CPG 7909 adjuvant plus hepatitis B virus vaccination in HIV-infected adults achieves long-term seroprotection for up to 5 years.

BACKGROUND: Human immunodeficiency virus (HIV)-infected persons are hyporesponsive to hepatitis B virus (HBV) vaccination. CPG 7909 is an oligodeoxynucleotide containing immunostimulatory CpG motifs that activate human B and plasmacytoid dendritic cells via Toll-like receptor 9. We previously reported that addition of CPG 7909 to a commercial HBV vaccine enhanced the kinetics, magnitude, and longevity of the seroprotective response over 48 weeks. We now report data for the 5-year period following vaccination. METHODS: A randomized, double-blind, controlled trial was conducted to determine clinical safety and immunogenicity of HBV vaccine in adult HIV-infected subjects receiving effective antiretroviral therapy. HBV-susceptible subjects, one-half of whom had experienced previous vaccination failure, were vaccinated at 0, 1, and 2 months with a double adult dose of recombinant HBV vaccine, with or without 1 mg of CPG 7909 (19 subjects per arm). Titers of antibody to HBV surface antigen (anti-HBs) were measured at 6-month intervals for up to 60 months. RESULTS: The proportion of participants achieving and retaining seroprotection (surface antibody titers, > or =10 mIU/mL) was greater in CPG 7909 recipients (P < .05 at all time points). Geometric mean anti-HBs titers were higher in the CPG 7909 group than in the control group (without CPG 7909 adjuvant) at all measured time points. CONCLUSIONS: The immunostimulatory properties of CPG 7909 present an important strategy in achieving long-term protection in HIV-infected patients and other HBV vaccine-hyporesponsive populations.

Quantification of oligodeoxynucleotides in human plasma with a novel hybridization assay offers greatly enhanced sensitivity over capillary gel electrophoresis.

Capillary gel electrophoresis using UV detection (CGE-UV) has been used to quantify oligodeoxynucleotides (ODN) in human plasma. Although the sensitivity of this method is adequate to detect antisense ODN, which are administered in daily doses up to 10 mg/kg, CGE-UV is not sensitive enough to detect the much lower quantities of ODN administered for other purposes, such as immune stimulation by CpG ODN. We have developed a very sensitive colorimetric hybridization assay that increases the sensitivity of detection by more than four logs compared with CGE-UV. The hybridization assay uses sequence-specific capture and detection ODN probes complementary to portions of the ODN sequence. Herein we provide a prototype for assay development and validation using a 24- mer immunostimulatory phosphorothioate ODN. Probes were locked nucleic acids (LNA), resulting in increased sensitivity and specificity. The linear range of the assay is 7.8-1000 pg/ml, with a 7.8 pg/ml lower limit of quantification (LLOQ) and a detection limit of 2.8 pg/ml. This translates to detection of 40 attamoles. Intraassay and interassay precision were < or =5.0% CV and < or =12.9% CV, respectively, for quality control samples. The assay is suitable for a variety of matrices, including monkey and rat plasma, allowing application to toxicokinetic samples. The methodology is highly specific, with the ability to distinguish almost all single-base mismatched ODN. The assay detects 100% of the parent as well as some metabolites up to N-4, which are known to be the primary metabolites forming in the first hours after in vivo administration and are physiologically active with in vitro assays.

CPG 7909, an immunostimulatory TLR9 agonist oligodeoxynucleotide, as adjuvant to Engerix-B HBV vaccine in healthy adults: a double-blind phase I/II study.

Oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG ODN) act as potent Th1-like immune enhancers with many antigens in animal models. We have extended these observations to the first clinical evaluation of the safety, tolerability and immunogenicity of CPG 7909 when added to a commercial HBV vaccine. In a randomized, double-blind phase I dose escalation study, healthy volunteers aged 18-35 years were vaccinated at 0, 4 and 24 weeks by intramuscular injection with Engerix-B (GlaxoSmithKline). The regular adult dose of 20 microg recombinant hepatitis B surface antigen (HBsAg) adsorbed to alum was administered mixed with saline (control) or with CPG 7909 at one of three doses (0.125, 0.5 or 1.0 mg). HBsAg-specific antibody responses (anti-HBs) appeared significantly sooner and were significantly higher at all timepoints up to and including 24 weeks in CPG 7909 recipients compared to control subjects (p< or = 0.001). Strikingly, most CpG 7909-vaccinated subjects developed protective levels of anti-HBs IgG within just two weeks of the priming vaccine dose. A trend towards higher rates of positive cytotoxic T cell lymphocyte responses was noted in the two higher dose groups of CPG 7909 compared to controls. The most frequently reported adverse events were injection site reactions, flu-like symptoms and headache. While these were more frequent in CPG 7909 groups than in the control group (p<0.0001), most were reported to be of mild to moderate intensity regardless of group. In summary, CPG 7909 as an adjuvant to Engerix-B was well-tolerated and enhanced vaccine immunogenicity. CPG 7909 may allow the development of a two-dose prophylactic HBV vaccine.

Safety and immunogenicity of CPG 7909 injection as an adjuvant to Fluarix influenza vaccine.

CPG 7909, a 24-mer B-Class CpG oligodeoxynucleotide (ODN), was tested for safety, tolerability and its ability to augment the immunogenicity of a commercial trivalent killed split influenza vaccine (Fluarix containing A/Beijing/262/95, A/Sydney/5/97 and B/Harbin/7/94; SmithKline Beecham) in a phase Ib blinded, randomized, controlled clinical trial. Sixty healthy volunteers were recruited in two consecutive cohorts of 30 subjects, who were randomly assigned to receive Fluarix plus 1mg CPG 7909 or Fluarix plus saline control (15 subjects each). Vaccines were administered by intramuscular injection on a single occasion with subjects in the first cohort receiving a 1/10th dose of Fluarix and those in the second cohort receiving the full-dose. All safety measures including physical evaluation, laboratory blood assays, and assays for DNA autoimmunity were within normal values except for transient and clinically inconsequential decreases in total white blood cell counts in groups receiving CPG 7909. All vaccines were found to be generally well tolerated with similar frequency and intensity for most adverse reactions for groups receiving CPG 7909 as controls. Exceptions were injection site pain and headache, which were reduced in frequency in subjects receiving the 1/10th Fluarix dose without CpG, compared to the frequency in all other groups. There was a lack of pre-existing immunity, defined as hemagglutinin inhibition (HI) activity < or =20, for all subjects to the influenza strains A/Beijing/262/95 and B/Harbin/7/94 and for some subjects to A/Sydney/5/97. Post-vaccination humoral immune responses, as determined 2 and 4 weeks later by assay of HI activity and ELISA to detect antibodies against hemagglutinin (anti-HA) were similar for both full and reduced Fluarix doses but the cellular immune responses (measured as PBMC antigen-specific IFN-gamma secretion) were reduced in the 1/10th Fluarix dose group. Humoral responses were not significantly enhanced by the addition of CPG 7909, except in individuals with pre-existing immunity to A/Sydney/5/97 strain (baseline HI activity titre >20), where there was a trend to higher HI activity with CPG 7909 (P = 0.06). The addition of CPG 7909 to the 1/10th dose of Fluarix did however result in significantly higher levels of IFN-gamma secretion from peripheral blood mononuclear cells recovered at 4 weeks and restimulated ex vivo with A/Beijing/262/95 (P = 0.048) and B/Harbin/7/94 (P = 0.0057), restoring these to the level seen with full-dose vaccine. These results suggest that addition of CPG 7909 to Fluarix may allow the use of reduced vaccine doses without reduced immunogenicity.

CpG ODN can re-direct the Th bias of established Th2 immune responses in adult and young mice.

Induction of an appropriate immune response is essential for successful immunization. For example, Th1 type immune responses are necessary for the control of intracellular infections whereas Th2 type responses are more useful for the control of extracellular infections. Immunostimulatory CpG ODN (oligonucleotides containing unmethylated cytosine and guanine dinucleotides in specific base contexts) act as potent adjuvants and have been shown to induce Th1 type immune responses with a number of different antigens. This study investigates the effect of CpG ODN on the Th bias of immune responses generated against the hepatitis B major surface antigen (HBsAg) in adult (6-8 weeks old) and young (<1 week old) BALB/c mice. It also investigates the potential of CpG DNA to reverse a pre-established Th2 response generated as an adult or as a neonate, following re-exposure to HBsAg in adult life. Both adult and young mice immunized with HBsAg/CpG ODN had a Th1 biased immune response (strong cytotoxic T-lymphocyte (CTL) induction, IgG2a>>IgG1). In contrast, mice immunized with HBsAg/alum had a Th2 type immune response (poor CTL, IgG1>>IgG2a). More importantly, when animals were immunized with HBsAg/alum and boosted with HBsAg/CpG ODN, the CpG ODN were able to re-direct the Th2 response pre-established by alum, whereas the animals receiving the primary immunization with HBsAg/CpG ODN and later boosted with HBsAg/alum maintained their Th1 bias, even after the boost with alum. These data suggest that CpG ODN have the ability to augment both humoral and cell mediated immune responses and override the Th2 bias created by alum, even in very young animals, which are known to have a Th2 biased immune system.

The potential of CpG oligodeoxynucleotides as mucosal adjuvants.

The development of mucosal vaccines for humans has been hindered by the lack of safe yet effective mucosal adjuvants. Bacterial toxins are commonly used as adjuvants in animal models, but they are too toxic for use in humans. A novel class of adjuvant is CpG DNA, which contains unmethylated CpG dinucleotides in particular base contexts (CpG motifs). CpG DNA is most often coadministered with antigen in the form of synthetic oligodeoxynucleotides (CpG ODN), which are made with a nuclease-resistant phosphorothioate backbone. The vast majority of studies using CpG DNA as adjuvant have been with parenteral delivery; recently, however, mucosal immunization with CpG DNA as adjuvant has also been shown to induce both systemic (humoral and cellular) and mucosal antigen-specific immune responses. This review will highlight the recent uses of CpG DNA as an adjuvant at mucosal surfaces.

Divergent therapeutic and immunologic effects of oligodeoxynucleotides with distinct CpG motifs.

Immune stimulatory oligodeoxynucleotides (ODN) with unmethylated CpG motifs are potent inducers of both innate and adaptive immunity. It initially appeared that a single type of optimal CpG motif would work in all applications. We now report that specific motifs of CpG ODN can vary dramatically in their ability to induce individual immune effects and that these differences impact on their antitumor activity in different tumor models. In particular, a distinct type of CpG motif, which has a chimeric backbone in combination with poly(G) tails, is a potent inducer of NK lytic activity but has little effect on cytokine secretion or B cell proliferation. One such NK-optimized CpG ODN (1585) can induce regression of established melanomas in mice. Surprisingly, no such therapeutic effects were seen with CpG ODN optimized for activation of B cells and Th1-like cytokine expression (ODN 1826). The therapeutic effects of CpG 1585 in melanoma required the presence of NK but not T or B cells and were not associated with the induction of a tumor-specific memory response. In contrast, CpG 1826, but not CpG 1585, was effective at inducing regression of the EL4 murine lymphoma; this rejection was associated with the induction of a memory response and although NK cells were necessary, they were not sufficient. These results demonstrate that selection of optimal CpG ODN for cancer immunotherapy depends upon a careful analysis of the cellular specificities of various CpG motifs and an understanding of the cellular mechanisms responsible for the antitumor activity in a particular tumor.

Immune-mediated destruction of transfected myocytes following DNA vaccination occurs via multiple mechanisms.

The delivery of antigenic proteins in the context of a DNA vaccine leads to the intracellular synthesis of antigen and the induction of both humoral and cellular immune responses. Subsequent to immune activation, any transfected cell expressing the immunogenic protein should, by the rules of immunology, become a legitimate target for removal by immune-mediated mechanisms. Herein, we have used an indirect assay of myocyte integrity following intra-muscular (i.m.) delivery of a DNA vaccine, in mice with various immune deficiencies, to determine which immunological mechanisms may be involved in destruction of antigen-expressing cells. We demonstrate that destruction of antigen- expressing myocytes following i.m. injection of a DNA vaccine is dependent on major histocompatibility complex (MHC) class II restricted CD4+ T cell activation, but is not mediated solely by MHC I-restricted or perforin-mediated lysis and appears to have a component that is antibody-mediated. Although we studied myocytes, the results likely represent what happens to any transfected cell expressing a foreign antigen. This study underscores the ability of DNA vaccines at inducing antigen-specific immune responses that include a number of effector mechanisms. From the perspective of gene therapy, this study highlights the significance of immune activation when considering strategies where maintenance of therapeutic gene expression is desired.

The use of CpG DNA as a mucosal vaccine adjuvant.

CpG DNA has been shown to be a potent adjuvant in many disease models. Most studies using CpG DNA as adjuvant have used parenteral delivery, but more effective protection against mucosal pathogens could be achieved with effective mucosal immunization. Recently, mucosal immunization with CpG DNA as an adjuvant has been shown to induce both systemic (humoral and cellular) and mucosal antigen-specific immune responses. This review will concentrate on the use of CpG DNA as an adjuvant for the induction of mucosal immunity.

Identification of methylated CpG motifs as inhibitors of the immune stimulatory CpG motifs.

The unmethylated CpG motifs within E. coli DNA (EC) cause immune stimulation. In contrast, mammalian DNA such as calf thymus (CT) DNA had been thought to be immunologically inert. In this article, we demonstrate that CT DNA unexpectedly specifically inhibits the immune activation by EC but not that by endotoxin. This inhibitory effect was mediated in the signaling pathway activated by EC since CT DNA markedly inhibited the CpG-induced nuclear translocation of the transcription factors, NF-kappaB and AP-1. In addition, CT DNA significantly inhibited the synergistic immune activation by EC and endotoxin. The mechanism of the inhibition by CT DNA probably did not involve the inhibition of the cellular uptake of EC. Using a CpG-depleted plasmid, we demonstrated that CpG methylation played an important role in the inhibition by CT DNA. Compared with unmethylated plasmid DNA, CpG-methylated DNA inhibited the immune activation by EC to the same extent as did CT DNA. Importantly, the inhibitory effect of CT DNA was also observed in vivo. Our results suggest that methylated DNA may be applied to alleviate the unwanted immune stimulation and inflammation in systemic inflammatory response syndrome and in gene therapy with plasmid DNA.

CpG oligodeoxynucleotides with hepatitis B surface antigen (HBsAg) for vaccination in HBsAg-transgenic mice.

DNA motifs containing unmethylated CpG dinucleotides within the context of certain flanking sequences enhance both innate and antigen-specific immune responses, due in part to the enhanced production of Th1-type cytokines. Here we explored the ability of CpG-containing oligodeoxynucleotides combined with recombinant hepatitis B surface antigen (HBsAg) to induce Th1 responses in mice that are transgenic for this antigen and that represent a model for asymptomatic hepatitis B virus chronic carriers. This was compared to hepatitis B virus-specific DNA-mediated immunization, which we have previously shown to induce the clearance of the transgene expression product and the down-regulation of hepatitis B virus mRNA in this transgenic mouse lineage. In control nontransgenic C57BL/6 mice, three immunizations with HBsAg and CpG triggered the production of anti-HBs antibodies and of HBs-specific T cells that secrete gamma interferon but do not display any HBsAg-specific cytotoxic activity. In the HBsAg-transgenic mice, immunization with HBsAg and CpG oligodeoxynucleotides, but not with CpG alone, induced the clearance of HBsAg circulating in the sera, with a concomitant appearance of specific antibodies, and was able to regulate the hepatitis B virus mRNA constitutively expressed in the liver. Finally, adoptive transfer experiments with CD8(+) T cells primed in C57BL/6 mice with HBsAg and CpG oligodeoxynucleotide-based immunization show that these cells were able to partially control transgene expression in the liver and to clear the HBsAg from the sera of recipient transgenic mice without an antibody requirement. CpG oligodeoxynucleotides motifs combined with HBsAg could therefore represent a potential therapeutic approach with which to treat chronically infected patients.

Mucosal immunization of mice using CpG DNA and/or mutants of the heat-labile enterotoxin of Escherichia coli as adjuvants.

Cholera toxin (CT) and the Escherichia coli heat-labile enterotoxin (LT) are potent mucosal adjuvants in animals associated, at least in part, with their ability to induce cAMP. While toxicity generally precludes their use in humans, a number of different subunit or genetically detoxified mutants of CT and LT have been developed. Another type of adjuvant that has been shown to be effective at mucosal surfaces comprises synthetic oligodeoxynucleotides (ODN) containing immunostimulatory CpG motifs (CpG ODN). We have previously demonstrated a synergy between CpG ODN and native toxins after intranasal (IN) administration to mice, and herein have examined whether this synergy is linked to the cAMP activity. The adjuvanticity of CpG ODN was evaluated with IN and oral delivery of tetanus toxoid or the hepatitis B surface antigen, relative to and in combination with native LT holotoxin (LTh), three active site mutants (LTS61F, LTA69G, LTE112K), a protease site mutant (LTR192G), and the B subunit of LT (LTB). At an equivalent dose, the adjuvants could generally be divided into two groups: one that included CpG ODN, LTh, LTR192G, and LTA69G which acted as strong adjuvants; and the second which comprised LTB, LTS61F, and LTE112K, which produced significantly weaker immune responses. When CpG ODN was co-administered with bacterial toxin-derivatives, in most cases, no synergy between CpG and the LT derivatives was found for strength of the humoral response. Nevertheless, for both routes and antigens, CpG ODN combined with any LT derivative induced a more Type 1-like response than LT derivative alone. These results suggest that while the synergy seen previously with native toxins may have been due in part to inherent cAMP activity, it may have also depended on the particular antigen used and the route of immunization.

Priming of immune responses to hepatitis B surface antigen in young mice immunized in the presence of maternally derived antibodies.

Early vaccination is necessary to protect infants from various infectious diseases. However, this is often unsuccessful largely due to the immaturity of the neonatal immune system. Furthermore, maternally derived antibodies can interfere with active immunization. We have previously shown in young mice that immune responses against several different antigens can be improved by the addition of oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG ODN). In this study we have evaluated immunization of newborn (1-7-day-old) BALB/c mice against hepatitis B surface antigen (HBsAg), with alum and/or CpG ODN, in the presence of high levels of maternal antibody against HBsAg (anti-HBs). Seroconversion rates and anti-HBs titers were compared to those induced by a HBsAg-expressing plasmid, since other studies had suggested DNA vaccines to be superior to protein vaccines in young mice with maternal antibody. HBsAg/alum/CpG ODN was superior to DNA vaccine in inducing HBsAg-specific CTL responses in young mice in the presence of maternally transferred anti-HBs antibodies. However, B cell responses to both HBsAg/alum/CpG ODN and DNA vaccines remained weak in the presence of maternally transferred anti-HBs antibodies.

Enhancing vaccines with immune stimulatory CpG DNA.

Certain vertebrate immune cells have evolved receptors that detect the presence of pathogen DNA based on its content of unmethylated CpG dinucleotides in particular base contexts. This 'CpG DNA' acts as a 'danger signal', triggering protective innate and acquired immune responses. The activity of CpG DNA can be mimicked with synthetic oligodeoxynucleotides, which when added to a vaccine greatly boost the resulting immune response.

The potential of oligodeoxynucleotides as mucosal and parenteral adjuvants.

Synthetic oligodeoxynucleotides (ODN) containing immunostimulatory CpG motifs (CpG ODN) are potent adjuvants in mice when delivered by parenteral (intramuscular, subcutaneous) and mucosal (intranasal, oral and intrarectal) routes. We have recently shown that with mucosal delivery non-CpG ODN can also have immunostimulatory properties which, in contrast to the Th1-bias characteristic of CpG ODN, are predominantly Th2-like. Herein, using hepatitis B surface antigen (HBsAg) and tetanus toxoid (TT) as model antigens in BALB/c mice, we have examined a number of different ODN (CpG, non-CpG, poly-T, poly-CG) to determine their effects on immune responses after mucosal (oral) and parenteral (IM) immunizations. Our findings demonstrate that with mucosal delivery, there is a Th2-biased immunostimulatory effect that is associated with non-CpG ODN, and that the presence of CpG motifs can shift this towards a Th1 response. The adjuvant effect of non-CpG ODN was much less evident after parenteral immunization.

Interleukin-12- and gamma interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Intranasal immunization with CpG oligodeoxynucleotides as an adjuvant dramatically increases IgA and protection against herpes simplex virus-2 in the genital tract.

Development of vaccines capable of preventing the transmission or limiting the severity of sexually transmitted viruses, such as HSV and HIV, will likely be dependent on the induction of potent long-lasting mucosal immune responses in the genital tract. Recently, synthetic oligodeoxynucleotides (ODN) containing immunostimulatory CpG motifs were shown to serve as potent adjuvants for the induction of mucosal immune responses. Here, we show that intranasal immunization with CpG ODN, plus recombinant glycoprotein B (rgB) of HSV-1, results in significantly elevated levels of specific anti-gB IgA Abs in vaginal washes that remained high throughout the estrous cycle. Additionally, dramatically elevated numbers of specific IgA Ab-secreting cells were present and persisted in the genital tract in response to intravaginal (IVAG) HSV-2 challenge. HSV-2-specific CTL were observed at moderate levels in the spleens of CpG or non-CpG ODN-immunized mice. In contrast, strong CTL responses were observed locally in the genital tissues of both groups following IVAG HSV-2 challenge. Interestingly, mice immunized intranasally with rgB plus CpG ODN, but not non-CpG ODN, were significantly protected following IVAG HSV-2 challenge. Measurement of virus in protected CpG-immunized mice revealed a log lower level of replication within the first few days after infection. In conclusion, these results indicate that intranasal immunization with CpG ODN plus protein mediates immunity in the female genital tract capable of protecting against a sexually transmitted pathogen.

Adjuvant effects of CpG oligodeoxynucleotides on responses against T-independent type 2 antigens.

Oligodeoxynucleotides containing CpG motifs (CpG-ODN) are potent in vitro B-cell activators and they have been successfully used to increase in vivo antibody responses to T-dependent peptide and protein antigens. In contrast, the use of CpG-ODN to enhance in vivo antibody responses to various T-independent type 2 (TI-2) antigens has recently generated contradictory results. In this study, we compared the CpG-ODN stimulatory effect on antibody responses of adult and young BALB/c mice to trinitrophenylaminoethyl-carboxymethyl (TNP) -Ficoll and to polysaccharides (PS) from several distinct serotypes of Streptococcus pneumoniae (SPn). CpG-ODN co-administration significantly enhanced antigen-specific immunoglobulin M (IgM), IgG, IgG1 and IgG2a titres to TNP-Ficoll. The depletion of CD4+ cells by monoclonal antibodies (GK1.5) identified their essential role in CpG-ODN-mediated enhancement of antibody responses. In contrast to TNP-Ficoll, CpG-ODN failed to enhance IgM and IgG responses to any of the 18 SPnPS serotypes tested. Providing T-cell epitopes by the conjugation of SPnPS to the carrier protein tetanus toxoid again allowed CpG-ODN to mediate enhancement of IgG, IgG2a and IgG3 responses to most SPnPS serotypes. Thus, antigen-presenting cell/T-cell interaction appears to largely mediate the in vivo influence of CpG-ODN on antibody responses to TI-2 antigens. In early life, additional factors limit CpG-ODN modulation of antibody responses to TI-2 antigens.

Designing gene therapy vectors: avoiding immune responses by using tissue-specific promoters.

Attempts to correct genetic disorders by gene therapy have been hindered by various problems including unwanted immune responses against the gene product. It has been shown that immune responses with DNA vaccines after i.m. injection of antigen-encoding plasmid DNA are primed solely by professional antigen-presenting cells (APC), even though myocytes are the primary type of cell transfected. This possibly involves direct transfection of some APC in regional lymph nodes draining the injected muscle. Here we have used plasmid DNA vaccines that express hepatitis B surface antigen (HBsAg) to evaluate the possibility of abrogating these immune responses by use of a tissue-specific promoter that does not drive expression in APC. We show that HBsAg-specific humoral or cell-mediated responses are not induced in mice when the muscle-specific human muscle creatine kinase promoter is used in place of the ubiquitous cytomegaloviral promoter to drive expression of HBsAg. This may have significance in the field of gene therapy where one aims to achieve stable expression of the desired gene product without interference from the host immune response.

History of vaccines and positioning of current trends.

The history of vaccine development spans a relatively short period of time in comparison to the history of human civilization. However, monumental advances in the field of vaccines have been made in effort to combat infectious disease. These advances have led to a reduction, and in one case the complete eradication, of the burden of some infectious diseases of the world. Throughout the history of vaccine development, milestone discoveries can be identified that have shaped the field of vaccine development, as we know it. These milestones include the first official use of a vaccine by Edward Jenner, the attenuation principals observed by Pasteur, the development of cell culture for the propagation of viruses, and the production of first recombinant protein based vaccine for hepatitis B. As vaccine development progresses into the 21st century, it will be important to build on the experience and knowledge generated in the past, in an effort to surpass the limitations that currently hamper the development of new and more effective vaccine technologies. Presented here is an overview on the history of vaccine development and its influence on the positioning of current trends and future considerations.