants. Using circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE), we first illustrate an unusual tetrameric G4 structure together with hairpin bulges formed by four strands of mt10251-d30 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGG). Of interest is that the structural conversion from a hairpin structure to diverse G4 structures in mt10251 is negligible in mt10251-d30 after the addition of 20 mM K+. Further kinetic and thermal studies of mt10251, mt10251-d30, and their mutants reveal the major factors in determining the transition from a hairpin structure to diverse G4 structures of mt10251 and the structural variation of their mutants after the addition of 20 mM K+.

G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences.

BACKGROUND: Mitochondrial DNA (mtDNA) mutations could lead to mitochondrial dysfunction, which plays a major role in aging, neurodegeneration, and cancer. Recently, we have highlighted G-quadruplex (G4) formation of putative G4-forming (PQF) mtDNA sequences in cells. Herein, we examine structural variation of G4 formation due to mutation of mtDNA sequences in vitro. METHODS: The combined circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE) results provide complementary insights into the structural variation of the studied G-rich sequence and its mutants. RESULTS: This study illustrates the structural diversity of mt10251, a G-rich mtDNA sequence with a 16-nt loop, (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures of mt10251 in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 can cause significant changes in terms of structural populations and polymorphism. In addition, single-base mutations of near-but-not-PQF sequences can potentially change not-G4 to G4 structures. We further found 124 modified PQF sequences due to single-base mutations of near-but-not-PQF sequences in mtDNA. CONCLUSIONS: Single-base mutations of mt10251 could make significant changes in its structural variation and some single-base mutated sequences in mtDNA could form G4 structures in vitro. GENERAL SIGNIFICANCE: We illustrate the importance of single-base mutations of DNA sequences to the change of G4 formation in vitro. The use of single-base mutations by generating the fourth G-tract and followed by selection in shortening the longest loop size in the near-but-not-PQF sequences was conducted for the G4 formation.

Binding of Small Molecules to G-quadruplex DNA in Cells Revealed by Fluorescence Lifetime Imaging Microscopy of o-BMVC Foci.

G-quadruplex (G4) structures have recently received increasing attention as a potential target for cancer research. We used time-gated fluorescence lifetime imaging microscopy (FLIM) with a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), to measure the number of o-BMVC foci, which may represent G4 foci, in cells as a common signature to distinguish cancer cells from normal cells. Here, the decrease in the number of o-BMVC foci in the pretreatment of cancer cells with TMPyP4, BRACO-19 and BMVC4 suggested that they directly bind to G4s in cells. In contrast, the increase in the number of o-BMVC foci in the pretreatment of cells with PDS and Hoechst 33258 (H33258) suggested that they do not inhabit the binding site of o-BMVC to G4s in cells. After the H33258 was removed, the gradual decrease of H33258-induced G4 foci may be due to DNA repair. The purpose of this work is to introduce o-BMVC foci as an indicator not only to verify the direct binding of potential G4 ligands to G4 structures but also to examine the possible effect of some DNA binding ligands on DNA integrity by monitoring the number of G4 foci in cells.

The G-quadruplex fluorescent probe 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide as a biosensor for human cancers.

Using time-gated fluorescence lifetime imaging microscopy, significantly more signals from 3,6-bis(1-methyl-2-vinyl-pyridinium) carbazole diiodide (o-BMVC) foci, characterized by the longer fluorescent decay time of o-BMVC, were detected in six types of cancer cells than in three types of normal cells. Accumulating evidence suggested that the o-BMVC foci are mainly the G-quadruplex foci. The large contrast in the number of o-BMVC foci can be considered as a common signature to distinguish cancer cells from normal cells. Further study of tissue biopsy showed that the o-BMVC test provides a high accuracy for clinical detection of head and neck cancers.

A G-Quadruplex Structure in the Promoter Region of CLIC4 Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.