Effect of glucose feeding on the glycosylation quality of antibody produced by a human cell line, F2N78, in fed-batch culture.

The human cell line rF2N78 produces an antibody with a high galactosylation ratio which resembles human IgG. However, it has been observed that the aglycosylated antibody starts to appear when glucose is depleted. To determine whether glucose depletion is a main cause for aglycosylation of the antibody, fed-batch cultures of rF2N78 cells were performed using different feeding cocktails (glucose only, nutrient feeding cocktail without glucose, and nutrient feeding cocktail with glucose). In the fed-batch culture with nutrient feeding cocktail without glucose, aglycosylated antibody was produced in a later phase of culture, when glucose was depleted. Approximately 44 % of antibodies produced were aglycosylated at the end of culture. In contrast, aglycosylated antibody was not produced in cultures with glucose feeding. The expression levels of oligosaccharyl transferases determined by Western blot analysis were similar among the cultures, suggesting that aglycosylation of the antibody was not due to altered expression of oligosaccharyl transferases under glucose-deficient conditions. Thus, it is likely that glucose deficiency led to insufficiency of the precursor for glycosylation and induced aglycosylation of the antibody. Taken together, glucose feeding in fed-batch cultures successfully prevented occurrence of aglycosylated antibody during the cultures, confirming that glucose depletion is a main cause for aglycosylation of antibody.

Application of a new human cell line, F2N78, in the transient and stable production of recombinant therapeutics.

Host cell lines developed by genetic engineering sometimes show instabilities in maintaining their genetically acquired phenotypes. Previously, a hybrid host cell line, designated as hybrid of kidney and B cells (HKB), capable of retaining selected phenotypes originally existing in the parental cells was developed via fusion of 293 cells and HH514-16 cells. Although HKB did indeed successfully preserve several favorable phenotypes, the expression of Epstein-Barr virus (EBV) specific nuclear antigen 1 (EBNA1), which should be constitutively expressed for host cells to utilize oriP expression vector in transient production of therapeutic proteins, was observed to be unstable. Here, in an attempt to obtain stable expression of EBNA1, a cell type that contains an integrated EBV genome, rather than HH514-16 cells, which harbor an episomal EBV genome, was applied for fusion with 293 cells. Fusion of 293 cells with Namalwa cells led to the creation of a new type of hybrid, F2N, which was able to stably express EBNA1 while not producing EBV particles. One of the F2N clones, F2N78, was observed to maintain EBNA1 expression for more than 1 year under serum-free suspension culture conditions along with human specific glycosyl phenotypes observed previously in HKB. In addition, F2N78 was demonstrated to be an appropriate host cell line for both the transient and stable production of recombinant therapeutics with the features of safety expected of production cell lines for human use.

Antifibrotic effects of a tissue inhibitor of metalloproteinase-1 antibody on established liver fibrosis in rats.

Liver fibrosis is characterized by increased synthesis, and decreased degradation, of extracellular matrix (ECM) within the injured tissue. Decreased ECM degradation results, in part, from increased expression of tissue inhibitor of metalloproteinase-1 (TIMP-1), which blocks matrix metalloproteinase (MMP) activity. TIMP-1 is also involved in promoting survival of activated hepatic stellate cells (HSCs), a major source of ECM. This study examined the effects of blocking TIMP-1 activity in a clinically relevant model of established liver fibrosis. Rats were treated with carbon tetrachloride (CCl(4)), or olive oil control, for 6 weeks; 24 days into the treatment, the rats were administered a neutralizing anti-TIMP-1 antibody derived from a fully human combinatorial antibody library (HuCAL), PBS, or an isotype control antibody. Livers from CCl(4)-treated rats exhibited substantial damage, including bridging fibrosis, inflammation, and extensive expression of smooth muscle alpha-actin (alpha-SMA). Compared to controls, rats administered anti-TIMP-1 showed a reduction in collagen accumulation by histological examination and hydroxyproline content. Administration of anti-TIMP-1 resulted in a marked decrease in alpha-SMA staining. Zymography analysis showed antibody treatment decreased the activity of MMP-2. In conclusion, administration of a TIMP-1 antibody attenuated CCl(4)-induced liver fibrosis and decreased HSC activation and MMP-2 activity.

Disruption of Epstein-Barr virus latency in the absence of phosphorylation of ZEBRA by protein kinase C.

ZEBRA protein converts Epstein-Barr virus (EBV) infection from the latent to the lytic state. The ability of ZEBRA to activate this switch is strictly dependent on the presence of serine or threonine at residue 186 of the protein (A. Francis, T. Ragoczy, L. Gradoville, A. El-Guindy, and G. Miller, J. Virol. 72:4543-4551, 1999). We investigated whether phosphorylation of ZEBRA protein at this site by a serine-threonine protein kinase was required for activation of an early lytic cycle viral gene, BMRF1, as a marker of disruption of latency. Previous studies suggested that phosphorylation of ZEBRA at S186 by protein kinase C (PKC) activated the protein (M. Baumann, H. Mischak, S. Dammeier, W. Kolch, O. Gires, D. Pich, R. Zeidler, H. J. Delecluse, and W. Hammerschmidt, J. Virol 72:8105-8114, 1998). Two residues of ZEBRA, T159 and S186, which fit the consensus for phosphorylation by PKC, were phosphorylated in vitro by this enzyme. Several isoforms of PKC (alpha, beta(1), beta(2), gamma, delta, and epsilon ) phosphorylated ZEBRA. All isoforms that phosphorylated ZEBRA in vitro were blocked by bisindolylmaleimide I, a specific inhibitor of PKC. Studies in cell culture showed that phosphorylation of T159 was not required for disruption of latency in vivo, since the T159A mutant was fully functional. Moreover, the PKC inhibitor did not block the ability of ZEBRA expressed from a transfected plasmid to activate the BMRF1 downstream gene. Of greatest importance, in vivo labeling with [(32)P]orthophosphate showed that the tryptic phosphopeptide maps of wild-type ZEBRA, Z(S186A), and the double mutant Z(T159A/S186A) were identical. Although ZEBRA is a potential target for PKC, in the absence of PKC agonists, ZEBRA is not constitutively phosphorylated in vivo by PKC at T159 or S186. Phosphorylation of ZEBRA by PKC is not essential for the protein to disrupt EBV latency.

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements.

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.