Schizophyllum commune fruiting body polysaccharides inhibit glioma by mediating ARHI regulation of PI3K/AKT signalling pathway.

Glioma poses a serious threat to human health and has a high mortality rate. Therefore, developing natural anti-tumour drugs for cancer treatment is an urgent priority. Schizophyllum commune is an edible and medicinal fungus, with polysaccharides as its main active components, which may have anti-tumour properties. Herein, we characterised S. commune fruiting body polysaccharides (SCFP) structure and evaluated its anti-glioma activity in vitro and in vivo. UV and FTIR spectra, high-performance gel chromatography, and monosaccharide composition analyses demonstrated that SCFP was a heteropolysaccharide with a molecular weight of 290.92 kDa. Among the monosaccharide compositions, mannose, galactose, and glucose were the most abundant. SCFP significantly inhibited the survival of the glioma cell lines U251 and U-87MG. U251 xenograft tumours treated with SCFP via gavage showed a 47.39 % inhibition, with no significant toxic side effects observed. SCFP upregulated aplasia Ras homologue member I (ARHI) expression, thereby regulating PI3K/AKT signalling, inhibiting tumour migration, and inducing apoptosis, to inhibit tumour growth. Furthermore, SCFP treatment increased the relative abundance of beneficial bacteria, including Akkermansia muciniphila, Ligilactobacillus murinus, and Parabacteroides goldsteinii, in tumour-bearing mice and restored the gut microbiota structure to that of the normal group (NG group) mice without tumours. Thus, SCFP has the potential for application as a natural anticancer drug.

First report of tomato as a natural host of tobacco vein banding mosaic virus (TVBMV) in Yunnan, China.

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

Three RNA helicase DDX genes are essential for the development and oocyte maturation in Laodelphax striatellus.

BACKGROUND: DEAD-box protein (DDX) is a member of the DDX RNA helicase family that exerts multiple functions in RNA metabolism, cell cycle, tumorigenesis, signal pathway, and fertility, particularly in mammals. Nevertheless, the biological functions of DDXs in insects have not been fully resolved and attracted increasing attention these years. Laodelphax striatellus (Hemiptera) is a notorious rice pest through feeding on rice sap and transmitting plant viruses. In this study, we aim to elucidate the functional characterization of DDXs in L. striatellus, and to exploit potential target genes for the development of pest control strategies. RESULTS: In this study, we characterized the expression patterns of LsDDX6, LsDDX47, and LsDDX51 in planthoppers and analyzed their conserved motifs. These genes were found to be expressed in all tissues and developmental stages examined, with significantly higher transcript levels observed in the ovary. Knockdown of LsDDX6, LsDDX47, and LsDDX51 resulted in an obvious lethal phenotype in nymphs and abnormal ovarian development in adults. Furthermore, a total of 27 DDXs were identified in L. striatellus, and most DDXs were highly expressed in ovary and structure analysis result revealed that all of the DDXs possessed nine motifs that were unique to the DDX family. CONCLUSION: The three DDX RNA helicases (LsDDX6, LsDDX47, and LsDDX51) are essential for both survivorship and reproduction in L. striatellus. Considering a total number of 27 DDXs identified in L. striatellus, they might serve as promising candidates for application in RNAi-based control of this destructive pest. © 2024 Society of Chemical Industry.

First report of potato virus H infecting tomato (Solanum lycopersicum) in China.

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

Genetic Characterization of Two Novel Insect-Infecting Negative-Sense RNA Viruses Identified in a Leaf Beetle, Aulacophora indica.

Herbivorous insects harbor a variety of insect-specific viruses (ISVs) some of which are considered to be valuable biological agents for potential applications in biological defense and control strategies. Leaf beetles with chewing mouthparts are particularly known for their capacity to disrupt plant tissue while feeding, often creating openings that can act as entry points for plant pathogens. In this study, we have identified two new negative-sense RNA viruses infecting the leaf beetle Aulacophora indica, an important member of the Chrysomelidae family. These recently discovered viruses belong to the viral families Nyamiviridae and Chuviridae and have been preliminarily named Aulacophora indica nyami-like virus 1 (AINlV1) and Aulacophora indica chu-like virus 1 (AIClV1), respectively. The complete genomic sequences of these viruses were obtained using rapid amplification of cDNA ends (RACE) techniques. Detailed analysis of their genomic structures has confirmed their similarity to other members within their respective families. Furthermore, analysis of virus-derived small interfering RNA (vsiRNA) demonstrated a high abundance and typical vsiRNA pattern of AINlV1 and AIClV1, offering substantial evidence to support their classification as ISVs. This research enhances our understanding of viral diversity within insects.

Endogenous nege-like viral elements in arthropod genomes reveal virus-host coevolution and ancient history of two plant virus families.

Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.

Complete genome sequence of a novel amalgavirus in sponge gourd, Luffa cylindrica.

A novel monopartite dsRNA virus, tentatively named "sponge gourd amalgavirus 1" (SGAV1), was discovered by high-throughput sequencing in sponge gourd (Luffa cylindrica) displaying mosaic symptoms in Jiashan County, Zhejiang Province, China. The genome of SGAV1 is 3,447 nucleotides in length and contains partially overlapping open reading frames (ORFs) encoding a putative replication factory matrix-like protein and a fusion protein, respectively. The fusion protein of SGAV1 shares 57.07% identity with the homologous protein of salvia miltiorrhiza amalgavirus 1 (accession no. DAZ91057.1). Phylogenetic analysis based on the RNA-dependent RNA polymerase (RdRp) protein suggests that SGAV1 belongs to the genus Amalgavirus of the family Amalgaviridae. Moreover, analysis of SGAV1-derived small interfering RNAs indicated that SGAV1 was actively replicating in the host plant. Semi-quantitative RT-PCR showed higher levels of SGAV1 expression in leaves than in flowers and fruits. This is the first report of a novel amalgavirus found in sponge gourd in China.

The plant-sucking insect selects assembly of the gut microbiota from environment to enhance host reproduction.

Plant-sucking insects have intricate associations with a diverse array of microorganisms to facilitate their adaptation to specific ecological niches. The midgut of phytophagous true bugs is generally structured into four distinct compartments to accommodate their microbiota. Nevertheless, there is limited understanding regarding the origins of these gut microbiomes, the mechanisms behind microbial community assembly, and the interactions between gut microbiomes and their insect hosts. In this study, we conducted a comprehensive survey of microbial communities within the midgut compartments of a bean bug Riptortus pedestris, soybean plant, and bulk soil across 12 distinct geographical fields in China, utilizing high-throughput sequencing of the 16 S rRNA gene. Our findings illuminated that gut microbiota of the plant-sucking insects predominantly originated from the surrounding soil environment, and plants also play a subordinate role in mediating microbial acquisition for the insects. Furthermore, our investigation suggested that the composition of the insect gut microbiome was probably shaped by host selection and/or microbe-microbe interactions at the gut compartment level, with marginal influence from soil and geographical factors. Additionally, we had unveiled a noteworthy dynamic in the acquisition of core bacterial taxa, particularly Burkholderia, which were initially sourced from the environment and subsequently enriched within the insect midgut compartments. This bacterial enrichment played a significant role in enhancing insect host reproduction. These findings contribute to our evolving understanding of microbiomes within the insect-plant-soil ecosystem, shedding additional light on the intricate interactions between insects and their microbiomes that underpin the ecological significance of microbial partnerships in host adaptation.

Identification and Characterization of Three Novel Solemo-like Viruses in the White-Backed Planthopper, Sogatella furcifera.

Agricultural insects play a crucial role in transmitting plant viruses and host a considerable number of insect-specific viruses (ISVs). Among these insects, the white-backed planthoppers (WBPH; Sogatella furcifera, Hemiptera: Delphacidae) are noteworthy rice pests and are responsible for disseminating the southern rice black-streaked dwarf virus (SRBSDV), a significant rice virus. In this study, we analyzed WBPH transcriptome data from public sources and identified three novel viruses. These newly discovered viruses belong to the plant-associated viral family Solemoviridae and were tentatively named Sogatella furcifera solemo-like virus 1-3 (SFSolV1-3). Among them, SFSolV1 exhibited a prevalent existence in different laboratory populations, and its complete genome sequence was obtained using rapid amplification of cDNA ends (RACE) approaches. To investigate the antiviral RNA interference (RNAi) response in WBPH, we conducted an analysis of virus-derived small interfering RNAs (vsiRNAs). The vsiRNAs of SFSolV1 and -2 exhibited typical patterns associated with the host's siRNA-mediated antiviral immunity, with a preference for 21- and 22-nt vsiRNAs derived equally from both the sense and antisense genomic strands. Furthermore, we examined SFSolV1 infection and distribution in WBPH, revealing a significantly higher viral load of SFSolV1 in nymphs' hemolymph compared to other tissues. Additionally, in adult insects, SFSolV1 exhibited higher abundance in male adults than in female adults.

Complete genome sequence and genetic characterization of a novel segmented RNA virus infecting Nilaparvata lugens.

The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.

Molecular and biological characterization of a bunyavirus infecting the brown planthopper (Nilaparvata lugens).

A negative-strand symbiotic RNA virus, tentatively named Nilaparvata lugens Bunyavirus (NLBV), was identified in the brown planthopper (BPH, Nilaparvata lugens). Phylogenetic analysis indicated that NLBV is a member of the genus Mobuvirus (family Phenuiviridae, order Bunyavirales). Analysis of virus-derived small interfering RNA suggested that antiviral immunity of BPH was successfully activated by NLBV infection. Tissue-specific investigation showed that NLBV was mainly accumulated in the fat-body of BPH adults. Moreover, NLBV was detected in eggs of viruliferous female BPHs, suggesting the possibility of vertical transmission of NLBV in BPH. Additionally, no significant differences were observed for the biological properties between NLBV-infected and NLBV-free BPHs. Finally, analysis of geographic distribution indicated that NLBV may be prevalent in Southeast Asia. This study provided a comprehensive characterization on the molecular and biological properties of a symbiotic virus in BPH, which will contribute to our understanding of the increasingly discovered RNA viruses in insects.

Complete genome analysis of a novel narnavirus in sweet viburnum (Viburnum odoratissimum).

Trees and shrubs provide important ecological services. However, few studies have surveyed the virome in trees and shrubs. In this study, we discovered a new positive-sense RNA virus originating from Viburnum odoratissimum, which we named "Vo narna-like virus". The complete genome of Vo narna-like virus is 3,451 nt in length with an open reading frame (ORF) encoding the RNA-dependent RNA polymerase (RdRP) protein. Phylogenetic analysis placed this virus within the betanarnavirus clade, sharing 53.63% amino acid sequence identity with its closest relative, Qingdao RNA virus 2. The complete sequence of the virus was confirmed by rapid amplification of cDNA ends (RACE) and Sanger sequencing. Small interfering RNA (siRNA) analysis indicated that this virus interacts with the RNA interference (RNAi) pathway of V. odoratissimum. This is the first report of a narnavirus in V. odoratissimum.

First report of citrus leaf blotch virus infecting Forsythia viridissima in China.

Green-stem forsythia (Forsythia viridissima), also known as golden bell, is cultivated widely in China as an early spring flowering shrub. In July 2020, yellow or white vein clearing symptoms on leaves were observed in approximate 15% golden bell plants along a landscape river in Ningbo city, Zhejiang province, China. Symptomatic leaves from six different plants were collected and pooled. Total RNA was extracted from about 200 mg pooled sample using TRIzol Reagent (Invitrogen, Carlsbad, USA) and used for high-throughput sequencing (HTS). The cDNA library was constructed using a TruSeq RNA Sample Preparation Kit (Illumina) and an Illumina NovaSeq 6000 platform was utilized to yield 150 nt paired-end reads. CLC Genomic Workbench 11 (QIAGEN) with default parameters were used for data analysis. A total of 41,604,174 paired-end reads were obtained, and 156,853 contigs (16 - 26,665 nt) were generated de novo and compared with sequences in the NCBI nt and nr database using BLASTn and BLASTx, respectively. A total of 197,277 reads were mapped to the citrus leaf blotch virus (CLBV; genus Citrivirus, family Betaflexiviridae) genome with an average coverage of 3191×. A contig of 8783 nt (excluding the poly(A) tail) was aligned to CLBV isolate Vib (accession No. OP751940) by BLASTn with the highest nt sequence identity of 99.7% and 99% query coverage, suggesting that the samples were infected with CLBV (Myung-Hwi Kim et al. 2023). No other virus was detected by this analysis. Subsequently, leaves of the six plants collected above, three plants with mild chlorotic symptoms and three plants without obvious symptoms were tested separately by RT-PCR and all were positive for CLBV. Sap from multiple symptomatic F. viridissima leaves was mechanically inoculated to Nicotiana benthamiana, N. tabacum and Datura stramonium in sextuplicate, but after two months, none of the inoculated plants had obvious symptoms and all of them tested negative for CLBV using RT-PCR. To determine the genome sequence of CLBV present in F. viridissima, a single sample from one plant was selected for genome validtion. The contig sequence was confirmed by Sanger sequencing of RT-PCR products amplified using CLBV-specific primers, and the 5' terminal sequence of the virus was determined using a commercial SUPERSWITCH RACE cDNA Synthesis Kit (Tiosbio, Beijing, China). The complete genomic sequence of CLBV isolated from F. viridissima was 8787 nts long, excluding the poly(A) tail, has the expected three predicted ORFs and was deposited in the GenBank database (accession no. OR766026). Phylogenetic analysis of different CLBV genome sequences from fruit trees and other hosts in GenBank using MEGA11 showed that the golden bell isolate was most closely related to isolate Vib (OP751940) from Viburnum lentago in South Korea, with which it was almost identical (99.7% complete nt sequence identity and >99% aa sequence identity in each of the three ORFs). Ten viruses have been previously reported from Forsythia spp. (Kaminska, M. 1985; Lee et al. 1997), but this is the first report of CLBV in this host. CLBV mainly infects citrus, kiwifruit and apple causing mosaic, chlorosis or yellow vein clearing symptoms, however, bud union disorder was observed in 'Nagami' kumquat infected by CLBV, which caused serious production losses (Cao et al. 2017; Li et al. 2018; Liu et al. 2019; Galipienso et al. 2001). Therefore, further investigation is needed to assess if F. viridissima can be an intermediate host to transfer CLBV to other crops.

Pre-operative enhanced magnetic resonance imaging combined with clinical features predict early recurrence of hepatocellular carcinoma after radical resection.

BACKGROUND: Indentifying predictive factors for postoperative recurrence of hepatocellular carcinoma (HCC) has great significance for patient prognosis. AIM: To explore the value of gadolinium ethoxybenzyl diethylenetriamine pentaacetic acid (Gd-EOB-DTPA) enhanced magnetic resonance imaging (MRI) combined with clinical features in predicting early recurrence of HCC after resection. METHODS: A total of 161 patients with pathologically confirmed HCC were enrolled. The patients were divided into early recurrence and non-early recurrence group based on the follow-up results. The clinical, laboratory, pathological results and Gd-EOB-DTPA enhanced MRI imaging features were analyzed. RESULTS: Of 161 patients, 73 had early recurrence and 88 were had non-early recurrence. Univariate analysis showed that patient age, gender, serum alpha-fetoprotein level, the Barcelona Clinic Liver Cancer stage, China liver cancer (CNLC) stage, microvascular invasion (MVI), pathological satellite focus, tumor size, tumor number, tumor boundary, tumor capsule, intratumoral necrosis, portal vein tumor thrombus, large vessel invasion, nonperipheral washout, peritumoral enhancement, hepatobiliary phase (HBP)/tumor signal intensity (SI)/peritumoral SI, HBP peritumoral low signal and peritumoral delay enhancement were significantly associated with early recurrence of HCC after operation. Multivariate logistic regression analysis showed that patient age, MVI, CNLC stage, tumor boundary and large vessel invasion were independent predictive factors. External data validation indicated that the area under the curve of the combined predictors was 0.861, suggesting that multivariate logistic regression was a reasonable predictive model for early recurrence of HCC. CONCLUSION: Gd-EOB-DTPA enhanced MRI combined with clinical features would help predicting the early recurrence of HCC after operation.

Cross-kingdom RNA interference mediated by insect salivary microRNAs may suppress plant immunity.

Communication between insects and plants relies on the exchange of bioactive molecules that traverse the species interface. Although proteinic effectors have been extensively studied, our knowledge of other molecules involved in this process remains limited. In this study, we investigate the role of salivary microRNAs (miRNAs) from the rice planthopper Nilaparvata lugens in suppressing plant immunity. A total of three miRNAs were confirmed to be secreted into host plants during insect feeding. Notably, the sequence-conserved miR-7-5P is specifically expressed in the salivary glands of N. lugens and is secreted into saliva, distinguishing it significantly from homologues found in other insects. Silencing miR-7-5P negatively affects N. lugens feeding on rice plants, but not on artificial diets. The impaired feeding performance of miR-7-5P-silenced insects can be rescued by transgenic plants overexpressing miR-7-5P. Through target prediction and experimental testing, we demonstrate that miR-7-5P targets multiple plant genes, including the immune-associated bZIP transcription factor 43 (OsbZIP43). Infestation of rice plants by miR-7-5P-silenced insects leads to the increased expression of OsbZIP43, while the presence of miR-7-5P counteracts this upregulation effect. Furthermore, overexpressing OsbZIP43 confers plant resistance against insects which can be subverted by miR-7-5P. Our findings suggest a mechanism by which herbivorous insects have evolved salivary miRNAs to suppress plant immunity, expanding our understanding of cross-kingdom RNA interference between interacting organisms.

The genomic history and global migration of a windborne pest.

Many insect pests, including the brown planthopper (BPH), undergo windborne migration that is challenging to observe and track. It remains controversial about their migration patterns and largely unknown regarding the underlying genetic basis. By analyzing 360 whole genomes from around the globe, we clarify the genetic sources of worldwide BPHs and illuminate a landscape of BPH migration showing that East Asian populations perform closed-circuit journeys between Indochina and the Far East, while populations of Malay Archipelago and South Asia undergo one-way migration to Indochina. We further find round-trip migration accelerates population differentiation, with highly diverged regions enriching in a gene desert chromosome that is simultaneously the speciation hotspot between BPH and related species. This study not only shows the power of applying genomic approaches to demystify the migration in windborne migrants but also enhances our understanding of how seasonal movements affect speciation and evolution in insects.

Inhibition of Rice Stripe Virus Accumulation by Polyubiquitin-C in Laodelphax striatellus.

Many hosts utilize the ubiquitin system to defend against viral infection. As a key subunit of the ubiquitin system, the role of polyubiquitin in the viral infection of insects is unclear. Here, we identified the full-length cDNA of the polyubiquitin-C (UBC) gene in Laodelphax striatellus, the small brown planthopper (SBPH). LsUBC was expressed in various tissues and was highly expressed in salivary glands, midgut, and reproductive systems. Furthermore, the LsUBC expression profiles in the developmental stages showed that LsUBC was ubiquitously expressed in seven developmental stages and was highest expressed in female adults with SBPH. qRT-PCR analyses indicated that rice stripe virus (RSV) infection promoted the LsUBC expression. Knockdown of LsUBC mRNA via RNA interference increased RSV accumulation. These findings suggest that LsUBC inhibits RSV accumulation in L. striatellus.

Salivary proteins potentially derived from horizontal gene transfer are critical for salivary sheath formation and other feeding processes.

Herbivorous insects employ an array of salivary proteins to aid feeding. However, the mechanisms behind the recruitment and evolution of these genes to mediate plant-insect interactions remain poorly understood. Here, we report a potential horizontal gene transfer (HGT) event from bacteria to an ancestral bug of Eutrichophora. The acquired genes subsequently underwent duplications and evolved through co-option. We annotated them as horizontal-transferred, Eutrichophora-specific salivary protein (HESPs) according to their origin and function. In Riptortus pedestris (Coreoidea), all nine HESPs are secreted into plants during feeding. The RpHESP4 to RpHESP8 are recently duplicated and found to be indispensable for salivary sheath formation. Silencing of RpHESP4-8 increases the difficulty of R. pedestris in probing the soybean, and the treated insects display a decreased survivability. Although silencing the other RpHESPs does not affect the salivary sheath formation, negative effects are also observed. In Pyrrhocoris apterus (Pyrrhocoroidea), five out of six PaHESPs are secretory salivary proteins, with PaHESP3 being critical for insect survival. The PaHESP5, while important for insects, no longer functions as a salivary protein. Our results provide insight into the potential origin of insect saliva and shed light on the evolution of salivary proteins.

Organocatalytic enantioselective decarboxylative protonation of α-alkyl-α-aryl malonate monoesters.

In contrast to the well-established enzymatic enantioselective decarboxylative protonation (EDP), the corresponding chemocatalytic reactions of acyclic malonic acid derivatives remain challenging. Herein, we developed a biomimetic EDP of α-alkyl-α-aryl malonate monoesters using a chiral 1,2-trans-diaminocyclohexane-based N-sulfonamide as an organocatalyst. The method demonstrates excellent chemical yields, good enantioselectivity, mild reaction conditions, and the generation of only CO2 as waste.

Selective oxidation of ß-keto ester modulated by the d-band centers in D-A conjugated microporous metallaphotoredox catalysts containing M-salen (MZn, Cu and Co) and triazine monomers.

Photocatalytic selective oxidation plays an important role in developing green chemistry. However, it is challenging to design an efficient photocatalyst for controlling the selectivity of photocatalytic oxidation reaction and exploring its detailed mechanism. Here, we synthesized three conjugated microporous polymers (CMPs) with D-A structures, named M-SATE-CMPs (MZn, Cu and Co), with different d-band centers based on different metal centers, resulting in the discrepancy in adsorption and activation capacities for the reactants, which produces the selectivity of ß-keto esters being catalyzed into α-hydroperoxide ß-keto esters (ROOH) or to α-hydroxyl ß-keto esters (ROH). Density functional theory (DFT) calculations also demonstrate that the adsorption and activation capacities of the metal active centers in M-SATE-CMPs (MZn, Cu and Co) for ROOH are the key factors to influence the photocatalytic selective oxidation of ß-keto ester. This study provides a promising strategy for designing a metallaphotoredox catalyst whose photocatalytic selectivity depends on the d-band center of metal site in the catalyst.