Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 243
Filtrar
1.
J Org Chem ; 2024 May 09.
Artigo em Inglês | MEDLINE | ID: mdl-38723145

RESUMO

In this study, we present an efficient approach for the synthesis of 3-sulfenyl indoles through an electron donor-acceptor (EDA) complex-promoted photoreaction. This sulfenylation reaction leverages sulfonyl chlorides as the sulfur source and employs PPh3 as the reductant without the need for any transition-metal catalyst or photocatalyst. At the same time, the relaxation process of the excited EDA complex was theoretically investigated at the method and multiconfiguration second-order perturbation//complete active space self-consistent field/PCM level of theory, which involves the π bond of indoles injecting an electron to the antibonding orbital of the S-Cl bond in arylsulfonyl chlorides.

2.
Exp Ther Med ; 27(6): 270, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38756899

RESUMO

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

3.
Nat Microbiol ; 9(5): 1256-1270, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38649412

RESUMO

Epstein-Barr virus (EBV) can infect both B cells and epithelial cells (ECs), causing diseases such as mononucleosis and cancer. It enters ECs via Ephrin receptor A2 (EphA2). The function of interferon-induced transmembrane protein-1 (IFITM1) in EBV infection of ECs remains elusive. Here we report that IFITM1 inhibits EphA2-mediated EBV entry into ECs. RNA-sequencing and clinical sample analysis show reduced IFITM1 in EBV-positive ECs and a negative correlation between IFITM1 level and EBV copy number. IFITM1 depletion increases EBV infection and vice versa. Exogenous soluble IFITM1 effectively prevents EBV infection in vitro and in vivo. Furthermore, three-dimensional structure prediction and site-directed mutagenesis demonstrate that IFITM1 interacts with EphA2 via its two specific residues, competitively blocking EphA2 binding to EBV glycoproteins. Finally, YTHDF3, an m6A reader, suppresses IFITM1 via degradation-related DEAD-box protein 5 (DDX5). Thus, this study underscores IFITM1's crucial role in blocking EphA2-mediated EBV entry into ECs, indicating its potential in preventing EBV infection.


Assuntos
Antígenos de Diferenciação , Efrina-A2 , Células Epiteliais , Infecções por Vírus Epstein-Barr , Herpesvirus Humano 4 , Receptor EphA2 , Internalização do Vírus , Humanos , Herpesvirus Humano 4/fisiologia , Herpesvirus Humano 4/genética , Herpesvirus Humano 4/metabolismo , Células Epiteliais/virologia , Células Epiteliais/metabolismo , Infecções por Vírus Epstein-Barr/virologia , Infecções por Vírus Epstein-Barr/metabolismo , Receptor EphA2/metabolismo , Efrina-A2/metabolismo , Efrina-A2/genética , Antígenos de Diferenciação/metabolismo , Antígenos de Diferenciação/genética , Animais , Células HEK293 , Ligação Proteica , Camundongos , Linhagem Celular
4.
Zhongguo Dang Dai Er Ke Za Zhi ; 26(3): 282-288, 2024 Mar 15.
Artigo em Chinês | MEDLINE | ID: mdl-38557381

RESUMO

OBJECTIVES: To investigate the effects of different concentrations of adapalene on the morphology and functions of neuroblastoma cell line SH-SY5Y, as well as its role in inducing cell differentiation and apoptosis. METHODS: SH-SY5Y cells were divided into control group, low concentration (0.1 µM and 1 µM) adapalene groups, and high concentration (10 µM) adapalene group. Time-lapse microscopy was used to observe the morphological changes of SH-SY5Y cells. Immunofluorescence staining was performed to detect the expression of neuronal specific marker ßIII-tubulin and mature neuronal marker neurofilament heavy polypeptide (NFH). Multi-electrode array was used to record the electrophysiological features of SH-SY5Y cells. Cell apoptosis was evaluated using a cell apoptosis detection kit. RESULTS: Low concentrations of adapalene promoted the formation of neurite outgrowth in SH-SY5Y cells, with the neurites interconnected to form a network. Spontaneous discharge activity was observed in SH-SY5Y cells treated with low concentrations of adapalene. Compared to the control group, the expression of ßIII-tubulin and NFH increased in the 1 µM adapalene group, while the level of cell apoptosis increased in the high concentration adapalene group (P<0.05). CONCLUSIONS: Low concentrations of adapalene can induce differentiation of SH-SY5Y cells into mature functional neurons, while high concentrations of adapalene can induce apoptosis in SH-SY5Y cells.


Assuntos
Neuroblastoma , Tubulina (Proteína) , Humanos , Neurônios , Diferenciação Celular , Apoptose , Linhagem Celular Tumoral
5.
Chem Commun (Camb) ; 60(28): 3854-3857, 2024 Apr 02.
Artigo em Inglês | MEDLINE | ID: mdl-38497353

RESUMO

In contrast to the well-established enzymatic enantioselective decarboxylative protonation (EDP), the corresponding chemocatalytic reactions of acyclic malonic acid derivatives remain challenging. Herein, we developed a biomimetic EDP of α-alkyl-α-aryl malonate monoesters using a chiral 1,2-trans-diaminocyclohexane-based N-sulfonamide as an organocatalyst. The method demonstrates excellent chemical yields, good enantioselectivity, mild reaction conditions, and the generation of only CO2 as waste.

6.
J Org Chem ; 89(6): 4031-4036, 2024 Mar 15.
Artigo em Inglês | MEDLINE | ID: mdl-38447165

RESUMO

Construction of medium-sized ring compounds remains challenging in synthetic chemistry. Herein, we describe the synthesis of medium-sized lactams via a photoinduced ring expansion of benzo-fused cyclic ketones using graphitic carbon nitride (g-C3N4) as a photocatalyst. The ring expansion protocol provided an efficient access to 8-10-membered lactams in good yields and displayed good tolerance to a range of functional groups. The mechanism studies revealed that the photochemical reaction proceeds via an intermediary of a nitrogen radical, which is generated through an oxidative hydrogen atom transfer (HAT) process.

7.
Proc Natl Acad Sci U S A ; 121(11): e2314383121, 2024 Mar 12.
Artigo em Inglês | MEDLINE | ID: mdl-38442178

RESUMO

Sponges (Porifera) contain many peptide-specialized metabolites with potent biological activities and significant roles in shaping marine ecology. It is well established that symbiotic bacteria produce bioactive "sponge" peptides, both on the ribosome (RiPPs) and nonribosomally. Here, we demonstrate that sponges themselves also produce many bioactive macrocyclic peptides, such as phakellistatins and related proline-rich macrocyclic peptides (PRMPs). Using the Stylissa carteri sponge transcriptome, methods were developed to find sequences encoding 46 distinct RiPP-type core peptides, of which ten encoded previously identified PRMP sequences. With this basis set, the genome and transcriptome of the sponge Axinella corrugata was interrogated to find 35 PRMP precursor peptides encoding 31 unique core peptide sequences. At least 11 of these produced cyclic peptides that were present in the sponge and could be characterized by mass spectrometry, including stylissamides A-D and seven previously undescribed compounds. Precursor peptides were encoded in the A. corrugata genome, confirming their animal origin. The peptides contained signal peptide sequences and highly repetitive recognition sequence-core peptide elements with up to 25 PRMP copies in a single precursor. In comparison to sponges without PRMPs, PRMP sponges are incredibly enriched in potentially secreted polypeptides, with >23,000 individual signal peptide encoding genes found in a single transcriptome. The similarities between PRMP biosynthetic genes and neuropeptides in terms of their biosynthetic logic suggest a fundamental biology linked to circular peptides, possibly indicating a widespread and underappreciated diversity of signaling peptide post-translational modifications across the animal kingdom.


Assuntos
Peptídeos Cíclicos , Peptídeos , Animais , Peptídeos/genética , Peptídeos Cíclicos/genética , Sequência de Aminoácidos , Bandagens , Sinais Direcionadores de Proteínas
8.
Front Pharmacol ; 15: 1268464, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38464713

RESUMO

Scopoletin is a coumarin synthesized by diverse medicinal and edible plants, which plays a vital role as a therapeutic and chemopreventive agent in the treatment of a variety of diseases. In this review, an overview of the pharmacology, pharmacokinetics, and toxicity of scopoletin is provided. In addition, the prospects and outlook for future studies are appraised. Scopoletin is indicated to have antimicrobial, anticancer, anti-inflammation, anti-angiogenesis, anti-oxidation, antidiabetic, antihypertensive, hepatoprotective, and neuroprotective properties and immunomodulatory effects in both in vitro and in vivo experimental trials. In addition, it is an inhibitor of various enzymes, including choline acetyltransferase, acetylcholinesterase, and monoamine oxidase. Pharmacokinetic studies have demonstrated the low bioavailability, rapid absorption, and extensive metabolism of scopoletin. These properties may be associated with its poor solubility in aqueous media. In addition, toxicity research indicates the non-toxicity of scopoletin to most cell types tested to date, suggesting that scopoletin will neither induce treatment-associated mortality nor abnormal performance with the test dose. Considering its favorable pharmacological activities, scopoletin has the potential to act as a drug candidate in the treatment of cancer, liver disease, diabetes, neurodegenerative disease, and mental disorders. In view of its merits and limitations, scopoletin is a suitable lead compound for the development of new, efficient, and low-toxicity derivatives. Additional studies are needed to explore its molecular mechanisms and targets, verify its toxicity, and promote its oral bioavailability.

9.
Anal Chem ; 2024 Feb 05.
Artigo em Inglês | MEDLINE | ID: mdl-38317503

RESUMO

Lateral flow immunoassay (LFIA) has played a vital role in point-of-care (POC) testing on account of its simplicity, rapidity, and low cost. However, the low sensitivity and difficulty of quantitation limit its further development. Sensitive markers with new detection modes are being developed to dramatically improve LFIA's performance. Herein, a ligand-complex approach was proposed to uniformly coat a thin layer of Au onto Ag triangular nanoplates (Ag TNPs) without etching the Ag cores, which not only retain the unique optical properties from Ag TNPs but also acquire the surface stability and biocompatibility of gold. The localized surface plasmon resonance absorption of these Ag@Au TNPs could be finely adjusted from visible (550 nm) to the second near-infrared region (NIR-II) (1100 nm), and even longer, by simply adjusting the ratio between edge length and thickness. Utilizing the Ag@Au TNPs as new markers for LFIA, a highly sensitive colorimetric and photothermal dual-mode detection of the SARS-CoV-2 nucleocapsid protein was achieved with a very low background. The Ag@Au TNPs showed an exceedingly high photothermal conversion efficiency of 61.4% (ca. 2 times higher than that of Au nanorods), endowing the LFIA method with a low photothermal detection limit (40 pg/mL), which was 25-fold lower than that of the colorimetric results. The generality of the method was further verified by the sensitive and accurate analysis of cardiac troponin I (cTnI). This method is robust, reproducible, and highly specific and has been successfully applied to SARS-COV-2 detection in 35 clinical samples with satisfactory results, demonstrating its potential for POC applications.

10.
World J Clin Cases ; 12(4): 820-827, 2024 Feb 06.
Artigo em Inglês | MEDLINE | ID: mdl-38322681

RESUMO

BACKGROUND: Human epidermal growth factor receptor-2 (HER-2) plays a vital role in tumor cell proliferation and metastasis. However, the prognosis of HER2-positive gastric cancer is poor. Inetetamab, a novel anti-HER2 targeting drug independently developed in China, exhibits more potent antibody-dependent cell-mediated cytotoxicity than trastuzumab, which is administered as the first-line treatment for HER2-positive gastric cancer in combination with chemotherapy. In this case, the efficacy and safety of inetetamab combined with tegafur was investigated as a second-line treatment for HER2-positive gastric cancer. CASE SUMMARY: A 52-year-old male patient with HER2-positive gastric cancer presented with abdominal distension, poor appetite, and fatigue two years after receiving six cycles of oxaliplatin combined with tegafur as first-line treatment after surgery, followed by tegafur monotherapy for six months. The patient was diagnosed with postoperative recurrence of gastric adenocarcinoma. He received 17 cycles of a combination of inetetamab, an innovative domestically developed anti-HER2 monoclonal antibody, and tegafur chemotherapy as the second-line treatment (inetetamab 200 mg on day 1, every 3 wk combined with tegafur twice daily on days 1-14, every 3 wk). Evaluation of the efficacy of the second-line treatment revealed that the patient achieved a stable condition and progression-free survival of 17 months. He tolerated the treatment well without exhibiting any grade 3-4 adverse events. CONCLUSION: Inetetamab combined with chemotherapy for the treatment of metastatic HER2-positive gastric cancer demonstrates significant survival benefits and acceptable safety.

11.
Cancers (Basel) ; 16(2)2024 Jan 15.
Artigo em Inglês | MEDLINE | ID: mdl-38254860

RESUMO

The discovery of the distinctive structure of heavy chain-only antibodies in species belonging to the Camelidae family has elicited significant interest in their variable antigen binding domain (VHH) and gained attention for various applications, such as cancer diagnosis and treatment. This article presents an overview of the characteristics, advantages, and disadvantages of VHHs as compared to conventional antibodies, and their usage in diverse applications. The singular properties of VHHs are explained, and several strategies that can augment their utility are outlined. The preclinical studies illustrating the diagnostic and therapeutic efficacy of distinct VHHs in diverse formats against solid cancers are summarized, and an overview of the clinical trials assessing VHH-based agents in oncology is provided. These investigations demonstrate the enormous potential of VHHs for medical research and healthcare.

12.
Sci Rep ; 14(1): 737, 2024 01 06.
Artigo em Inglês | MEDLINE | ID: mdl-38184719

RESUMO

The aim of this study was to develop a model for early prediction of adverse events and treatment effectiveness in patients with hyperkalemia. We collected clinical data from patients with hyperkalemia in the First Hospital of Zhejiang University School of Medicine between 2015 and 2021. The least absolute shrinkage and selection operator (LASSO) and multivariate logistic regression were used to analyze the predictors on the full dataset. We randomly divided the data into a training group and a validation group, and used LASSO to filter variables in the training set. Six machine learning methods were used to develop the models. The best model was selected based on the area under the curve (AUC). Shapley additive exPlanations (SHAP) values were used to explain the best model. A total of 1074 patients with hyperkalemia were finally enrolled. Diastolic blood pressure (DBP), breathing, oxygen saturation (SPO2), Glasgow coma score (GCS), liver disease, oliguria, blood sodium, international standardized ratio (ISR), and initial blood potassium were the predictors of the occurrence of adverse events; peripheral edema, estimated glomerular filtration rate (eGFR), blood sodium, actual base residual, and initial blood potassium were the predictors of therapeutic effect. Extreme gradient boosting (XGBoost) model achieved the best performance (adverse events: AUC = 0.87; therapeutic effect: AUC = 0.75). A model based on clinical characteristics was developed and validated with good performance.


Assuntos
Hiperpotassemia , Humanos , Potássio , Área Sob a Curva , Aprendizado de Máquina , Sódio
14.
ACS Synth Biol ; 13(1): 394-401, 2024 Jan 19.
Artigo em Inglês | MEDLINE | ID: mdl-38194299

RESUMO

Peptide cyclization improves conformational rigidity, providing favorable pharmacological properties, such as proteolytic resistance, target specificity, and membrane permeability. Thus, many synthetic and biosynthetic peptide circularization strategies have been developed. PatG and related natural macrocyclases process diverse peptide sequences, generating millions of cyclic derivatives. However, the application of these cyclases is limited by low yields and the potential presence of unwanted intermediates. Here, we designed a covalently fused G macrocyclase with substrates that efficiently and spontaneously release cyclic peptides. To increase the fidelity of synthesis, we developed an orthogonal control mechanism enabling precision synthesis in Escherichia coli. As a result, a library comprising 4.8 million cyclic derivatives was constructed, producing an estimated 2.6 million distinct cyclic peptides with an improved yield and fidelity.


Assuntos
Peptídeos Cíclicos , Peptídeos , Peptídeos Cíclicos/metabolismo , Peptídeos/genética , Peptídeos/química , Sequência de Aminoácidos , Peptídeo Hidrolases/química , Ciclização
15.
Plant Physiol ; 194(4): 2101-2116, 2024 Mar 29.
Artigo em Inglês | MEDLINE | ID: mdl-37995372

RESUMO

The precise timing of flowering plays a pivotal role in ensuring successful plant reproduction and seed production. This process is intricately governed by complex genetic networks that integrate internal and external signals. This study delved into the regulatory function of microRNA397 (miR397) and its target gene LACCASE-15 (OsLAC15) in modulating flowering traits in rice (Oryza sativa). Overexpression of miR397 led to earlier heading dates, decreased number of leaves on the main stem, and accelerated differentiation of the spikelet meristem. Conversely, overexpression of OsLAC15 resulted in delayed flowering and prolonged vegetative growth. Through biochemical and physiological assays, we uncovered that miR397-OsLAC15 had a profound impact on carbohydrate accumulation and photosynthetic assimilation, consequently enhancing the photosynthetic intensity in miR397-overexpressing rice plants. Notably, we identified that OsLAC15 is at least partially localized within the peroxisome organelle, where it regulates the photorespiration pathway. Moreover, we observed that a high CO2 concentration could rescue the late flowering phenotype in OsLAC15-overexpressing plants. These findings shed valuable insights into the regulatory mechanisms of miR397-OsLAC15 in rice flowering and provided potential strategies for developing crop varieties with early flowering and high-yield traits through genetic breeding.


Assuntos
Oryza , Oryza/metabolismo , Flores/fisiologia , Melhoramento Vegetal , Folhas de Planta/genética , Folhas de Planta/metabolismo , Reprodução , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Regulação da Expressão Gênica de Plantas
16.
Inflamm Res ; 73(1): 145-155, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-38085279

RESUMO

OBJECTIVE AND DESIGN: Changes in the immune status of patients with sepsis may have a major impact on their prognosis. Our research focused on changes in various immune cell subsets and T-cell activation during the progression of sepsis. METHODS AND SUBJECTS: We collected data from 188 sepsis patients at the First Affiliated Hospital of Zhejiang University School of Medicine. The main focus was on the patient's immunocyte subset typing, T-cell activation/Treg cell analysis, and cytokine assay, which can indicate the immune status of the patient. RESULTS: The study found that the number of CD4+ T cells, CD8+ T cells, NK cells, and B cells decreased early in the disease, and the decrease in CD4+ and CD8+ T cells was more pronounced in the death group. T lymphocyte activation was inhibited, and the number of Treg cells increased as the disease progressed. T lymphocyte inhibition was more significant in the death group, and the increase in IL-10 was more significant in the death group. Finally, we used patients' baseline conditions and immunological detection indicators for modeling and found that IL-10, CD4+ Treg cells, CD3+HLA-DR+ T cells, and CD3+CD69+ T cells could predict patients' prognosis well. CONCLUSION: Our study found that immunosuppression occurs in patients early in sepsis. Early monitoring of the patient's immune status may provide a timely warning of the disease.


Assuntos
Citocinas , Sepse , Humanos , Citocinas/metabolismo , Interleucina-10/metabolismo , Linfócitos T CD8-Positivos , Ativação Linfocitária , Linfócitos T Reguladores , Sepse/metabolismo , Subpopulações de Linfócitos T
17.
Org Lett ; 26(1): 292-297, 2024 Jan 12.
Artigo em Inglês | MEDLINE | ID: mdl-38157220

RESUMO

The diaryl ether represents a prevalent structural motif found in numerous biologically active molecules. Herein, we describe a dirhodium-catalyzed C(sp2)-O cross coupling reaction between diazo quinones and phenols for the construction of diaryl ethers in moderate to high yields. The reaction proceeds under mild and neutral conditions and is tolerant of various functional groups. The synthetic method has been successfully applied to the concise synthesis of a Navl.7 inhibitor.

18.
BMC Womens Health ; 23(1): 585, 2023 11 08.
Artigo em Inglês | MEDLINE | ID: mdl-37940895

RESUMO

BACKGROUND: The accuracy of ultrasound in distinguishing benign from malignant adnexal masses is highly correlated with the experience of ultrasound physicians. In China, most of ultrasound differentiation is done by junior physicians. PURPOSE: To compare the diagnostic performance of the International Ovarian Tumour Analysis (IOTA) Simple Rules Risk (SRR) and IOTA Logistic Regression Model 2 (LR2) scoring systems in Chinese patients with adnexal masses. METHODS: Retrospective analysis of ovarian cancer tumor patients who underwent surgery at a hospital in China from January 2016 to December 2021. Screening patients with at least one adnexal mass on inclusion and exclusion criteria. Two trained junior physicians evaluated each mass using the two scoring systems. A receiver operating characteristic curve was used to test the diagnostic performance of each system. RESULTS: A total of 144 adnexal masses were retrospectively collected. Forty masses were histologically diagnosed as malignant. Compared with premenopausal women, postmenopausal women had a much higher rate of malignant masses. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) of the SRR was 97.5% (95% CI: 86.8 -99.9%), 82.7% (95% CI: 74.0 -89.4%), 68.4% (95% CI: 58.7 -76.8%) and 98.9% (95% CI: 92.5 -99.8%). The sensitivity, specificity, PPV, NPV of the LR2 were 90.0% (95% CI: 76.5 -97.2%), 89.4% (95% CI: 81.9 -94.6%), 76.6% (95% CI: 65.0 -85.2%), and 95.9% (95% CI: 90.2 -98.3%). There was good agreement between two scoring systems, with 84.03% total agreement and a kappa value of 0.783 (95% CI: 0.70-0.864). The areas under the curve for predicting malignant tumours using SRR and LR2 were similar for all patients (P > 0.05 ). CONCLUSION: The two scoring systems can effectively distinguish benign from malignant adnexal masses. Both scoring systems have high diagnostic efficacy, and diagnostic efficacy is stable, which can provide an important reference for clinical decision making.


Assuntos
Doenças dos Anexos , Neoplasias Ovarianas , Humanos , Feminino , Modelos Logísticos , Estudos Retrospectivos , População do Leste Asiático , Sensibilidade e Especificidade , Neoplasias Ovarianas/diagnóstico por imagem , Neoplasias Ovarianas/patologia , Ultrassonografia , Doenças dos Anexos/diagnóstico por imagem , Doenças dos Anexos/patologia , Diagnóstico Diferencial
19.
Artigo em Inglês | MEDLINE | ID: mdl-37847462

RESUMO

It aimed to explore the correlation of Glu504Lys locus mutation of aldehyde dehydrogenase-2 (ALDH2) with coronary heart disease (CHD) based on gold magnetic nanoparticles (GMNPs) chromatography and amplification refractory mutation system-PCR (ARMS-PCR). 120 CHD patients admitted to the cardiovascular Department of Wenling First People's Hospital affiliated to Wenzhou Medical University from December 2020 to December 2021 were selected as Case group and 80 non-CHD patients admitted during the same period were selected as Ctrl group. The venous blood and indexes of Total Cholesterol (TC), Triglyceride (TG), Low Density Lipoprotein Cholesterol (LDL-C), High Density Lipoprotein Cholesterol (HDL-C), and Fasting Blood Glucose (FBS) were collected. The ARMS-PCR GMNPs chromatography based on ARMS-PCR and immunochromatography assay was adopted to detect gene polymorphism of ALDH2. Correlation between ALDH2 gene polymorphism and risk factors of CHD was analyzed via logistic regression. In contrast to Ctrl group, the genotypes of GG, GA, and AA in Case group were evidently different (P < 0.05), and the frequency of A allelic gene was obviously increased (P < 0.05). Under the dominant model, frequency of GA + AA genotype in Case group was remarkably higher in contrast to Ctrl group (P < 0.05). Under the recessive model, there was no obvious difference in genotype frequency between two groups. In contrast to Ctrl group, TC, LDL-C, and FBS in Case group were notably increased (P < 0.05), while HDL-C was notably decreased (P < 0.05). The distribution frequency of abnormal LDL-C, HDL-C, and FBS in Case group was notably higher in contrast to Ctrl group (P < 0.05). LDL-C and FBS had no obvious effect on the genotypes and frequency distribution of alleles in CHD patients. However, the frequency distribution of genotypes of GA and AA and A allelic gene in patients with abnormal HDL-C was notably lower in contrast to those with normal HDL-C (P < 0.05). Logistic regression analysis showed that abnormal HDC-C with A allelic gene were independent risk factors for CHD (P = 0.001, OR = 1.934). The gene polymorphism of Glu504Lys locus of ALDH2 was closely related to the pathogenesis of CHD, A allelic gene may be a susceptibility gene for CHD, and patients with abnormal HDC-C and carried A allelic gene had relatively higher incidence of CHD.

20.
Chem Biol Interact ; 386: 110782, 2023 Dec 01.
Artigo em Inglês | MEDLINE | ID: mdl-37884181

RESUMO

Fine particulate matter (PM2.5) has attracted increasing attention due to its health-threatening effects. Although numerous studies have investigated the impact of PM2.5 on lung injuries, the specific mechanisms underlying the damage to the air-blood barrier after exposure to PM2.5 remain unclear. In this study, we established an in vitro co-culture system using lung epithelial cells and capillary endothelial cells. Our findings indicated that the tight junction (TJ) proteins were up-regulated in the co-cultured system compared to the monolayer-cultured cells, suggesting the establishment of a more closely connected in vitro system. Following exposure to PM2.5, we observed damage to the air-blood barrier in vitro. Concurrently, PM2.5 exposure induced significant oxidative stress and activated the NLRP3 inflammasome-mediated pyroptosis pathway. When oxidative stress was inhibited, we observed a decrease in pyroptosis and an increase in TJ protein levels. Additionally, disulfiram reversed the adverse effects of PM2.5, effectively suppressing pyroptosis and ameliorating air-blood barrier dysfunction. Our results indicate that the oxidative stress-pyroptosis pathway plays a critical role in the disruption of the air-blood barrier induced by PM2.5 exposure. Disulfiram may represent a promising therapeutic option for mitigating PM2.5-related lung damage.


Assuntos
Células Endoteliais , Piroptose , Espécies Reativas de Oxigênio/metabolismo , Células Endoteliais/metabolismo , Barreira Alveolocapilar/metabolismo , Dissulfiram , Material Particulado/toxicidade
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA