[Pituitary Crooke cell neuroendocrine tumor of adrenocorticotropic hormone differentiation-specific transcription factor lineage: a clinicopathological analysis of six cases].

Objective: To investigate the clinicopathological features of Crooke cell tumor of adrenocorticotropic hormone differentiation specific transcription factor (TPIT, also known as transcription factor 19, TBX19) lineage neuroendocrine tumors. Methods: Six cases of Crooke cell tumor diagnosed at the First Affiliated Hospital of University of Science and Technology of China, Hefei, China from October 2019 to October 2023 were collected. The clinical and pathological features of these cases were analyzed. Results: Among the six cases, one was male and five were female, with ages ranging from 26 to 75 years, and an average age of 44 years. All tumors occurred within the sella turcica. Clinical presentations included visual impairment in two cases, menstrual disorders in one case, Cushing's syndrome in one case, headache in one case, and one asymptomatic case discovered during a physical examination. Preoperative serum analyses revealed elevated levels of cortisol and adrenocorticotropic hormones in two cases, elevated cortisol in two cases, elevated adrenocorticotropic hormone in one case, and one case with a mild increase in prolactin due to the pituitary stalk effect. Magnetic resonance imaging revealed uneven enhancement of masses with maximum diameters ranging from 1.7 to 3.2 cm, all identified as macroadenomas. Microscopically, tumor cells exhibited irregular polygonal shapes, solid sheets, or pseudo-papillary arrangements around blood vessels. The cell nuclei were eccentric or centrally located, varying in size, with abundant cytoplasm. Some tumor cells showed perinuclear halo. Immunohistochemistry demonstrated diffuse strong positivity for TPIT in five cases, focal weak positivity for TPIT in one case, diffuse strong positivity for adrenocorticotropic hormone in all cases, and faint staining around the nuclei in a few cells. CK8/18 showed a strong positive ring pattern in more than 50% of tumor cells, focal weak positive expression of p53, and the Ki-67 positive index ranged 1%-5%. Periodic acid-Schiff staining revealed positive cytoplasm and negative perinuclear areas. Conclusions: Crooke cell tumor is a rare type of pituitary neuroendocrine tumors. Its pathological characteristics include a distinctive perinuclear clear zone and immunohistochemical markers, such as CK8/18 exhibiting a ring or halo pattern. This entity represents a high-risk subtype among pituitary neuroendocrine tumors, displaying a high risk of invasion and a propensity for recurrence. Accurate diagnosis is crucial for the postoperative follow-up and multimodal treatment planning.

[Clinicopathological features of olfactory carcinoma].

Objective: To investigate the clinicopathological features and differential diagnosis of olfactory carcinoma (OC). Methods: Twenty-one cases of sinonasal tumors, including those initially diagnosed as olfactory neuroblastoma (ONB) and those with uncertain diagnosis, were collected from the Department of Pathology, the First Affiliated Hospital of University of Science and Technology of China (Anhui Provincial Hospital) from January 2016 to August 2022, among which 3 cases were reclassified as OC. The clinicopathological features were investigated, and the remaining 18 cases were used as control. Results: Of the three OC patients, 2 were male and 1 was female, with an average age of 57 years ranging from 35 to 74 years. Microscopically, the tumor cells were arranged in solid, nested or lobulated patterns with occasional palisading around the solid nests. The stroma was highly vascular with focal neurofibrillary areas. There were prominent rosettes or pseudorosettes formation. The tumor cells were mainly ovoid to spindly with scant to moderate amount of cytoplasm, one or several small nucleoli, and fine chromatin content. Brisk mitotic figures were seen. In all 3 cases of OC, there were scanty atypical glands and some were ciliated. Immunohistochemically, at least one epithelial marker and neuroendocrine marker were diffusely expressed in the tumor. Some of the tumor cells were positive for p40 and p63, and the sustentacular cells showed the expression of S-100 protein. All cases tested were negative for NUT, CD99 and desmin, with intact expression of SMARCA4 (BRG1) and SMARCB1 (INI-1). Ki-67 proliferation index varied from 20% to 80%. Follow-up after 16-18 months showed no mortality with tumor recurrence from 1 patient after 16 months. Conclusion: OC is a rare sinonasal tumor with neuroepithelial differentiation, its histomorphology is diverse, and the combination of immunohistochemical markers is essential for appropriate diagnosis.

Post-earthquake outbreak of insecticide-associated conjunctivitis in a primary school of Lixian district, China: An epidemiological investigation.

OBJECTIVES: To describe the time course and characteristics of an insecticide-associated incident and highlight potential risks from similar outbreaks that may occur in other areas to enhance the preparedness of emergency physicians and other healthcare providers to deal with the sequelae of these events. STUDY DESIGN: Outbreak investigation METHODS: From 5 to 8 August 2008, an outbreak investigation was carried out among the affected primary school located in the refugee camp area of Lixian district, Sichuan, China. Affected pupils, parents, teachers and doctors working in the local medical stations were visited. Clinical checking, clinical treatment, epidemiological investigation and environmental investigation were undertaken. RESULTS: In total, 138 individuals were diagnosed with acute conjunctivitis, characterized by inflammation of the conjunctiva and intense ocular symptoms such as redness, itching and mucus discharge. According to the results, all risk factors (i.e. drinking water, indoor air and the materials used in camp classrooms) were excluded except insecticide exposure. The characteristics of symptoms, distribution of cases and records of irregular insecticide spraying support the assumption that the conjunctivitis outbreak was associated with synthetic pyrethroid alphacypermethrin exposure. CONCLUSION: The results suggest that non-standard operating procedures in pest control could lead to disease incidents. Medical rescue teams should receive training and education in preventive techniques.

Determination of flavonoid compounds from Saussurea involucrata by liquid chromatography electrospray ionisation mass spectrometry.

Saussurea involucrata produces several bioactive flavonoids that are derived from the phenylpropanoid pathway. To determine these flavonoids, a sensitive high performance liquid chromatography electrospray ionisation mass spectrometry method (LC-ESI-MS) was developed. Chromatographic separation was then performed. The gradient elution was optimised to give high recoveries and satisfactory chromatographic resolution. Flavonoid detection was carried out using an ion trap as mass analyser. Parameters of the mass analyser were optimised. We used the validated LC-ESI-MS method to verify the identities of bioactive compounds, namely apigenin, luteolin, hispidulin, luteolin-7-O-glucoside and rutin. Calibration curves for these five flavonoids were linear in ranges between 5.0 and 500 microg mL(-1). The limit of detection ranged from 1.5 x 10(-4) (for hispidulin) to 6.1 x 10(-3) mg mL(-1) (for rutin). Precision was well within the acceptable range (RSD < 3.0%) and the recovery rate was between 75.3 and 89.8% for each flavonoid. A method validation study showed that the LC/MS technique was a powerful analytical tool for detecting trace amounts of the flavonoid compounds in extracts of S. involucrata.

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

In vivo laser-induced fluorescence imaging of a rat pancreatic cancer with pheophorbide-a.

Laser-induced fluorescence (LIF) of pheophorbide-a (Ph-a) was used for imaging of a rat pancreatic tumor. Using a dimensionless function (the ratio of Ph-a fluorescence by bluish autofluorescence), the fluorescence contrasts between excised tumors and their paired pancreas were investigated up to 48 h after a 9 mg kg-1 Ph-a intravenous administration. Among five tested excitation wavelengths, 355 and 610 nm excitations gave the best distinctive contrasts, both 48 h after dye injection. The LIF imaging of six intrapancreatic tumors and six healthy pancreas was carried out in vivo using two laser excitations: 355 nm (Nd:YAG + tripling) for bluish autofluorescence and 610 nm (rhodamine 6G dye) for reddish autofluorescence and dye emission. Images were recorded through bandpass filters at 470 and 640 nm (autofluorescence) and at 680 nm (dye + autofluorescence) with an intensified charged-coupled device camera. Autofluorescence as Ph-a fluorescence images did not allow accurate LIF diagnosis of pancreatic carcinoma. An image processing, including for each pixel a computed division of Ph-a fluorescence (after subtraction of reddish autofluorescence) by bluish autofluorescence intensity generated poorly contrasted tumor images in five of six and false tumor localization in one of three of the tumor-bearing pancreas. A fitting of the digital 640 nm autofluorescence up to the mean 680 nm fluorescence intensity in pancreas prior to subtraction allowed a safe diagnosis to be made with well-contrasted tumor images. To assess automation ability of the processing, a same fitting coefficient (mean of individual values) was applied. In this way, false-negative (one of six) and false-positive (two of six) images were present in tumor-bearing animals as false-positive in one-half of the controls. A successful standardized procedure was then applied with a normalization of 640 and 680 nm pancreas intensities to a same set threshold prior processing. In opposition to thin-layered hollow organs, such as bronchial tube or digestive tract, LIF imaging of carcinoma inserted in a compact organ is exhausting. The use of a dye excitable in the red wavelength range (610 nm for Ph-a) may partly solve this problem, rendering LIF imaging more accurate and potentially automated.