RESUMO
A 49-year-old male was admitted to Peking Union Medical College Hospital presented with fever for more than half a year. The patient was diagnosed as Sjogren's syndrome at local hospital. After oral prednisone 60 mg per day was given, the fever alleviated, but recurred after prednisone tapered to 40 mg/d. Both blood culture and stool culture were positive for Salmonella enteritidis. Antibiotics including ceftazidime, ceftriaxone, cilastatin-imipenem were sequentially administrated for 4 weeks, yet not effective. Although there were not respiratory symptoms or certain abnormalities on high-resolution chest CT, arterial blood gas indicated hypoxemia. Serum lactate dehydrogenase and ß2 micro-globulin were elevated, and the lung function test demonstrated significant impairment of diffusion function. Positron emission tomography-computed tomography (PET/CT)scan suggested that high fluorodeoxyglucose uptake was diffusely seen in both lungs. The patient was finally diagnosed as pulmonary intravascular large B-cell lymphoma (IVLBCL) by transbronchial lung biopsy. This case aims to emphasize the differentiation diagnoses of pulmonary intravascular lymphoma from common situations.
Assuntos
Linfoma Difuso de Grandes Células B , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Fluordesoxiglucose F18 , Humanos , Hipóxia , Masculino , Pessoa de Meia-Idade , Recidiva Local de NeoplasiaRESUMO
OBJECTIVE: Inflammation and fibrosis progress of nucleus pulposus (NP) cells participate in the pathologic changes of intervertebral disc degeneration (IDD). ANGPTL2 is well known for its angiogenesis and proinflammatory properties and transforming growth factor ß1 (TGF-ß1) is also responsible for tissue fibrosis. However, the role of ANGPTL2 in IDD and whether it is related to TGF-ß1 remains unclear. This study aims to explore the relation of TGF-ß1 and ANGPTL2 in the degenerative process of NP cells. PATIENTS AND METHODS: We isolated NP cells of NP tissues provided from the spine fracture patients. IL-1ß was used to induce the NP cells degeneration. To determine the effect of TGF-ß1 and ANGPTL2 on NP cell degeneration, we regulated the cellular TGF-ß1 and ANGPTL2 expression by Recombinant human protein stimulation and siRNA transfection. Quantitative real-time polymerase chain reaction (qRT-PCR) or Western blot was employed to investigate the expression of TGF-ß1, ANGPTL2, IL-6, TNF-α, collagen I, and collagen III. RESULTS: TGF-ß1 overexpression aggravated the ANGPTL2, IL-6, TNF-α, collagen I, and collagen III expressions of NP cells that caused by IL-1ß, which was rejected by ANGPTL2 gene silencing. Besides, the silencing of TGF-ß1 weakened the ANGPTL2 expression. ANGPTL2 overexpression promoted the NP cells inflammation and fibrosis via increasing IL-6, TNF-α, collagen I, and collagen III expression, which was sharpened by a consequent increase of TGF-ß1 expression. CONCLUSIONS: This study, for the first time, points that TGF-ß1 aggravates degenerative NP cells inflammation and fibrosis via the mediation of ANGPTL2.
Assuntos
Proteínas Semelhantes a Angiopoietina/metabolismo , Fibrose/metabolismo , Inflamação/metabolismo , Núcleo Pulposo/metabolismo , Fator de Crescimento Transformador beta1/metabolismo , Regulação para Cima , Adulto , Proteína 2 Semelhante a Angiopoietina , Proteínas Semelhantes a Angiopoietina/genética , Feminino , Fibrose/patologia , Humanos , Inflamação/patologia , Masculino , Pessoa de Meia-Idade , Núcleo Pulposo/patologia , Fator de Crescimento Transformador beta1/genéticaRESUMO
OBJECTIVE: Nucleus pulposus (NP) cell proliferation plays a key role during the process of intervertebral disc degeneration (IDD). S-phase kinase-associated protein-2 (Skp2) has been proved as an important regulator for cell growth factors in vitro. Nonetheless, whether Skp2 attenuates IDD by mediating NP cell proliferation still remains unclear. Therefore, the aim of this study was to explore how Skp2 affected NP cell proliferation and the potential mechanism in vitro. PATIENTS AND METHODS: In this study, we first collected different degenerated human NP samples and isolated NP cells from these tissues. NP cell degenerated model was established with IL-1ß, and the cells were transfected with lentivirus to achieve Skp2 overexpression. Besides, SKPinC1 was used to suppress Skp2 expression in vitro. Western blot, RT-PCR, and immunocytofluorescence were applied to detect genetic differences among groups. Furthermore, cell viability and cell cycle were determined by CCK-8 assay and flow cytometry, respectively. RESULTS: Skp2 expression decreased significantly in degenerated disc samples (p<0.05). IL-1ß stimulation significantly promoted NP cell degeneration, which could be reversed by Skp2 overexpression (p<0.05). Meanwhile, Skp2 in IDD significantly inhibited the expression level of medial p27 and promoted cell cycle by CDK2 activation (p<0.05). In addition, Skp2 suppression affected NP cell proliferation in vitro. CONCLUSIONS: NP cells exhibited significantly inhibited proliferation ability when down-regulated the expression level of Skp2. Our findings provided a more meritorious viewpoint of Skp2 in NP cell proliferation. Furthermore, the above results suggested that Skp2 was a novel target in the treatment of IDD.
Assuntos
Inibidor de Quinase Dependente de Ciclina p27/metabolismo , Degeneração do Disco Intervertebral/metabolismo , Núcleo Pulposo/metabolismo , Proteínas Quinases Associadas a Fase S/metabolismo , Proliferação de Células , Células Cultivadas , Inibidor de Quinase Dependente de Ciclina p27/genética , Humanos , Degeneração do Disco Intervertebral/patologia , Núcleo Pulposo/patologia , Proteínas Quinases Associadas a Fase S/genéticaRESUMO
Objective: To find key microRNA (miR) associated with chronic thromboembolic pulmonary hypertension (CTEPH). Methods: Affymetrix miR microarray data and GSE56914 data downloaded from GEO database (http: //www.ncbi.nlm.nih.gov/geo/) were obtained and integrated. The microarray data were obtained from peripheral blood samples of CTEPH patients and the matched control. Differentially expressed miRs were screened. Target genes of these miRs were searched. Then, functional enrichment analyses for these miRs were performed. After that, disease network including miRs, target genes and pathways was constructed. Results: Five important miRs including hsa-miR-885-5p, hsa-miR-501-5p, hsa-miR-615-3p, hsa-miR-610, and hsa-miR-346 were identified. Furthermore, hsa-miR-885-5p and hsa-miR-501-5p were significantly enriched in cell cycle pathway. Hsa-miR-615-3p was involved in cytokine-cytokine receptor interaction, axon guidance, focal adhesion and cell cycle pathway. Hsa-miR-610 was significantly enriched in focal adhesion pathway, and hsa-miR-346 was involved in cytokine-cytokine receptor interaction, axon guidance, and focal adhesion pathway. Conclusions: Hsa-miR-885-5p, hsa-miR-501-5p, hsa-miR-615-3p, hsa-miR-610 and hsa-miR-346 are important miRs for the development of CTEPH.
Assuntos
Hipertensão Pulmonar , Adesão Celular , Humanos , MicroRNAsRESUMO
Objective: To investigate the spectrum of gene mutations in adult patients with B-acute lymphoblastic leukemia (B-ALL), and to analyze the influences of different gene mutations on prognosis. Methods: DNA samples from 113 adult B-ALL patients who administered from June 2009 to September 2015 were collected. Target-specific next generation sequencing (NGS) approach was used to analyze the mutations of 112 genes (focused on the specific mutational hotspots) and all putative mutations were compared against multiple databases to calculate the frequency spectrum. The impact of gene mutation on the patients' overall survival (OS) and recurrence free survival (RFS) was analyzed by the putative mutations through Kaplan-Meier, and Cox regression methods. Results: Of the 113 patients, 103 (92.0%) harbored at least one mutation and 29 (25.6%) harbored more than 3 genes mutation. The five most frequently mutated genes in B-ALL are SF1, FAT1, MPL, PTPN11 and NRAS. Gene mutations are different between Ph+ B-ALL and Ph- B-ALL patients. Ph- B-ALL patients with JAK-STAT signal pathway related gene mutation, such as JAK1/JAK2 mutation showed a poor prognosis compared to the patients without mutation (OS: P=0.011, 0.001; RFS: P=0.014,<0.001). Patients with PTPN11 mutation showed better survival than those without mutation, but the difference was not statistically significant (P value > 0.05). Besides, in Ph+ B-ALL patients whose epigenetic modifications related signaling pathway genes were affected, they had a worse prognosis (OS: P=0.038; RFS: P=0.047). Conclusion: Gene mutations are common in adult ALL patients, a variety of signaling pathways are involved. The frequency and spectrum are varied in different types of B-ALL. JAK family gene mutation usually indicates poor prognosis. The co-occurrence of somatic mutations in adult B-ALL patients indicate the genetic complex and instability of adult B-ALL patients.
Assuntos
Leucemia-Linfoma Linfoblástico de Células Precursoras , Adulto , Linfócitos B , Análise Mutacional de DNA , Humanos , Mutação , PrognósticoRESUMO
Shield tunneling construction of metro infrastructure will continuously disturb the soils. The ground surface will be subjected to uplift or subsidence due to the deep excavation and the extrusion and consolidation of the soils. Implementation of the simultaneous monitoring with the shield tunnel construction will provide an effective reference in controlling the shield driving, while how to design and implement a safe, economic, and effective structural monitoring system for metro infrastructure is of great importance and necessity. This paper presents the general architecture of the shield construction of metro tunnels as well as the procedure of the artificial ground freezing construction of the metro-tunnel cross-passages. The design principles for metro infrastructure monitoring of the shield tunnel intervals in the Hangzhou Metro Line 1 are introduced. The detailed monitoring items and the specified alarming indices for construction monitoring of the shield tunneling are addressed, and the measured settlement variations at different monitoring locations are also presented.
Assuntos
Indústria da Construção/métodos , Ferrovias/normas , Indústria da Construção/instrumentação , Congelamento , Solo/químicaRESUMO
In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 µm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 µm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 µl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.