Physiological and photochemical profiling of soybean plant using biological and chemical methods of treatment against biotic stress management.

Phyto-pathogenic fungal species is a leading biotic stress factor to agri-food production and ecosystem of globe. Chemical (Systemic fungicides) and biological treatment (micro-organism) are globally accepted methods that are being used against biotic stress (disease) management. Plant Growth-Promoting Microbes are being used as an alternative to ease chemical dependency as their overdoses have generated injurious effects on plants and environment. Therefore, present study performs to evaluate the photochemical and physiological profiling of plants exposed to chemical and biological treatment in biotic stress (disease) environment. Two concentrations of each chemical treatment i.e. Topsin-M 70 (Dimethyl 4,4'-o-phenylene bis 3-thioallaphanate, MF1 = 3 g kg-1 and MF2 = 6 g kg-1 seeds) and biological treatment i.e. Trichoderma harzianum strain Th-6 (MT1 = 106 spores mL-1and MT2 = 107 spores mL-1) were used in this experiment. Macrophomina phaseolina (MP) were used as biotic stress factor causing root rot disease in soybean plants. Morpho-physiological assessments and light harvesting efficiency of photosystem II were conducted after 52 days of treatment. Maximum quantum yield (Fv/Fm), number and size of active reaction center (Fv/Fo), photochemical quenching (qP), efficiency of photosystem II (ΦPSII), electron transport rate (ETR), chlorophyll content index (CCI), relative water content (RWC) and stomatal conductance (SC) were increased in MT2 and MF1 treatments as compared to stress plants (MP). Biological (MT2) and chemical (MF1) treatment lessen the production of stress markers showing -48.0 to -54.3% decline in malondialdehyde (MDA) and -42.0 to -53.7% in hydrogen peroxide (H2O2) as compared to stress plant (MP). Biological treatment in both concentration (MF1 & MF2) while chemical treatment at low dose effectively mitigates biotic stress and eases the magnitude of disease. Increasing doses of chemical treatment persuaded deleterious effects on the physiology and light harvesting efficiency of stressed plant suggesting the role of biological treatment (T. harzianum) against biotic stress management in future of crop protection.

Physiological and photochemical evaluation of pepper methionine sulfoxide reductase B2 (CaMsrB2) expressing transgenic rice in saline habitat.

Two pepper methionine sulfoxide reductase B2 (CaMsrB2) gene expressing transgenic rice lines (L-8 and L-23) were interrogated with respect to their physiological and photochemical attributes along with control (WT, Ilmi) as a standard against varying levels of salt concentration which are 75 mM, 150 mM and 225 mM. Against various levels of salt (NaCl) concentration, recurring detrimental effects of extreme salt stress was observed and more pronounced in the wild type plants as compared to our transgenic lines. As the exacerbated effects of salinity is responsible for pushing the plants to their ecological tolerance, our transgenic lines performed well uplifted in different realms of physiology and photochemistry such as relative water content (RWC = 60-75%), stomatal conductance (gs = 70-190 mmolm-2s-1), performance index (PIABS = 1.0-4.5), maximal photochemical yield of PSII (FV/FM = 0.48-0.72) and chlorophyll content index (CCI = 5-7.2 au) in comparison to the control. Relative gene expression, ion analysis and antioxidants activity were analyzed in all treatments to ensure the hypothesis obtained from data of physiology and photochemistry. Photosynthetic apparatus is known to lose energy in various forms such as NPQ, DIO/CS, damages of reaction center (FV/FO) which are the markers of poor health were clearly decreased in the L-23 line as compared to L-8 and WT. Present study revealed the protruding tolerance of L-23 and L-8 transgenic lines with L-23 line in the lead in comparison to control and L-8 transgenic lines.

Physiological Aspects of Germination and Early Seedling Establishment of Pleurotus sajor-caju Glyceraldehyde-3-Phosphate Dehydrogenase Expressing Transgenic Rice in Saline Environment.

GPD encodes glyceraldehyde-3-phosphate dehydrogenase enzyme involved in sugar mobilization, particularly glycolysis and gluconeogenesis. The objective of this study was to determine physiological aspects of germination and early seedling establishment of PsGPD (Pleurotus sajor-caju glyceraldehyde-3-phosphate dehydrogenase) expressing transgenic rice (T5) against different salt concentrations. The T5 line that carried 2 copies of T-DNA and had the highest level of PsGPD expression was used in the investigation. Final germination percentage, amylase activity, reducing sugar accumulation, and chlorophyll biosynthesis were comparatively higher in PsGPD expressing transgenic rice against elevating saline conditions. A slow-paced conversion of porphyrin's precursors was seen through the matrix model and further elaborated by a graphical model. A sustained level of porphyrin was observed in PsGPD expressing transgenic rice. These data were concurrent with the relative gene expression and thermal imaging (thermography) of PsGPD expressing transgenic rice against salt stress. Morphological attributes also favored the salt tolerance exhibited by PsGPD-transformed rice.

The effect of concurrent elevation in CO2 and temperature on the growth, photosynthesis, and yield of potato crops.

Global climate change accompanied by continuous increases in atmospheric carbon dioxide (CO2) concentration and temperature affects the growth and yield of important crops. The present study investigated the effect of elevated temperature and CO2 concentrations on the growth, yield, and photosynthesis of potato (Solanum tuberosum L. cv. Superior) crops using Korean Soil-Plant-Atmosphere-Research chambers that allow the regulation of temperature and CO2 concentration under daylight conditions. Based on the average temperature from 1991 to 2010 in the Jeonju area, South Korea, potato plants were exposed to four different conditions: ambient weather (400 µmol mol-1, aCaT), elevated temperature (+4°C, aCeT), elevated CO2 concentration (800 µmol mol-1, eCaT), and concurrently elevated CO2 concentration and temperature (eCeT). Under aCeT conditions, the temperature exceeded the optimal growth temperature range towards the late growth phase that decreased stomatal conductance and canopy net photosynthetic rate and subsequently reduced biomass and tuber yield. Stomatal conductance and chlorophyll concentration were lower under eCaT conditions than under aCaT conditions, whereas late-growth phase biomass and tuber yield were greater. Compared to other conditions, eCeT yielded a distinct increase in growth and development and canopy net photosynthetic rate during tuber initiation and bulking. Consequently, biomass and canopy net photosynthesis increased, and tuber yield increased by 20.3%, which could be attributed to the increased tuber size, rather than increased tuber number. Elevated CO2 reduced chlorophyll, magnesium, and phosphorus concentrations; reducing nitrogen concentration (by approximately 39.7%) increased the C:N ratio. The data indicate that future climate conditions will likely change nutrient concentration and quality of crops. The present study shows that while elevated temperature may negatively influence the growth and yield of potato crops, especially towards the late-growth phase, the concurrent and appropriate elevation of CO2 and temperature could promote balanced development of source and sink organs and positively effect potato productivity and quality.

Deficiency of rice hexokinase HXK5 impairs synthesis and utilization of starch in pollen grains and causes male sterility.

There is little known about the function of rice hexokinases (HXKs) in planta. We characterized hxk5-1, a Tos17 mutant of OsHXK5 that is up-regulated in maturing pollen, a stage when starch accumulates. Progeny analysis of self-pollinated heterozygotes of hxk5-1 and reciprocal crosses between the wild-type and heterozygotes revealed that loss of HXK5 causes male sterility. Homozygous hxk5-1, produced via anther culture, and additional homozygous hxk5-2, hxk5-3 and hxk5-4 lines created by CRISPR/Cas9 confirmed the male-sterile phenotype. In vitro pollen germination ability and in vivo pollen tube growth rate were significantly reduced in the hxk5 mutant pollen. Biochemical analysis of anthers with the mutant pollen revealed significantly reduced hexokinase activity and starch content, although they were sufficient to produce some viable seed. However, the mutant pollen was unable to compete successfully against wild-type pollen. Expression of the catalytically inactive OsHXK5-G113D did not rescue the hxk5 male-sterile phenotype, indicating that its catalytic function was responsible for pollen fertility, rather than its role in sugar sensing and signaling. Our results demonstrate that OsHXK5 contributes to a large portion of the hexokinase activity necessary for the starch utilization pathway during pollen germination and tube growth, as well as for starch biosynthesis during pollen maturation.

Role of rice cytosolic hexokinase OsHXK7 in sugar signaling and metabolism.

We characterized the function of the rice cytosolic hexokinase OsHXK7 (Oryza sativa Hexokinase7), which is highly upregulated when seeds germinate under O2 -deficient conditions. According to transient expression assays that used the promoter:luciferase fusion construct, OsHXK7 enhanced the glucose (Glc)-dependent repression of a rice α-amylase gene (RAmy3D) in the mesophyll protoplasts of maize, but its catalytically inactive mutant alleles did not. Consistently, the expression of OsHXK7, but not its catalytically inactive alleles, complemented the Arabidopsis glucose insensitive2-1 (gin2-1) mutant, thereby resulting in the wild type characteristics of Glc-dependent repression, seedling development, and plant growth. Interestingly, OsHXK7-mediated Glc-dependent repression was abolished in the O2 -deficient mesophyll protoplasts of maize. This result provides compelling evidence that OsHXK7 functions in sugar signaling via a glycolysis-dependent manner under normal conditions, but its signaling role is suppressed when O2 is deficient. The germination of two null OsHXK7 mutants, oshxk7-1 and oshxk7-2, was affected by O2 deficiency, but overexpression enhanced germination in rice. This result suggests the distinct role that OsHXK7 plays in sugar metabolism and efficient germination by enforcing glycolysis-mediated fermentation in O2 -deficient rice.

Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

Rice Os9BGlu31 is a transglucosidase with the capacity to equilibrate phenylpropanoid, flavonoid, and phytohormone glycoconjugates.

Glycosylation is an important mechanism of controlling the reactivities and bioactivities of plant secondary metabolites and phytohormones. Rice (Oryza sativa) Os9BGlu31 is a glycoside hydrolase family GH1 transglycosidase that acts to transfer glucose between phenolic acids, phytohormones, and flavonoids. The highest activity was observed with the donors feruloyl-glucose, 4-coumaroyl-glucose, and sinapoyl-glucose, which are known to serve as donors in acyl and glucosyl transfer reactions in the vacuole, where Os9BGlu31 is localized. The free acids of these compounds also served as the best acceptors, suggesting that Os9BGlu31 may equilibrate the levels of phenolic acids and carboxylated phytohormones and their glucoconjugates. The Os9BGlu31 gene is most highly expressed in senescing flag leaf and developing seed and is induced in rice seedlings in response to drought stress and treatment with phytohormones, including abscisic acid, ethephon, methyljasmonate, 2,4-dichlorophenoxyacetic acid, and kinetin. Although site-directed mutagenesis of Os9BGlu31 indicated a function for the putative catalytic acid/base (Glu(169)), catalytic nucleophile residues (Glu(387)), and His(386), the wild type enzyme displays an unusual lack of inhibition by mechanism-based inhibitors of GH1 ß-glucosidases that utilize a double displacement retaining mechanism.

Rice mitogen-activated protein kinase interactome analysis using the yeast two-hybrid system.

Mitogen-activated protein kinase (MAPK) cascades support the flow of extracellular signals to intracellular target molecules and ultimately drive a diverse array of physiological functions in cells, tissues, and organisms by interacting with other proteins. Yet, our knowledge of the global physical MAPK interactome in plants remains largely fragmented. Here, we utilized the yeast two-hybrid system and coimmunoprecipitation, pull-down, bimolecular fluorescence complementation, subcellular localization, and kinase assay experiments in the model crop rice (Oryza sativa) to systematically map what is to our knowledge the first plant MAPK-interacting proteins. We identified 80 nonredundant interacting protein pairs (74 nonredundant interactors) for rice MAPKs and elucidated the novel proteome-wide network of MAPK interactors. The established interactome contains four membrane-associated proteins, seven MAP2Ks (for MAPK kinase), four MAPKs, and 59 putative substrates, including 18 transcription factors. Several interactors were also validated by experimental approaches (in vivo and in vitro) and literature survey. Our results highlight the importance of OsMPK1, an ortholog of tobacco (Nicotiana benthamiana) salicyclic acid-induced protein kinase and Arabidopsis (Arabidopsis thaliana) AtMPK6, among the rice MAPKs, as it alone interacts with 41 unique proteins (51.2% of the mapped MAPK interaction network). Additionally, Gene Ontology classification of interacting proteins into 34 functional categories suggested MAPK participation in diverse physiological functions. Together, the results obtained essentially enhance our knowledge of the MAPK-interacting protein network and provide a valuable research resource for developing a nearly complete map of the rice MAPK interactome.

Development of a simple and efficient system for excising selectable markers in Arabidopsis using a minimal promoter::Cre fusion construct.

The development of rapid and efficient strategies to generate selectable marker-free transgenic plants could help increase the consumer acceptance of genetically modified (GM) plants. To produce marker-free transgenic plants without conditional treatment or the genetic crossing of offspring, we have developed a rapid and convenient DNA excision method mediated by the Cre/loxP recombination system under the control of a -46 minimal CaMV 35S promoter. The results of a transient expression assay showed that -46 minimal promoter::Cre recombinase (-46::Cre) can cause the loxP-specific excision of a selectable marker, thereby connecting the 35S promoter and ß-glucuronidase (GUS) reporter gene. Analysis of stable transgenic Arabidopsis plants indicated a positive correlation between loxP-specific DNA excision and GUS expression. PCR and DNA gel-blot analysis further revealed that nine of the 10 tested T(1) transgenic lines carried both excised and nonexcised constructs in their genomes. In the subsequent T(2) generation plants, over 30% of the individuals for each line were marker-free plants harboring the excised construct only. These results demonstrate that the -46::Cre fusion construct can be efficiently and easily utilized for producing marker-free transgenic plants.

Impaired function of the tonoplast-localized sucrose transporter in rice, OsSUT2, limits the transport of vacuolar reserve sucrose and affects plant growth.

Physiological functions of sucrose (Suc) transporters (SUTs) localized to the tonoplast in higher plants are poorly understood. We here report the isolation and characterization of a mutation in the rice (Oryza sativa) OsSUT2 gene. Expression of OsSUT2-green fluorescent protein in rice revealed that OsSUT2 localizes to the tonoplast. Analysis of the OsSUT2 promoter::ß-glucuronidase transgenic rice indicated that this gene is highly expressed in leaf mesophyll cells, emerging lateral roots, pedicels of fertilized spikelets, and cross cell layers of seed coats. Results of Suc transport assays in yeast were consistent with a H(+)-Suc symport mechanism, suggesting that OsSUT2 functions in Suc uptake from the vacuole. The ossut2 mutant exhibited a growth retardation phenotype with a significant reduction in tiller number, plant height, 1,000-grain weight, and root dry weight compared with the controls, the wild type, and complemented transgenic lines. Analysis of primary carbon metabolites revealed that ossut2 accumulated more Suc, glucose, and fructose in the leaves than the controls. Further sugar export analysis of detached leaves indicated that ossut2 had a significantly decreased sugar export ability compared with the controls. These results suggest that OsSUT2 is involved in Suc transport across the tonoplast from the vacuole lumen to the cytosol in rice, playing an essential role in sugar export from the source leaves to sink organs.

Near-UV cyanobacteriochrome signaling system elicits negative phototaxis in the cyanobacterium Synechocystis sp. PCC 6803.

Positive phototaxis systems have been well studied in bacteria; however, the photoreceptor(s) and their downstream signaling components that are responsible for negative phototaxis are poorly understood. Negative phototaxis sensory systems are important for cyanobacteria, oxygenic photosynthetic organisms that must contend with reactive oxygen species generated by an abundance of pigment photosensitizers. The unicellular cyanobacterium Synechocystis sp. PCC6803 exhibits type IV pilus-dependent negative phototaxis in response to unidirectional UV-A illumination. Using a reverse genetic approach, together with biochemical, molecular genetic, and RNA expression profiling analyses, we show that the cyanobacteriochrome locus (slr1212/uirS) of Synechocystis and two adjacent response regulator loci (slr1213/uirR and the PatA-type regulator slr1214/lsiR) encode a UV-A-activated signaling system that is required for negative phototaxis. We propose that UirS, which is membrane-associated via its ETR1 domain, functions as a UV-A photosensor directing expression of lsiR via release of bound UirR, which targets the lsiR promoter. Constitutive expression of LsiR induces negative phototaxis under conditions that normally promote positive phototaxis. Also induced by other stresses, LsiR thus integrates light inputs from multiple photosensors to determine the direction of movement.

Identification and characterization of the duplicate rice sucrose synthase genes OsSUS5 and OsSUS7 which are associated with the plasma membrane.

Systematic searches using the complete genome sequence of rice (Oryza sativa) identified OsSUS7, a new member of the rice sucrose synthase (OsSUS) gene family, which shows only nine single nucleotide substitutions in the OsSUS5 coding sequence. Comparative genomic analysis revealed that the synteny between OsSUS5 and OsSUS7 is conserved, and that significant numbers of transposable elements are scattered at both loci. In particular, a 17.6-kb genomic region containing transposable elements was identified in the 5' upstream sequence of the OsSUS7 gene. GFP fusion experiments indicated that OsSUS5 and OsSUS7 are largely associated with the plasma membrane and partly with the cytosol in maize mesophyll protoplasts. RT-PCR analysis and transient expression assays revealed that OsSUS5 and OsSUS7 exhibit similar expression patterns in rice tissues, with the highest expression evident in roots. These results suggest that two redundant genes, OsSUS5 and OsSUS7, evolved via duplication of a chromosome region and through the transposition of transposable elements.

The ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of abiotic stress and ABA signaling in rice.

Abscisic acid (ABA) is an important phytohormone involved in abiotic stress tolerance in plants. The group A bZIP transcription factors play important roles in the ABA signaling pathway in Arabidopsis but little is known about their functions in rice. In our current study, we have isolated and characterized a group A bZIP transcription factor in rice, OsABF2 (Oryza sativa ABA-responsive element binding factor 2). It was found to be expressed in various tissues in rice and induced by different types of abiotic stress treatments such as drought, salinity, cold, oxidative stress, and ABA. Subcellular localization analysis in maize protoplasts using a GFP fusion vector indicated that OsABF2 is a nuclear protein. In yeast experiments, OsABF2 was shown to bind to ABA-responsive elements (ABREs) and its N-terminal region found to be necessary to transactivate a downstream reporter gene. A homozygous T-DNA insertional mutant of OsABF2 is more sensitive to salinity, drought, and oxidative stress compared with wild type plants. In addition, this Osabf2 mutant showed a significantly decreased sensitivity to high levels of ABA at germination and post-germination. Collectively, our present results indicate that OsABF2 functions as a transcriptional regulator that modulates the expression of abiotic stress-responsive genes through an ABA-dependent pathway.

Expression analysis and functional characterization of the monosaccharide transporters, OsTMTs, involving vacuolar sugar transport in rice (Oryza sativa).

In Arabidopsis, the compartmentation of sugars into vacuoles is known to be facilitated by sugar transporters. However, vacuolar sugar transporters have not been studied in detail in other plant species. To characterize the rice (Oryza sativa) tonoplast monosaccharide transporters, OsTMT1 and OsTMT2, we analysed their subcellular localization using green fluorescent protein (GFP) and expression patterns using reverse-transcription polymerase chain reaction (RT-PCR), performed histochemical beta-glucuronidase (GUS) assay and in situ hybridization analysis, and assessed sugar transport ability using isolated vacuoles. Expression of OsTMT-GFP fusion protein in rice and Arabidopsis revealed that the OsTMTs localize at the tonoplast. Analyses of OsTMT promoter-GUS transgenic rice indicated that OsTMT1 and OsTMT2 are highly expressed in bundle sheath cells, and in vascular parenchyma and companion cells in leaves, respectively. Both genes were found to be preferentially expressed in the vascular tissues of roots, the palea/lemma of spikelets, and in the main vascular tissues and nucellar projections on the dorsal side of the seed coats. Glucose uptake studies using vacuoles isolated from transgenic mutant Arabidopsis (tmt1-2-3) expressing OsTMT1 demonstrated that OsTMTs are capable of transporting glucose into vacuoles. Based on expression analysis and functional characterization, our present findings suggest that the OsTMTs play a role in vacuolar glucose storage in rice.

The bZIP transcription factor OsABF1 is an ABA responsive element binding factor that enhances abiotic stress signaling in rice.

A number of basic leucine zipper (bZIP) transcription factors are known to function in stress signaling in plants but few have thus far been functionally characterized in rice. In our current study in rice, we have newly isolated and characterized the OsABF1 (Oryza sativa ABA responsive element binding factor 1) gene that encodes a bZIP transcription factor. Its expression in seedling shoots and roots was found to be induced by various abiotic stress treatments such as anoxia, salinity, drought, oxidative stress, cold and abscisic acid (ABA). Subcellular localization analysis in maize protoplasts using GFP fusion vectors indicated that OsABF1 is a nuclear protein. In a yeast experiment, OsABF1 was shown to bind to ABA responsive elements (ABREs) and its N-terminal region was necessary to transactivate the downstream reporter gene. The homozygous T-DNA insertional mutants Osabf1-1 and Osabf1-2 were more sensitive in response to drought and salinity treatments than wild type plants. Furthermore, the upregulated expression of some ABA/stress-regulated genes in response to ABA treatment was suppressed in these Osabf1 mutants. Our current results thus suggest that OsABF1 is involved in abiotic stress responses and ABA signaling in rice.

Evidence for a role of hexokinases as conserved glucose sensors in both monocot and dicot plant species.

The role of the hexokinases (HXKs) as glucose (Glc) sensors has been mainly demonstrated for Arabidopsis (Arabidopsis thaliana) HXK1 (AtHXK1) but has yet to be shown in other plant species. In our recent publication, we reported that two rice (Oryza sativa) HXKs, OsHXK5 and OsHXK6, also function as Glc sensors. These two enzymes harbor both mitochondrial targeting peptides (mTPs) and nuclear localization signals (NLSs), and we confirmed their dual-targeting ability to nuclei and mitochondria using GFP fusion experiments. Consistently, it has been previously known that AtHXK1 is predominantly associated with mitochondria but is also present in nuclei in vivo at appreciable levels. Notably, the expression of OsHXK5, OsHXK6, or their catalytically inactive mutant alleles complemented the Arabidopsis glucose insensitive2 (gin2) mutant. In addition, transgenic rice plants overexpressing OsHXK5 or OsHXK6 exhibited hypersensitive plant growth retardation and enhanced repression of the Rubisco small subunit (RbcS) gene in response to glucose treatment. Our results thus provided evidence that OsHXK5 and OsHXK6 can function as glucose sensors in rice. Hence, the available current data suggest that the role of the HXKs as Glc sensors may be conserved in both monocot and dicot plant species, and that the nuclear localization of AtHXK1, OsHXK5 and OsHXK6 may be critical for Glc sensing and signaling.

Role of the rice hexokinases OsHXK5 and OsHXK6 as glucose sensors.

The Arabidopsis (Arabidopsis thaliana) hexokinase 1 (AtHXK1) is recognized as an important glucose (Glc) sensor. However, the function of hexokinases as Glc sensors has not been clearly demonstrated in other plant species, including rice (Oryza sativa). To investigate the functions of rice hexokinase isoforms, we characterized OsHXK5 and OsHXK6, which are evolutionarily related to AtHXK1. Transient expression analyses using GFP fusion constructs revealed that OsHXK5 and OsHXK6 are associated with mitochondria. Interestingly, the OsHXK5DeltamTP-GFP and OsHXK6DeltamTP-GFP fusion proteins, which lack N-terminal mitochondrial targeting peptides, were present mainly in the nucleus with a small amount of the proteins seen in the cytosol. In addition, the OsHXK5NLS-GFP and OsHXK6NLS-GFP fusion proteins harboring nuclear localization signals were targeted predominantly in the nucleus, suggesting that these OsHXKs retain a dual-targeting ability to mitochondria and nuclei. In transient expression assays using promoterluciferase fusion constructs, these two OsHXKs and their catalytically inactive alleles dramatically enhanced the Glc-dependent repression of the maize (Zea mays) Rubisco small subunit (RbcS) and rice alpha-amylase genes in mesophyll protoplasts of maize and rice. Notably, the expression of OsHXK5, OsHXK6, or their mutant alleles complemented the Arabidopsis glucose insensitive2-1 mutant, thereby resulting in wild-type characteristics in seedling development, Glc-dependent gene expression, and plant growth. Furthermore, transgenic rice plants overexpressing OsHXK5 or OsHXK6 exhibited hypersensitive plant growth retardation and enhanced repression of the photosynthetic gene RbcS in response to Glc treatment. These results provide evidence that rice OsHXK5 and OsHXK6 can function as Glc sensors.

Loss of cytosolic fructose-1,6-bisphosphatase limits photosynthetic sucrose synthesis and causes severe growth retardations in rice (Oryza sativa).

During photosynthesis, triose-phosphates (trioseP) exported from the chloroplast to the cytosol are converted to sucrose via cytosolic fructose-1,6-bisphosphatase (cFBPase). Expression analysis in rice suggests that OscFBP1 plays a major role in the cytosolic conversion of trioseP to sucrose in leaves during the day. The isolated OscFBP1 mutants exhibited markedly decreased photosynthetic rates and severe growth retardation with reduced chlorophyll content, which results in plant death. Analysis of primary carbon metabolites revealed both significantly reduced levels of sucrose, glucose, fructose and starch in leaves of these mutants, and a high accumulation of sucrose to starch in leaves of rice plants. In the oscfbp1 mutants, products of glycolysis and the TCA cycle were significantly increased. A partitioning experiment of (14)C-labelled photoassimilates revealed altered carbon distributions including a slight increase in the insoluble fraction representing transitory starch, a significant decrease in the neutral fraction corresponding to soluble sugars and a high accumulation of phosphorylated intermediates and carboxylic acid fractions in the oscfbp1 mutants. These results indicate that the impaired synthesis of sucrose in rice cannot be sufficiently compensated for by the transitory starch-mediated pathways that have been found to facilitate plant growth in the equivalent Arabidopsis mutants.

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase alpha2 gene that is essential for expression.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.