The impact of long-term (≥5 years) cholecystectomy on gut microbiota changes and its influence on colorectal cancer risk: based on 16S rDNA sequencing analysis.

BACKGROUND: Colorectal cancer (CRC) continues to be a major global health concern. Recent advances in molecular biology have highlighted the gut microbiota's role in CRC. This study investigates long-term (≥5 years) gut microbiota changes in patients postcholecystectomy, comparing them with CRC patients and healthy controls to assess their impact on CRC development. METHODS: Sixty participants were divided into three groups: 20 healthy controls, 20 postcholecystectomy (PCE) patients, and 20 CRC patients. Demographic data and stool samples were collected. Gut microbiota composition, abundance, and diversity were analyzed using high-throughput 16S rDNA sequencing. RESULTS: Significant differences in microbial community, α-diversity (P < 0.05) and ß-diversity (P = 0.006), were observed among the three groups. At the phylum level, Firmicutes abundance was significantly reduced in PCE and CRC groups compared with the control group (P = 0.002), while changes in other phyla were not significant (P>0.05). At the genus level, Bacteroides, Dialister, and Parabacteroides increased progressively from control to PCE to CRC groups (P = 0.004, 0.001, and 0.002). Prevotella decreased across these groups (P = 0.041). Faecalibacterium and Roseburia abundances were reduced in PCE and CRC groups compared with controls (P = 0.001 and 0.003). The Random Forest algorithm identified Parabacteroides, Bacteroides, Roseburia, and Dialister as key distinguishing genera. CONCLUSION: The gut microbiota of long-term (≥5 years) PCE patients significantly differs from that of controls and resembles that of CRC patients, suggesting a potential link between cholecystectomy and CRC development through key microbial changes.

Anterior cingulate cortex provides the neural substrates for feedback-driven iteration of decision and value representation.

Adjusting decision-making under uncertain and dynamic situations is the hallmark of intelligence. It requires a system capable of converting feedback information to renew the internal value. The anterior cingulate cortex (ACC) involves in error and reward events that prompt switching or maintenance of current decision strategies. However, it is unclear whether and how the changes of stimulus-action mapping during behavioral adaptation are encoded, nor how such computation drives decision adaptation. Here, we tracked ACC activity in male mice performing go/no-go auditory discrimination tasks with manipulated stimulus-reward contingencies. Individual ACC neurons integrate the outcome information to the value representation in the next-run trials. Dynamic recruitment of them determines the learning rate of error-guided value iteration and decision adaptation, forming a non-linear feedback-driven updating system to secure the appropriate decision switch. Optogenetically suppressing ACC significantly slowed down feedback-driven decision switching without interfering with the execution of the established strategy.

Effect of Chloroquine on Type 2 Inflammatory Response in MC903-Induced Atopic Dermatitis Mice.

Introduction: Atopic dermatitis (AD) is a chronic, non-infectious inflammatory dermatosis. Chloroquine (CQ) has long been proven to possess anti-inflammatory properties. Objective: This paper aims to investigate the impact of CQ on type 2 inflammatory response in MC903-induced AD mice. Methods: An AD mouse model was established via MC903 induction. After CQ treatment, AD mice were intraperitoneally injected with polyinosinic: polycyclic acid [poly (I:C)] or Nigericin. Dermatitis severity was scored, and the thickness of the left ear was measured. The pathological changes in mouse skin tissues were observed by H&E staining. The number of mast cells was counted via TB staining. The content of peripheral blood T-helper 2 (Th2) cells and levels of immunoglobulin E (IgE), thymic stromal-derived lymphopoietin (TSLP), interleukin (IL)-4, IL-13, interferon (IFN)-γ, IL-1ß, and IL-18 were assessed by flow cytometry and ELISA. The levels of toll-like receptor 3 (TLR3), NLRP3, ASC, and cleaved caspase-1 proteins in skin tissues were determined by Western blot. Results: CQ treatment abated dermatitis severity and left ear thickness in AD mice, alleviated skin damage, reduced mast cell number, diminished IgE, TSLP, IL-4, and IL-13 levels, and peripheral blood Th2 cell content, with no significant changes in IFN-γ level. CQ alleviated type 2 inflammatory response in AD mice by inhibiting the activation of TLR3. CQ suppressed NLRP3 inflammasome activation. Activating TLR3/NLRP3 annulled CQ-mediated alleviation on type 2 inflammatory response in AD mice. Conclusion: CQ alleviated type 2 inflammatory response in AD mice by inhibiting TLR3 activation and NLRP3 inflammasome activation.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Encapsulation of phenolic acids within food-grade carriers systems: a systematic review.

Phenolic acids are natural compounds with potential therapeutic effects against various diseases. However, their incorporation into food and pharmaceutical products is limited by challenges such as instability, low solubility, and reduced bioavailability. This systematic review summarizes recent advances in phenolic acid encapsulation using food-grade carrier systems, focusing on proteins, lipids, and polysaccharides. Encapsulation efficiency, release behavior, and bioavailability are examined, as well as the potential health benefits of encapsulated phenolic acids in food products. Strategies to address limitations of current encapsulation systems are also proposed. Encapsulation has emerged as a promising method to enhance the stability and bioavailability of phenolic acids in food products, and various encapsulation technologies have been developed for this purpose. The use of proteins, lipids, and carbohydrates as carriers in food-grade encapsulation systems remains a common approach, but it is associated with certain limitations. Future research on phenolic acid encapsulation should focus on developing environmentally friendly, organic solvent-free, low-energy, scalable, and stable encapsulation systems, as well as co-encapsulation methods that combine multiple phenolic acids or phenolic acids with other bioactive substances to produce synergistic effects.

CAR T Cell Membrane Camouflaged Nanocatalyst Augments CAR T Cell Therapy Efficacy Against Solid Tumor.

The immunosuppressive tumor microenvironment (TME) reduces the chimeric antigen receptor (CAR) T-cell therapy against solid tumors. Here, a CAR T cell membrane-camouflaged nanocatalyst (ACSP@TCM) is prepared to augment CAR T cell therapy efficacy against solid tumors. ACSP@TCM is prepared by encapsulating core/shell Au/Cu2- xSe and 3-bromopyruvate with a CAR T cell membrane. It is demonstrated that the CAR T cell membrane camouflaging has much better-targeting effect than the homologous tumors cell membrane camouflaging. ACSP@TCM has an appealing synergistic chemodynamic/photothermal therapy (CDT/PTT) effect that can induce the immunogenic cell death (ICD) of NALM 6 cells. Moreover, 3-bromopyruvate can inhibit the efflux of lactic acid by inhibiting the glycolysis process, regulating the acidity of TME, and providing a more favorable environment for the survival of CAR T cells. In addition, the photoacoustic (PA) imaging and computed tomography (CT) imaging performance can guide the ACSP@TCM-mediated tumor therapy. The results demonstrated that the ACSP@TCM significantly enhanced the CAR T cell therapy efficacy against NALM 6 solid tumor mass, and completely eliminated tumors. This work provides an effective tumor strategy for CAR T cell therapy in solid tumors.

Identification of Novel NSD1 variations in four Pediatric cases with sotos Syndrome.

OBJECTIVE: Sotos syndrome (SOTOS) is an uncommon genetic condition that manifests itself with the following distinctive features: prenatal overgrowth, facial abnormalities, and intellectual disability. This disorder is often associated with haploinsufficiency of the nuclear receptor-binding SET domain protein 1 (NSD1)gene. We investigated four pediatric cases characterized by early-onset overgrowth and developmental delay. The primary objective of this study was to achieve accurate genetic diagnoses. DESIGN&METHODS: A sequential analysis approach comprising chromosomal karyotyping, whole exome sequencing, and microarray analysis was conducted. RESULTS: All four cases exhibited variations in the NSD1 gene, with the identification of four previously unreported de novo variants, each specific to one case.Specifically, Case 1 carried the NSD1 (NM_022455): c.2686 C > T(p.Q896X) variant, Case 2 had the NSD1 (NM_022455): c.2858_2859delCT(p.S953X) variant, Case 3 displayed a chromosomal aberration, chr5: 5q35.2q35.3(176,516,604-176,639,249)×1, which encompassed the 5'-untranslated region of NSD1, and Case 4 harbored the NSD1 (NM_022455): c.6397T > G(p.C2133G) variant. CONCLUSION: This study not only provided precise diagnoses for these cases but also supplied significant evidence to facilitate informed consultations. Furthermore, our findings expanded the spectrum of mutations associated with SOTOS.

Early predictor for differentiation syndrome in newly diagnosed acute promyelocytic leukaemia patients treated with single-agent arsenic trioxide.

Differentiation syndrome (DS) is the second leading cause of death in acute promyelocytic leukaemia (APL) patients. Few studies have tested predictors of DS events. This study aimed to identify optimized predictors of DS events related to APL. The data of 298 consecutive patients who were newly diagnosed with APL between December 2012 and June 2023 were retrospectively investigated. A systematic review of computer-based patient medical records was conducted to obtain clinical data, including baseline characteristics, routine blood examination findings, biochemical indices and clinical manifestations of DS. Among the 298 patients, 158 were classified into the no-DS group, while 140 had DS. Compared with those of patients without DS, the peripheral blast count, age, and WBC count at each time point were significantly different in patients with DS (P < 0.05 for all time points). Generalized linear mixed models (GLMMs) revealed that WBC Double (Coeff. 0.442, P = 0.000) and WBCPeak (Coeff. 0.879, P = 0.000) were independent risk factors for DS. The frequencies of clinical manifestations of unexplained fever (P = 0.003), dyspnoea (P = 0.002), weight gain of more than 5 kg (P = 0.006), pleural effusion (P = 0.001), pulmonary infiltrates (P < 0.001), pericardial effusion (P = 0.002) and renal failure (P = 0.006) were considerably lower in moderate DS patients than in severe DS patients. The WBCDouble occurs earlier than the WBCpeak occurrence, so WBC Double might be a new indicator of DS.

Functional assessment of a novel biallelic MYH3 variation causing CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B).

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.

Study on the Permeability and Absorption Performance of the Crotch Layer in Seamless Knitted Period Underwear.

During the physiological period, women have the problem of lateral and posterior leakage, and they expect to have period underwear that can reduce lateral and posterior leakage. This study is combined with menstrual needs, and in the crotch penetration layer, three types of yarns are used, seaweed viscose yarn, apocynum viscose yarn, and viscose yarn, as well as two fabric structures: honeycomb-shaped convex-concave stitching and grid-shaped convex point stitching. In the crotch absorption layer, three types of yarns are used, modal yarn, bamboo yarn, and viscose yarn, as well as two fabric structures: plush stitching and plain stitching. The above two parts establish a sample scheme according to full-factor experimental tests, and 12 knitted fabric samples were knitted. The experimental data were analyzed through SPSS one-way ANOVA. The results indicate that in terms of veil raw materials, the crotch penetration layer with seaweed viscose yarn has better penetration performance, while the crotch absorption layer with bamboo yarn has better absorption performance. In terms of fabric structure, the crotch penetration layer with grid-shaped convex point stitching has better penetration performance, while the crotch absorption layer with plush stitching has better absorption performance. This study provides a theoretical basis for the development of period underwear.

SGMS1 facilitates osteogenic differentiation of MSCs and strengthens osteogenesis-angiogenesis coupling by modulating Cer/PP2A/Akt pathway.

Mesenchymal stem cell (MSC)-mediated coupling of osteogenesis and angiogenesis is a critical phenomenon in bone formation. Herein, we investigated the role and mechanism of SGMS1 in the osteogenic differentiation of MSCs and, in combination with osteogenesis and angiogenesis, to discover new therapeutic targets for skeletal dysplasia and bone defects. SGMS1 addition accelerated MSC osteogenic differentiation, whereas SGMS1 silencing suppressed this process. Moreover, SGMS1 overexpression inhibited ceramide (Cer) and promoted sphingomyelin (SM) levels. SM treatment neutralized the suppressive effect of shSGMS1 on osteogenesis. SGMS1 restrained PP2A activity by regulating Cer/SM metabolism and thus enhanced the levels of phosphorylated Akt, Runx2, and vascular endothelial growth factor (VEGF). Furthermore, SGMS1 transcription was regulated by Runx2. SGMS1 increased MSC-mediated angiogenesis by promoting VEGF expression. SGMS1 addition promoted rat bone regeneration in vivo. In conclusion, SGMS1 induces osteogenic differentiation of MSCs and osteogenic-angiogenic coupling through the regulation of the Cer/PP2A/Akt signaling pathway.

Integrated genomic and proteomic analyses identify PYGL as a novel experimental therapeutic target for clear cell renal cell carcinoma.

Sunitinib, the first-line targeted therapy for metastatic clear cell renal cell carcinoma (ccRCC), faces a significant challenge as most patients develop acquired resistance. Integrated genomic and proteomic analyses identified PYGL as a novel therapeutic target for ccRCC. PYGL knockdown inhibited cell proliferation, cloning capacity, migration, invasion, and tumorigenesis in ccRCC cell lines. PYGL expression was increased in sunitinib-resistant ccRCC cell lines, and CP-91149 targeting the PYGL could restore drug sensitivity in these cell lines. Moreover, chromatin immune-precipitation assays revealed that PYGL upregulation is induced by the transcription factor, hypoxia-inducible factor 1α. Overall, PYGL was identified as a novel diagnostic biomarker by combining genomic and proteomic approaches in ccRCC, and sunitinib resistance to ccRCC may be overcome by targeting PYGL.

Dynamics of carbon storage driven by land use/land cover transformation in coal mining areas with a high groundwater table: A case study of Yanzhou Coal Mine, China.

Intensive anthropogenic activities have led to drastic changes in land use/land cover (LULC) and impacted the carbon storage in high-groundwater coal basins. In this paper, we conduct a case study on the Yanzhou Coalfield in Shandong Province of China. We further classify waterbodies by using the Google Earth Engine (GEE) to better investigate the process of LULC transformation and the forces driving it in four periods from 1985 to 2020 (i.e., 1985-1995, 1995-2005, 2005-2015, and 2015-2020). We modeled the spatiotemporal dynamics of carbon storage by using InVEST based on the transformation in LULC and its drivers, including mining (M), reclamation (R), urbanization and village relocation (U), and ecological restoration (E). The results indicate that carbon storage had depleted by 19.69 % (321099.06 Mg) owing to intensive transformations in LULC. The area of cropland shrank with the expansion of built-up land and waterbodies, and 56.31 % of the study area underwent transitions in land use in the study period. U was the primary driver of carbon loss while E was the leading driver of carbon gain. While the direct impact of M on carbon loss accounted for only 5.23 % of the total, it affected urbanization and led to village relocation. R led to the recovery of cropland and the reclamation of water for aquaculture, which in turn improved the efficiency of land use. However, it contributed only 2.09 % to the total increase in carbon storage. Numerous complicated and intertwined processes (211) drove the changes in carbon storage in the study area. The work here provides valuable information for decision-makers as well as people involved in reclamation and ecological restoration to better understand the link between carbon storage and the forces influencing it. The results can be used to integrate the goals of carbon sequestration into measures for land management.

Regulation of PM2.5 on mitochondrial damage in H9c2 cells through miR-421/SIRT3 pathway and protective effect of miR-421 inhibitor and resveratrol.

Fine particulate matter (PM2.5) exposure is associated with cardiovascular disease (CVD) morbidity and mortality. Mitochondria are sensitive targets of PM2.5, and mitochondrial dysfunction is closely related to the occurrence of CVD. The epigenetic mechanism of PM2.5-triggered mitochondrial injury of cardiomyocytes is unclear. This study focused on the miR-421/SIRT3 signaling pathway to investigate the regulatory mechanism in cardiac mitochondrial dynamics imbalance in rat H9c2 cells induced by PM2.5. Results illustrated that PM2.5 impaired mitochondrial function and caused dynamics homeostasis imbalance. Besides, PM2.5 up-regulated miR-421 and down-regulated SIRT3 gene expression, along with decreasing p-FOXO3a (SIRT3 downstream target gene) and p-Parkin expression and triggering abnormal expression of fusion gene OPA1 and fission gene Drp1. Further, miR-421 inhibitor (miR-421i) and resveratrol significantly elevated the SIRT3 levels in H9c2 cells after PM2.5 exposure and mediated the expression of SOD2, OPA1 and Drp1, restoring the mitochondrial morphology and function. It suggests that miR-421/SIRT3 pathway plays an epigenetic regulatory role in mitochondrial damage induced by PM2.5 and that miR-421i and resveratrol exert protective effects against PM2.5-incurred cardiotoxicity.

NTRK1 knockdown induces mouse cognitive impairment and hippocampal neuronal damage through mitophagy suppression via inactivating the AMPK/ULK1/FUNDC1 pathway.

Hippocampal neuronal damage may induce cognitive impairment. Neurotrophic tyrosine kinase receptor 1 (NTRK1) reportedly regulates neuronal damage, although the underlying mechanism remains unclear. The present study aimed to investigate the role of NTRK1 in mouse hippocampal neuronal damage and the specific mechanism. A mouse NTRK1-knockdown model was established and subjected to pre-treatment with BAY-3827, followed by a behavioral test, Nissl staining, and NeuN immunofluorescence (IF) staining to evaluate the cognitive impairment and hippocampal neuronal damage. Next, an in vitro analysis was conducted using the CCK-8 assay, TUNEL assay, NeuN IF staining, DCFH-DA staining, JC-1 staining, ATP content test, mRFP-eGFP-LC3 assay, and LC3-II IF staining to elucidate the effect of NTRK1 on mouse hippocampal neuronal activity, apoptosis, damage, mitochondrial function, and autophagy. Subsequently, rescue experiments were performed by subjecting the NTRK1-knockdown neurons to pre-treatment with O304 and Rapamycin. The AMPK/ULK1/FUNDC1 pathway activity and mitophagy were detected using western blotting (WB) analysis. Resultantly, in vivo analysis revealed that NTRK1 knockdown induced mouse cognitive impairment and hippocampal tissue damage, in addition to inactivating the AMPK/ULK1/FUNDC1 pathway activity and mitophagy in the hippocampal tissues of mice. The treatment with BAY-3827 exacerbated the mouse depressive-like behavior induced by NTRK1 knockdown. The results of in vitro analysis indicated that NTRK1 knockdown attenuated viability, NeuN expression, ATP production, mitochondrial membrane potential, and mitophagy, while enhancing apoptosis and ROS production in mouse hippocampal neurons. Conversely, pre-treatment with O304 and rapamycin abrogated the suppression of mitophagy and the promotion of neuronal damage induced upon NTRK1 silencing. Conclusively, NTRK1 knockdown induces mouse hippocampal neuronal damage through the suppression of mitophagy via inactivating the AMPK/ULK1/FUNDC1 pathway. This finding would provide insight leading to the development of novel strategies for the treatment of cognitive impairment induced due to hippocampal neuronal damage.

Protein Labeling Facilitates the Understanding of Protein Corona Formation via Fluorescence Resonance Energy Transfer and Fluorescence Correlation Spectroscopy.

Once nanoparticles enter into the biological milieu, nanoparticle-biomacromolecule complexes, especially the protein corona, swiftly form, which cause obvious effects on the physicochemical properties of both nanoparticles and proteins. Here, the thermodynamic parameters of the interactions between water-soluble GSH-CdSe/ZnS core/shell quantum dots (GSH-QDs) and human serum albumin (HSA) were investigated with the aid of labeling fluorescence of HSA. It was proved that the labeling fluorescence originating from a fluorophore (BDP-CN for instance) could be used to investigate the interactions between QDs and HSA. Gel electrophoresis displayed that the binding ratio between HSA and QDs was ∼2:1 by direct visualization. Fluorescence resonance energy transfer (FRET) results indicated that the distance between the QDs and the fluorophore BDP-CN in HSA was 7.2 nm, which indicated that the distance from the fluorophore to the surface of the QDs was ∼4.8 nm. Fluorescence correlation spectroscopy (FCS) results showed that HSA formed a monolayer of a protein corona with a thickness of 5.5 nm. According to the spatial structure of HSA, we could speculate that the binding site of QDs was located at the side edge (not the triangular plane) of HSA with an equilateral triangular prism. The elaboration of the thermodynamic parameters, binding ratio, and interaction orientation will highly improve the fundamental understanding of the formation of protein corona. This work has guiding significance for the exploration of the interactions between proteins and nanomaterials.

RBM25 induces trophoblast epithelial-mesenchymal transition and preeclampsia disorder by enhancing the positive feedback loop between Grhl2 and RBM25.

Defects in migration and invasion caused by dysregulation of trophoblast epithelial-mesenchymal transformation (EMT) are one of the key factors in the pathogenesis of preeclampsia (PE). RNA-binding motif protein 25 (RBM25) is an RNA-binding protein involved in a variety of cellular processes, including cell proliferation, apoptosis, cell migration and invasion, and EMT. However, the expression and function of RBM25 in placental of PE remain unclear. In this study, we reveal that the expression of RBM25 is significantly elevated in PE placental tissue. RBM25 depletion and over-expression in trophoblast cells increase and decrease, respectively, cell migration and invasion by regulating EMT marker E-cadherin and Vimentin expression. Mechanistically, Grhl2 is involved in RBM25-regulated trophoblast cell migration, invasion, and EMT through RBM25-facilitated mRNA stabilization. Furthermore, the upregulation of Grhl2 enhances the expression of RBM25 through transcription and forms a positive feedback regulation in the progression of PE. These findings suggest that upregulation of RBM25 induces dysregulation of trophoblast EMT by enhancing positive feedback regulation of Grhl2 and RBM25, leading to defects in cell migration and invasion. Targeting this newly identified regulatory axis may provide benefits in the prevention and treatment of PE.

Feedback Modulation between Human INO80 Chromatin Remodeling Complex and miR-372 in HCT116 Cells.

Human INO80 chromatin remodeling complex (INO80 complex) as a transcription cofactor is widely involved in gene transcription regulation and is frequently highly expressed in tumor cells. However, few reports exist on the mutual regulatory mechanism between INO80 complex and non-coding microRNAs. Herein, we showed evidence that the INO80 complex transcriptionally controls microRNA-372 (miR-372) expression through RNA-Seq analysis and a series of biological experiments. Knocking down multiple subunits in the INO80 complex, including the INO80 catalytic subunit, YY1, Ies2, and Arp8, can significantly increase the expression level of miR-372. Interestingly, mimicking miR-372 expression in HCT116 cells, in turn, post-transcriptionally suppressed INO80 and Arp8 expression at both mRNA and protein levels, indicating the existence of a mutual regulatory mechanism between the INO80 complex and miR-372. The target relationship between miR-372 and INO80 complex was verified using luciferase assays in HCT116 colon cancer cells. As expected, miR-372 mimics significantly suppressed the luciferase activity of pMIR-luc/INO80 and pMIR-luc/Arp8 3'-UTR in cells. In contrast, the miR-372 target sites in the 3'-UTRs linked to the luciferase reporter were mutagenized, and both mutant sites lost their response to miR-372. Furthermore, the mutual modulation between the INO80 complex and miR-372 was involved in cell proliferation and the p53/p21 signaling pathway, suggesting the synergistic anti-tumor role of the INO80 complex and miR372. Our results will provide a solid theoretical basis for exploring miR-372 as a biological marker of tumorigenesis.

New Insights on the Size-Dependent Inhibition of Enzymes by Gold Nanoparticles.

Particle size might affect the inhibition behaviors of gold nanoparticles (AuNPs) on enzyme activity by influencing the density of binding sites (ρ), the association constant (Ka), the steric hindrance of enzymes by AuNPs, the binding orientations of the enzyme on AuNPs, as well as the structural changes of enzymes. In previous studies, the effects of the above-mentioned factors, which could not be ignored in the applications of enzymatic electrochemistry, were often overshadowed by the effects of surface area. In order to study the size effect on the inhibition types and inhibitory ability of enzymes by AuNPs, we investigated the inhibition behaviors of chymotrypsin (ChT) by AuNPs with three different sizes (D1-AuNCs, D3-AuNPs, and D6-AuNPs) under the same surface area concentration. The results showed that both of the inhibition types and the inhibition ability varied with the particle size of AuNPs. D1-AuNCs inhibited ChT noncompetitively, while D3/D6-AuNPs inhibited ChT competitively. Contrary to the common sense, D6-AuNPs showed a weaker inhibitory ability than D3-AuNPs. By means of zeta potential, agarose gel electrophoresis, isothermal titration calorimetry, synchronous fluorescence spectroscopy, and circular dichroism, the mechanism of the weak inhibitory ability of D6-AuNPs was found to be the standing binding orientation caused by the small curvature. This work had certain guiding significance for the biosafety of AuNPs, the development of nanoinhibitors, as well as the applications of AuNPs in enzymatic electrochemistry.

Pigment Biosynthesis and Molecular Genetics of Fruit Color in Pepper.

Pepper, as a vegetable crop with a wide cultivation area worldwide, besides being a significant condiment and food, also has a momentous use for chemistry, medicine, and other industries. Pepper fruits are rich in various pigments, such as chlorophyll, carotenoids, anthocyanins, and capsanthin, which have important healthcare and economic value. Since various pigments are continuously metabolized during the development of pepper fruits, peppers exhibit an abundant fruit-colored phenotype in both the mature and immature periods. In recent years, great progress has been made in the study of pepper fruit color development, but the developmental mechanisms are still unclear systematically dissected in terms of pigment, biosynthesis, and regulatory genes. The article outlines the biosynthetic pathways of three important pigments: chlorophyll, anthocyanin, and carotenoid in pepper and the various enzymes involved in these pathways. The genetics and molecular regulation mechanisms of different fruit colors in immature and mature peppers were also systematically described. The objective of this review is to provide insights into the molecular mechanisms of pigments biosynthesis in pepper. This information will provide theoretical basis for the breeding of high-quality colored pepper varieties in the future.