Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 35
Filtrar
1.
Artigo em Inglês | MEDLINE | ID: mdl-39037059

RESUMO

Patients with diabetes face a 2-4-fold greater cardiovascular risk compared to those without diabetes. Both metformin and acetylsalicylic acid (aspirin) treatment have demonstrated a significant reduction in this risk. This single-center, open-label, sequence randomized, 2 × 2 crossover, single-dose clinical trial evaluated the pharmacokinetics profile and comparative bioavailability of a novel oral fixed-dose combination (FDC) of metformin/acetylsalicylic acid (500/100 mg tablet) versus the reference mono-drugs administered concomitantly, metformin 500 mg tablet and acetylsalicylic acid 100 mg tablet, in 22 healthy Mexican adult volunteers under fasting conditions. Blood samples were collected predose and at specified intervals across a 24-hour period following administration and were analyzed for metformin and salicylic acid using high-performance liquid chromatography coupled with tandem mass spectrometry. Test products were considered to have comparative bioavailability if confidence intervals of natural log-transformed (maximum plasma drug concentration (Cmax), (area under the plasma drug concentration-time curve form 0 up to last sampling time (AUC0 -t), and (area under the plasma drug concentration-time cruve from 0 up to infinity (AUC0 ∞) data were within the range of 80%-125%. The results obtained from the present clinical study demonstrate the comparative bioavailability of the FDC when compared with the coadministration of reference mono-drugs. There were no adverse events or adverse reactions reported throughout the study.

2.
Int J Mol Sci ; 25(9)2024 Apr 30.
Artigo em Inglês | MEDLINE | ID: mdl-38732158

RESUMO

Biological membranes are composed of a lipid bilayer with embedded proteins, including ion channels like the epithelial sodium channel (ENaC), which are critical for sodium homeostasis and implicated in arterial hypertension (HTN). Changes in the lipid composition of the plasma membrane can significantly impact cellular processes related to physiological functions. We hypothesized that the observed overexpression of ENaC in neutrophils from HTN patients might result from alterations in the structuring domains within the plasma membrane, disrupting the endocytic processes responsible for ENaC retrieval. This study assessed the structural lipid composition of neutrophil plasma membranes from HTN patients along with the expression patterns of key elements regulating ENaC at the plasma membrane. Our findings suggest alterations in microdomain structure and SGK1 kinase activity, which could prolong ENaC presence on the plasma membrane. Additionally, we propose that the proteasomal and lysosomal degradation pathways are insufficient to diminish ENaC presence at the plasma membrane in HTN. These results highlight the importance of understanding ENaC retrieval mechanisms and suggest that targeting these mechanisms could provide insights for developing drugs to prevent and treat HTN.


Assuntos
Membrana Celular , Endocitose , Canais Epiteliais de Sódio , Hipertensão , Neutrófilos , Canais Epiteliais de Sódio/metabolismo , Humanos , Neutrófilos/metabolismo , Hipertensão/metabolismo , Hipertensão/patologia , Membrana Celular/metabolismo , Lipídeos de Membrana/metabolismo , Proteínas Serina-Treonina Quinases/metabolismo , Masculino , Feminino , Proteínas Imediatamente Precoces/metabolismo , Pessoa de Meia-Idade , Microdomínios da Membrana/metabolismo
3.
Plant Dis ; 2023 Aug 01.
Artigo em Inglês | MEDLINE | ID: mdl-37526486

RESUMO

Wheat (Triticum aestivum) is the third most cultivated field crop in Paraguay; it is grown on over 450,000 hectares with an annual production of 927,776 tons (fao.org/faostat). In 1952, Septoria tritici blotch (STB) was associated with the fungus Septoria tritici solely based on microscopic observation of conidia (Viedma and Delgado 1987). However, no morphometric or molecular studies have been performed in Paraguay up to date. Over the following decades, STB epidemic outbreaks were recorded, with a reduction in wheat production of up to 70% (Viedma and Delgado 1987). During winter 2021, leaf blotch symptoms were observed with an incidence above 50% in wheat fields in Capitán Miranda, Itapúa, Paraguay. Scattered, spherical, buried, and light brown necrotic spots with dark edges were observed on the leaves. Pycnidia with prominent central ostiole were observed. Leaves with symptoms were washed with 1% sodium hypochlorite for 1 min, rinsed with sterile distilled water, and incubated in wet chambers to induce sporulation of the fungus. Pycnidia produced greyish to white cirri. Isolated conidia were thin, elongated, and hyaline, ranging from 26.9-72.7 × 1.5-2.9 µm with one to three septa. Monosporic colonies on potato dextrose agar (PDA, ; Difco laboratories, Detroit, MI) media varied in color from white to pink, dark gray to black, or black with stroma-like structures. Based on morphology, the fungus was characterized as Zymoseptoria tritici (Hoorne et al. 2002; Gilchrist-Saavedra et al. 2005). Fungal DNA was extracted from mycelia, and the internal transcribed spacer (ITS), translation elongation factor 1-α (TEF1-α), 28S rRNA gene (LSU), actin gene (act), calmodulin (CaM) were amplified using ITS1/ITS4, EF1-728F/EF-2, LSU1Fd/ LR5, ACT-512F/ACT-783R, CAL-228F/CAL737R primers, respectively. PCR amplicons were sequenced at Macrogen (Seoul, Republic of Korea) and deposited in the NCBI GenBank database (ITS: OQ360718; TEF1-α: OQ999044, LSU: OQ996413, act: OQ999046, CaM: OQ999045). Sequences were aligned with several isolates of Septoria spp. previously reported (Verkley et al. 2013; Stukenbrock et al. 2012) using ClustalW. The alignments were concatenated with Bioedit (Hall 1999). The UPGMA method with 1,000 bootstrap replications, was used to construct the phylogenetic tree using MEGA11 with Readeriella mirabilis as the outgroup. The isolate from Paraguay grouped into the Zymoseptoria tritici clade with 96% bootstrap support. To confirm pathogenicity, ten wheat plants cv. Itapúa 80 were grown in pots for three weeks in growth chambers (22 ± 2°C; 16 h photoperiod). Subsequently, these plants were inoculated with 1×107 conidia ml-1 suspension, and ten non-inoculated plants served as control. Seven days after inoculation (DAI), symptoms were observed displaying oval necrotic lesions and approximately 14 DAI abundant pycnidia were observed on and around the lesions. Segments of symptomatic leaves were placed in moisture chambers overnight to enhance cirri development. Conidia were mounted on a slide and observed under the compound microscope. Individual cirrhus were transferred to plates containing PDA and produced colonies like those used in the inoculation (Hoorne et al. 2002). We confirmed that the causal agent of STB from wheat fields in Paraguay was Zymoseptoria tritici. This pathogen causes annual wheat disease epidemics in Paraguay; therefore, optimizing surveillance for early detection and understanding its distribution will improve integrated management.

4.
J Clin Transl Sci ; 7(1): e23, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36714798

RESUMO

Introduction: Communities of color have faced disproportionate morbidity and mortality from COVID-19, coupled with historical underrepresentation in US clinical trials, creating challenges for equitable participation in developing and testing a safe and effective COVID-19 vaccine. Methods: To increase diversity, including racial and ethnic representation, in local Los Angeles County NIH-sponsored Phase 3 SARS-CoV-2 vaccine clinical trials, we used deliberative community engagement approaches to form a Community Consultant Panel (CCP) that partnered with trial research teams. Thirteen members were recruited, including expertise from essential workers, community-based and faith-based organizations, or leaders from racial and ethnic minority communities. Results: Working closely with local investigators for the vaccine studies, the CCP provided critical insight on best practices for community trust building, clinical trial participation, and reliable information dissemination regarding COVID-19 vaccines. Modifying recruitment, outreach, and trial protocols led to majority-minority participants (55%-78%) in each of the three vaccine clinical trials. CCP's input led to cultural tailoring of recruitment materials, changes in recruitment messaging, and supportive services to improve trial accessibility and acceptability (transportation, protocols for cultural competency, and support linkages to care in case of an adverse event). Barriers to clinical trial participation unable to be resolved included childcare, requests for after-hours appointment availability, and mobile locations for trial visits. Conclusion: Using deliberative community engagement can provide critical and timely insight into the community-centered barriers to COVID-19 vaccine trial participation, including addressing social determinants of health, trust, clinical trial literacy, structural barriers, and identifying trusted messenger and reliable sources of information.

5.
Plant Dis ; 2022 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-35467944

RESUMO

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

6.
Biosensors (Basel) ; 12(2)2022 Jan 24.
Artigo em Inglês | MEDLINE | ID: mdl-35200322

RESUMO

Love wave (L-SAW) sensors have been used to probe cell monolayers, but their application to detect changes beyond the focal adhesion points on cell monolayers, as viscosity changes on the cytoskeleton, has not been explored. In this work we present for the first time a Love wave sensor with tuned penetration depth and sensitivity to potentially detect mechanical changes beyond focal adhesion points of cell monolayers. We designed and fabricated a Love wave sensor operating at 30 MHz with sensitivity to detect viscous changes between 0.89 and 3.3 cP. The Love wave sensor was modeled using an acoustic transmission line model, whereas the response of interdigital transducers (IDTs) was modeled with the Campbell's cross-field circuit model. Our design uses a substrate with a high electromechanical coupling coefficient (LiNbO3 36Y-X), and an 8-µm polymeric guiding layer (SU-8). The design aims to overcome the high insertion losses of viscous liquid environments, and the loss of sensitivity due to the low frequency. The fabricated sensor was tested in a fluidic chamber glued directly to the SU-8 guiding layer. Our experiments with liquids of viscosity similar to those expected in cell monolayers showed a measurable sensor response. In addition, experimentation with SaOs-2 cells within a culture medium showed measurable responses. These results can be of interest for the development of novel cell-based biosensors, and novel characterization tools for cell monolayers.


Assuntos
Acústica , Técnicas Biossensoriais , Técnicas Biossensoriais/métodos , Adesão Celular/fisiologia , Transdutores , Viscosidade
7.
Molecules ; 27(3)2022 Feb 03.
Artigo em Inglês | MEDLINE | ID: mdl-35164296

RESUMO

The transient vanilloid receptor potential type 1 (TRPV1) regulates neuronal and vascular functions mediated by nitric oxide (NO) and by the calcitonin gene-related peptide (CGRP). Here, we study the participation of TRPV1 in the regulation of myocardial injury caused by ischemia-reperfusion and in the control of NO, tetrahydrobiopterin (BH4), the cGMP pathway, CGRP, total antioxidant capacity (TAC), malondialdehyde (MDA) and phosphodiesterase-3 (PDE-3). Isolated hearts of Wistar rats perfused according to the Langendorff technique were used to study the effects of an agonist of TRPV1, capsaicin (CS), an antagonist, capsazepine (CZ), and their combination CZ+CS. The hearts were subjected to three conditions: (1) control, (2) ischemia and (3) ischemia-reperfusion. We determined cardiac mechanical activity and the levels of NO, cGMP, BH4, CGRP, TAC, MDA and PDE-3 in ventricular tissue after administration of CS, CZ and CZ+CS. Western blots were used to study the expressions of eNOS, iNOS and phosphorylated NOS (pNOS). Structural changes were determined by histological evaluation. CS prevented damage caused by ischemia-reperfusion by improving cardiac mechanical activity and elevating the levels of NO, cGMP, BH4, TAC and CGRP. TRPV1 and iNOS expression were increased under ischemic conditions, while eNOS and pNOS were not modified. We conclude that the activation of TRPV1 constitutes a therapeutic possibility to counteract the damage caused by ischemia and reperfusion by regulating the NO pathway through CGRP.


Assuntos
Coração/fisiopatologia , Traumatismo por Reperfusão Miocárdica/fisiopatologia , Óxido Nítrico/metabolismo , Estresse Oxidativo , Canais de Cátion TRPV/metabolismo , Animais , Masculino , Traumatismo por Reperfusão Miocárdica/metabolismo , Ratos , Ratos Wistar , Transdução de Sinais
8.
Blood Purif ; 50(3): 355-363, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33105136

RESUMO

INTRODUCTION: Patients with acute respiratory distress syndrome (ARDS) secondary to COVID-19 frequently develop severe acute kidney injury (AKI). Although continuous renal replacement therapy is the standard of care for critically ill patients, prolonged intermittent renal replacement therapy (PIRRT) may be a feasible option. We aimed to describe the tolerability and security of PIRRT treatments in COVID-19 patients with ARDS who required mechanical ventilation and developed severe AKI. METHODS: We prospectively analyzed patients who underwent PIRRT treatments at a COVID-19 reference hospital in Mexico City. Intradialytic hypotension was defined as a systolic blood pressure decrease of ≥20 mm Hg or an increase of 100% in vasopressor dose. RESULTS: We identified 136 AKI cases (60.7%) in 224 patients admitted to the intensive care unit. Among them, 21 (15%) underwent PIRRT (130 sessions) due to stage 3 AKI. The median age of the cohort was 49 (range 36-73) years, 17 (81%) were male, 7 (33%) had diabetes, and the median time between symptoms onset and PIRRT initiation was 12 (interquartile range [IQR] 7-14) days. The median of PIRRT procedures for each patient was 5 (IQR 4-9) sessions. In 108 (83%) PIRRT sessions, the total ultrafiltration goal was achieved. In 84 (65%) PIRRT procedures, there was a median increase in norepinephrine dose of +0.031 mcg/kg/min during PIRRT (IQR 0.00 to +0.07). Intradialytic hypotensive events occurred in 56 (43%) procedures. Fifteen (12%) PIRRT treatments were discontinued due to severe hypotension. Vasopressor treatment at PIRRT session onset (OR 6.2, 95% CI 1.4-28.0, p: 0.02) and a pre-PIRRT lactate ≥3.0 mmol/L (OR 4.63, 95% CI 1.3-12.8, p: 0.003) were independently and significantly associated with the risk of hypotension during PIRRT. During follow-up, 11 patients (52%) recovered from AKI and respiratory failure and 9 (43%) died. Several adaptations to our PIRRT protocol during the COVID-19 outbreak are presented. CONCLUSIONS: PIRRT was feasible in the majority of COVID-19 patients with ARDS and severe AKI, despite frequent transitory intradialytic hypotensive episodes. PIRRT may represent an acceptable alternative of renal replacement therapy during the COVID-19 outbreak.


Assuntos
Injúria Renal Aguda/terapia , COVID-19/complicações , Cuidados Críticos/métodos , Terapia de Substituição Renal Intermitente , Síndrome do Desconforto Respiratório/etiologia , SARS-CoV-2 , Injúria Renal Aguda/etiologia , Adulto , Idoso , COVID-19/epidemiologia , Comorbidade , Terapia de Substituição Renal Contínua , Complicações do Diabetes/epidemiologia , Feminino , Humanos , Hipertensão/epidemiologia , Hipotensão/etiologia , Terapia de Substituição Renal Intermitente/efeitos adversos , Masculino , Pessoa de Meia-Idade , Norepinefrina/uso terapêutico , Estudos Prospectivos , Respiração Artificial , Síndrome do Desconforto Respiratório/terapia , Resultado do Tratamento , Vasoconstritores/uso terapêutico
9.
Artigo em Inglês | MEDLINE | ID: mdl-31557799

RESUMO

The purpose of the present study was to analyze the actions of transient receptor potential vanilloid type 1 (TRPV1) agonist capsaicin (CS) and of its antagonist capsazepine (CZ), on cardiac function as well as endothelial biomarkers and some parameters related with nitric oxide (NO) release in L-NG-nitroarginine methyl ester (L-NAME)-induced hypertensive rats. NO has been implicated in the pathophysiology of systemic arterial hypertension (SAHT). We analyzed the levels of nitric oxide (NO), tetrahydrobiopterin (BH4), malondialdehyde (MDA), total antioxidant capacity (TAC), cyclic guanosin monophosphate (cGMP), phosphodiesterase-3 (PDE-3), and the expression of endothelial nitric oxide synthase (eNOS), guanosine triphosphate cyclohydrolase 1 (GTPCH-1), protein kinase B (AKT), and TRPV1 in serum and cardiac tissue of normotensive (118±3 mmHg) and hypertensive (H) rats (165 ± 4 mmHg). Cardiac mechanical performance (CMP) was calculated and NO was quantified in the coronary effluent in the Langendorff isolated heart model. In hypertensive rats capsaicin increased the levels of NO, BH4, cGMP, and TAC, and reduced PDE-3 and MDA. Expressions of eNOS, GTPCH-1, and TRPV1 were increased, while AKT was decreased. Capsazepine diminished these effects. In the hypertensive heart, CMP improved with the CS treatment. In conclusion, the activation of TRPV1 in H rats may be an alternative mechanism for the improvement of cardiac function and systemic levels of biomarkers related to the bioavailability of NO.


Assuntos
Coração/efeitos dos fármacos , Hipertensão/metabolismo , Miocárdio/metabolismo , Óxido Nítrico/metabolismo , Canais de Cátion TRPV/metabolismo , Animais , Biomarcadores/sangue , Biopterinas/análogos & derivados , Biopterinas/metabolismo , Pressão Sanguínea , Capsaicina/análogos & derivados , Capsaicina/farmacologia , Capsaicina/uso terapêutico , Avaliação Pré-Clínica de Medicamentos , Hipertensão/tratamento farmacológico , Masculino , NG-Nitroarginina Metil Éster , Óxido Nítrico Sintase Tipo III , Estresse Oxidativo , Proteínas Proto-Oncogênicas c-akt , Ratos , Ratos Wistar , Canais de Cátion TRPV/agonistas , Canais de Cátion TRPV/antagonistas & inibidores , Resistência Vascular
10.
PeerJ ; 6: e4996, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29910988

RESUMO

Amendment with biochar and/or compost has been proposed as a strategy to remediate soil contaminated with low levels of polycyclic aromatic hydrocarbons. The strong sorption potential of biochar can help sequestering contaminants while the compost may promote their degradation. An improved understanding of how sorption evolves upon soil amendment is an essential step towards the implementation of the approach. The present study reports on the sorption of pyrene to two soils, four biochars and one compost. Detailed isotherm analyzes across a wide range of concentration confirmed that soil amendments can significantly increase the sorption of pyrene. Comparisons of data obtained by a classical batch and a passive sampling method suggest that dissolved organic matter did not play a significant role on the sorption of pyrene. The addition of 10% compost to soil led to a moderate increase in sorption (<2-fold), which could be well predicted based on measurements of sorption to the individual components. Hence, our result suggest that the sorption of pyrene to soil and compost can be relatively well approximated by an additive process. The addition of 5% biochar to soil (with or without compost) led to a major increase in the sorption of pyrene (2.5-4.7-fold), which was, however, much smaller than that suggested based on the sorption measured on the three individual components. Results suggest that the strong sorption to the biochar was attenuated by up to 80% in the presence of soil and compost, much likely due to surface and pore blockage. Results were very similar in the two soils considered, and collectively suggest that combined amendments with compost and biochar may be a useful approach to remediate soils with low levels of contamination. Further studies carried out in more realistic settings and over longer periods of time are the next step to evaluate the long term viability of remediation approaches based on biochar amendments.

12.
Int J Mol Sci ; 17(11)2016 Oct 26.
Artigo em Inglês | MEDLINE | ID: mdl-27792193

RESUMO

Vitamin E (VE) tocotrienols (T3), recognized for their cancer-specific anti-proliferative and pro-apoptotic activities, have been previously fabricated into bio-active nanoemulsion (NE) formulations. Here, our viscosity-adapted δ-T3 NE platform was developed to additionally incorporate curcumin (CUR), which is known for its potent suppression of signaling pathways involved in malignant cell growth, survival and metastasis. Thanks to efficient 70:30 wt % surfactant mix of Lutrol F-127:VE-TPGS, in conjunction with optimal CUR loading, a prototype CUR in δ-T3 NE was successfully prepared. Model CUR/δ-T3 NE demonstrated excellent nano-scale aspects (mean particle size = 261 nm, PDI = 0.27, and ζ-potential = -35 mV), pharmaceutical stability, and controlled release properties. Suitability for systemic administration was also verified via standardized in vitro biocompatibility and hemocompatibility assays. In two human cancer cells (MCF-7 and OVCAR-8), our CUR/δ-T3 NE prominently suppressed constitutive NF-κB activation, and significantly induced apoptosis. Finally, the combined CUR/δ-T3 NE produced superior cytotoxicity profiles, in concentration- and time-dependent manners (p ≤ 0.05), at least three to four folds lower IC50 than in closest CUR control. The strong synergism, estimated in both cultured carcinomas, revealed the augmented therapeutic efficacy of our CUR/δ-T3 NE combined platform, supporting its strong potential towards pharmaceutical development for cancer therapy.


Assuntos
Antineoplásicos/uso terapêutico , Apoptose/efeitos dos fármacos , Neoplasias da Mama/tratamento farmacológico , Curcumina/uso terapêutico , Neoplasias Ovarianas/tratamento farmacológico , Tocotrienóis/uso terapêutico , Vitaminas/uso terapêutico , Antineoplásicos/administração & dosagem , Mama/efeitos dos fármacos , Mama/patologia , Neoplasias da Mama/patologia , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Curcumina/administração & dosagem , Preparações de Ação Retardada/química , Emulsões/química , Feminino , Humanos , Neoplasias Ovarianas/patologia , Ovário/efeitos dos fármacos , Ovário/patologia , Tocotrienóis/administração & dosagem , Vitaminas/administração & dosagem
13.
Rev Med Inst Mex Seguro Soc ; 53 Suppl 2: S140-53, 2015.
Artigo em Espanhol | MEDLINE | ID: mdl-26462509

RESUMO

In this paper we are reporting for the first time the presence of seed sequences of human and viral microRNAs embedded within both high and low risk human papillomavirus (HPV) genomes. These seed sequences have high oncogenic potential. They were found using an in silico analysis based on the microRNA sequences added to Sanger's database. Among these sequences, it was observed a potential fingerprint harbouring several repeated sequences of microRNA 297 (miR-297) within the LCR region of HPV types 16, 18, 33, 45 and 52. Further analyses were performed for low risk HPV types 6 and 11 and we observed that the probable fingerprint was absent in HPV11, even when we detected other repeated sequences of miR-363. According to these findings, besides the fact that we detected the presence of microRNA sequences within HPV genomes, we suggest a common putative viral mechanism of gene expression regulation shared among human virus.


En el presente trabajo reportamos por primera vez la existencia de secuencias semilla de diferentes microRNAs (codificados en humano y de otros virus) en el genoma de los virus de papiloma humano (VPH). Estas secuencias tienen un alto poder oncogénico y se encontraron mediante un análisis in silico basado en las secuencias de microRNAs depositadas en la base de datos de Sanger. Entre ellas se detectó una posible huella que consiste en la presencia de varias repeticiones de la semilla del microRNA 297 (miR-297) en la región LCR y que fue detectada en los tipos virales 16, 18, 33, 45 y 52. Además, se realizó la búsqueda de semillas en los tipos virales de bajo poder oncogénico 6 y 11 y se observó que esta posible huella está ausente en el tipo 11, si bien se localizaron repeticiones de la semilla de otro microRNA, miR-363. Con base en este hallazgo, además de que se detectaron semillas de otros virus en las diferentes regiones de los seis tipos virales, se abre la posibilidad de la existencia de un mecanismo de regulación de la expresión de genes celulares a través de la transcripción de las diferentes regiones del genoma de los VPH de alto poder oncogénico que contienen las diferentes semillas de microRNAs.


Assuntos
MicroRNAs/análise , Papillomaviridae/genética , Análise de Sequência de RNA/métodos , Bases de Dados de Ácidos Nucleicos , Regulação Viral da Expressão Gênica , Humanos
14.
Pharmacol Res Perspect ; 3(2): e00122, 2015 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-26038698

RESUMO

In order to determine the feasibility of utilizing novel rexinoids for chemotherapeutics and as potential treatments for neurological conditions, we undertook an assessment of the side effect profile of select rexinoid X receptor (RXR) analogs that we reported previously. We assessed pharmacokinetic profiles, lipid and thyroid-stimulating hormone (TSH) levels in rats, and cell culture activity of rexinoids in sterol regulatory element-binding protein (SREBP) induction and thyroid hormone inhibition assays. We also performed RNA sequencing of the brain tissues of rats that had been dosed with the compounds. We show here for the first time that potent rexinoid activity can be uncoupled from drastic lipid changes and thyroid axis variations, and we propose that rexinoids can be developed with improved side effect profiles than the parent compound, bexarotene (1).

15.
Rev. cuba. cir ; 54(2): 104-111, abr.-jun. 2015. tab
Artigo em Espanhol | LILACS | ID: lil-760983

RESUMO

Introducción: el mantenimiento de la salud cubana en los niveles deseados es una tarea que requiere del esfuerzo de muchos factores y de cuantiosos recursos monetarios, por lo que se hace necesario garantizar la utilización eficiente de los recursos, el ahorro y la eliminación de gastos innecesarios. Objetivo: analizar el comportamiento de los costos hospitalarios en los pacientes con sangrado digestivo alto no variceal ingresados en el Hospital Universitario General Calixto García en el periodo comprendido entre junio de 2012 a diciembre de 2013. Métodos: se realizó un estudio cuasi-experimental, explicativo de tipo observacional, de corte longitudinal con dos grupos de pacientes con el diagnóstico de sangrado digestivo alto no variceal a través de la aplicación del método clínico. Resultados: los costos hospitalarios de importantes indicadores disminuyeron considerablemente en el grupo de pacientes a los que se les aplicó el ácido tranexámico cómo variante terapéutica con respecto a los que no se le administró este medicamento. Conclusiones: en el grupo de pacientes que se usó el ácido tranexámico, disminuyó el número de complicaciones y fallecidos, lo que se traduce en una rápida reincorporación social del paciente y mejor calidad de vida para este y sus familiares(AU)


Introduction: keeping the Cuban population´s health at desirable levels is one task requiring the efforts of many people and a lot of financial resources, so it is necessary to assure the effective use of resources, saving and reduction of unwanted costs. Objective: to analyze the behavior of hospital costs in the treatment of patients with non-variceal upper gastrointestinal bleeding and admitted to General Calixto Garcia university hospital in the period of June 2012 through December 2013. Methods: quasiexperimental, observational-type explanatory and longitudinal study performed in two groups of patients diagnosed as non-variceal upper gastrointestinal bleeding cases through the clinical method. Results: the hospital costs of essential indicators significantly lowered in the group of patients treated with traexamic acid as therapeutic option when compared with those who were not administered this drug. Conclusions: the number of complications and of deaths decreased in the group of patients using tranexamic acid, which means rapid social reincorporation and better quality of life for them and their relatives(AU)


Assuntos
Humanos , Masculino , Feminino , Custos e Análise de Custo/economia , Hemorragia Gastrointestinal/diagnóstico , Custos Hospitalares , Ácido Tranexâmico/administração & dosagem , Ensaio Clínico , Estudos Longitudinais , Estudo Observacional
16.
Rev. cuba. cir ; 54(1): 34-42, ene.-mar. 2015.
Artigo em Espanhol | LILACS | ID: lil-754884

RESUMO

Introducción: el sangrado digestivo alto no variceal es una de las primeras causas de ingreso hospitalario en el país, en los últimos años se convirtió en un grave y sensible problema de salud. Objetivo: caracterizar el comportamiento de las variables demográficas, clínicas y terapéuticas en los pacientes ingresados por esta enfermedad en el servicio de urgencia de Cirugía General del Hospital Universitario General Calixto García desde junio del 2012 a diciembre 2013. Métodos: se realizó un estudio observacional, analítico, prospectivo y de vigilancia poscomercialización para demostrar la efectividad del uso del ácido tranexámico como variante terapéutica precoz para detener el sangrado y evitar el resangrado en los pacientes con sangrado digestivo alto no variceal. Resultados: de un total de 104 pacientes, predominó el sexo masculino y los mayores de 70 años con 61,5 por ciento y 37,5 por ciento, respectivamente. Consumían café en exceso 94 por ciento, más del 50 por ciento, alcohol, 37 por ciento tomaba medicamentos antiinflamatorios no esteroideos. Del total de pacientes, 61,5 por ciento y el 55,8 por ciento padecían de hipertensión arterial y de gastritis crónica, respectivamente. La melena fue la forma de presentación clínica más frecuente de esta enfermedad; la endoscopia de urgencia se le realizó solo al 25 por ciento de los casos y predominó como diagnóstico la pangastritis eritematosa en el 51,1 por ciento de los pacientes. El tratamiento quirúrgico fue excepcional solo en el 2,9 por ciento de los pacientes del estudio, la estadía hospitalaria fue en el 84 por ciento de los enfermos menor de 3 días y la mortalidad general muy baja de un 1,9 por ciento. Conclusiones: los efectos del uso del ácido tranexámico en los pacientes con sangrado digestivo alto no variceal fueron beneficiosos para el tratamiento de esta enfermedad, las evidencias de sangrado activo luego de la aplicación del medicamento se redujeron de forma relevante, el tratamiento quirúrgico fue excepcional y la mortalidad muy baja(AU)


Introduction: Non-variceal upper gastrointestinal bleeding is one of the first causes of hospitalization in our country and it has become a serious and sensitive health problem in the last few years. Objective: To characterize the behaviour of the demographic, clinical and therapeutic variables found in patients admitted to the emergency general surgery service of General Calixto Garcia university hospital due to this disease from June 2012 to December 2013. Methods: Observational, analytical, prospective and postmarket surveillance study to prove the effectiveness of the tranexamic acid as an early therapeutic variant to stop bleeding and avoid re-bleeding in those patients with non-variceal upper gastrointestinal bleeding. Results: In the study group of 104 patients, males and over 70 years-old people predominated for 61.5 percent and 37.5 percent, respectively. The coffee overconsumption was seen in 94 percent, more than 50 percent took alcohol and 37 percent had non-steroidal antinflammatory drugs treatment. Of the total number of patients, 61.5 percent and 55.8 percent suffered blood hypertension and chronic gastritis, respectively. Melena was the most frequent presentation of this disease; urgent endoscopoy was performed in just 25 percent of casos and the predominant diagnosis was erythematous pangastritis in 51.1 percent of patients. The surgical treatment was used in just 2.5 percent of the study patients, the lenght of stay at hospital was less than 3 days in 84 percent and very low overall mortality rate of 1.9 percent. Conclusions: The effects of the tranexamic acido n patients with non-variceal upper gastrointestinal bleeding were benefitial for treating the disease; evidence of active bleeding after the use of drug significantly decrease, surgical treatment was an exception and mortality rate was very low(AU)


Assuntos
Humanos , Masculino , Feminino , Hemorragia Gastrointestinal/complicações , Hemorragia Gastrointestinal/tratamento farmacológico , Hemorragia Gastrointestinal/epidemiologia , Ácido Tranexâmico/uso terapêutico , Estudo Observacional , Estudos Prospectivos
17.
Cir. parag ; 38(2): 26-29, dic. 2014. ilus
Artigo em Espanhol | LILACS, BDNPAR | ID: biblio-972562

RESUMO

Las duplicaciones intestinales son malformaciones congénitas poco frecuentes. Pueden localizarse desde la boca al ano. En general son asintomáticas, aunque pueden complicarse y manifestarse como hemorragia digestiva o abdomen agudo en aquellos casos en que se localiza a nivel abdominal. Esto obliga a tenerlo en cuenta como diagnóstico diferencial ante estos cuadros. En adultos, el diagnóstico suele darse de manera casual en el acto operatorio. Si bien la conducta es quirúrgica, con resección de la duplicación, ya sea total o parcial, en casos asintomáticos no complicados, esta conducta es controversial. Se presentan tres casos asintomáticos no complicados, diagnosticados casualmente en operaciones abdominales por otras causas, en la que se optó por tratamiento conservador. Dos de los casos fueron operados en el Hospital Regional del Luque y el tercero en el Instituto Nacional del Cáncer. Se hace una revisión del tema.


Intestinal duplications are infrequent congenital malformations. They can be located since the mouth to the anus. Generally they are asymptomatic, although they can be complicated and manifest themselves as a gastrointestinal bleeding or an acute abdomen in those cases that they are located in an abdominal level. These cases compel us to think in them as a differential diagnosis. In adults, the diagnosis usually occurs by chance during the surgical procedure. Although the behavior is surgical, with a partial or total resection of the duplication, it is controversial in those asymptomatic or not complicated cases. It is presented three asymptomatic and not complicated cases which were diagnosed by chance during abdominal surgeries for other causes, and where we chose a conservative treatment. Two out of the three cases were operated in the Hospital Regional de Luque and the third case was operated in the Instituto Nacional del Cáncer. It is made a review of the subject.


Assuntos
Masculino , Feminino , Humanos , Adulto , Pessoa de Meia-Idade , Anormalidades Congênitas , Intestino Delgado , Intestino Delgado/cirurgia
18.
Rev. peru. cardiol. (Lima) ; 38(3): 166-169, sept.-dic. 2013. ilus
Artigo em Espanhol | LILACS, LIPECS | ID: lil-722414

RESUMO

La cardiopatía de Tako-Tsubo es una entidad clínica de reciente descripción puede simular un infarto agudo de miocardio pero con una evolución y pronostico diferentes, generalmente se asocia una situación de estrés desencadenante con bolonamiento apical e hipercontratibilidad compensatoria de los segmentos basales del ventrículo izquierdo pero sin alteraciones significativas en las arteria coronarias.Nosotros reportamos un caso balonamiento apical transitorio del ventrículo izquierdo durante una ecocardiografía de stress con dobutamina cuya recuperación fue a los 15 días.


Assuntos
Humanos , Feminino , Idoso , Cardiomiopatia de Takotsubo , Dobutamina/uso terapêutico , Ecocardiografia sob Estresse
19.
Salud pública Méx ; 55(5): 498-504, Sep.-Oct. 2013. ilus
Artigo em Espanhol | LILACS | ID: lil-704789

RESUMO

Objetivo. Confirmar la presencia de dexametasona y diclofenaco como adulterantes de un producto comercializado como de origen natural. Material y métodos. Para la identificación y confirmación de la presencia de los fármacos se utilizó un método de análisis instrumental por cromatografía de líquidos de alta presión acoplado a espectrometría de masas en tándem. Resultados. En el análisis de 11 frascos de Reumofan Plus obtenidos de pacientes y médicos de la localidad se confirmó la presencia de dexametasona y diclofenaco. La metodología utilizada permitió separar los esteroisómeros dexametasona y betametasona, las abundancias relativas de iones productos 237.2 y 279.2 m/z permiten diferenciar espectralmente un compuesto de otro. Conclusiones. Se confirmó la presencia de dexametasona y diclofenaco en muestras de un producto comercializado como "100% natural" obtenidas de diferentes pacientes o médicos en el periodo enero a diciembre de 2011.


Objective. To confirm the presence of dexamethasone and diclofenac as adulterants of an herbal product. Materials and methods. For identificaction and confirmation of drugs a method of instrumental analysis by liquid chromatography coupled with high pressure tandem mass spectrometry was used. Results. The presence of dexamethasone and diclofenac was confirmed in samples of 11 bottles of Reumofan Plus obtained from patients and/or physicians. The methodology used, allowed separation of stereoisomers dexamethasone and betamethasone, the relative abundances of product ions 237.2 and 279.2 m / z spectrally differentiate the compounds. Conclusions. The presence of dexamethasone and diclofenac was confirmed in samples of a product marketed as "100% natural" obtained from patients and / or physicians in a period from January to December, 2011.


Assuntos
Anti-Inflamatórios não Esteroides/análise , Dexametasona/análise , Diclofenaco/análise , Contaminação de Medicamentos , Glucocorticoides/análise , Preparações de Plantas/química , Cromatografia Líquida , Espectrometria de Massas em Tandem
20.
J Virol ; 87(21): 11371-87, 2013 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-23946460

RESUMO

Sequences and structures within the terminal genomic regions of plus-strand RNA viruses are targets for the binding of host proteins that modulate functions such as translation, RNA replication, and encapsidation. Using murine norovirus 1 (MNV-1), we describe the presence of long-range RNA-RNA interactions that were stabilized by cellular proteins. The proteins potentially responsible for the stabilization were selected based on their ability to bind the MNV-1 genome and/or having been reported to be involved in the stabilization of RNA-RNA interactions. Cell extracts were preincubated with antibodies against the selected proteins and used for coprecipitation reactions. Extracts treated with antibodies to poly(C) binding protein 2 (PCBP2) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 significantly reduced the 5'-3' interaction. Both PCBP2 and hnRNP A1 recombinant proteins stabilized the 5'-3' interactions and formed ribonucleoprotein complexes with the 5' and 3' ends of the MNV-1 genomic RNA. Mutations within the 3' complementary sequences (CS) that disrupt the 5'-3'-end interactions resulted in a significant reduction of the viral titer, suggesting that the integrity of the 3'-end sequence and/or the lack of complementarity with the 5' end is important for efficient virus replication. Small interfering RNA-mediated knockdown of PCBP2 or hnRNP A1 resulted in a reduction in virus yield, confirming a role for the observed interactions in efficient viral replication. PCBP2 and hnRNP A1 induced the circularization of MNV-1 RNA, as revealed by electron microscopy. This study provides evidence that PCBP2 and hnRNP A1 bind to the 5' and 3' ends of the MNV-1 viral RNA and contribute to RNA circularization, playing a role in the virus life cycle.


Assuntos
Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Interações Hospedeiro-Patógeno , Norovirus/fisiologia , RNA Viral/metabolismo , Proteínas de Ligação a RNA/metabolismo , Replicação Viral , Animais , Imunoprecipitação da Cromatina , Técnicas de Silenciamento de Genes , Ribonucleoproteína Nuclear Heterogênea A1 , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Microscopia Eletrônica , Estabilidade de RNA , Proteínas de Ligação a RNA/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA