Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 4 de 4
Filtrar
Mais filtros








Base de dados
Intervalo de ano de publicação
1.
Biochimie ; 204: 154-168, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36167255

RESUMO

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.


Assuntos
Genes p53 , Proteína Supressora de Tumor p53 , Proteína Supressora de Tumor p53/genética , Proteína Supressora de Tumor p53/metabolismo , Fosforilação , Dano ao DNA , Reparo do DNA , DNA/metabolismo
2.
Life (Basel) ; 11(7)2021 Jul 08.
Artigo em Inglês | MEDLINE | ID: mdl-34357041

RESUMO

METTL16 methyltransferase is responsible for the methylation of N6-adenosine (m6A) in several RNAs. In mouse cells, we showed that the nuclear distribution of METTL16 is cell cycle-specific. In the G1/S phases, METTL16 accumulates to the nucleolus, while in the G2 phase, the level of METTL16 increases in the nucleoplasm. In metaphase and anaphase, there is a very low pool of the METTL16 protein, but in telophase, residual METTL16 appears to be associated with the newly formed nuclear lamina. In A-type lamin-depleted cells, we observed a reduction of METTL16 when compared with the wild-type counterpart. However, METTL16 does not interact with A-type and B-type lamins, but interacts with Lamin B Receptor (LBR) and Lap2α. Additionally, Lap2α depletion caused METTL16 downregulation in the nuclear pool. Furthermore, METTL16 interacted with DDB2, a key protein of the nucleotide excision repair (NER), and also with nucleolar proteins, including TCOF, NOLC1, and UBF1/2, but not fibrillarin. From this view, the METTL16 protein may also regulate the transcription of ribosomal genes because we observed that the high level of m6A in 18S rRNA appeared in cells with upregulated METTL16.

3.
Cells ; 10(2)2021 02 01.
Artigo em Inglês | MEDLINE | ID: mdl-33535591

RESUMO

The essential components of splicing are the splicing factors accumulated in nuclear speckles; thus, we studied how DNA damaging agents and A-type lamin depletion affect the properties of these regions, positive on the SC-35 protein. We observed that inhibitor of PARP (poly (ADP-ribose) polymerase), and more pronouncedly inhibitors of RNA polymerases, caused DNA damage and increased the SC35 protein level. Interestingly, nuclear blebs, induced by PARP inhibitor and observed in A-type lamin-depleted or senescent cells, were positive on both the SC-35 protein and another component of the spliceosome, SRRM2. In the interphase cell nuclei, SC-35 interacted with the phosphorylated form of RNAP II, which was A-type lamin-dependent. In mitotic cells, especially in telophase, the SC35 protein formed a well-visible ring in the cytoplasmic fraction and colocalized with ß-catenin, associated with the plasma membrane. The antibody against the SRRM2 protein showed that nuclear speckles are already established in the cytoplasm of the late telophase and at the stage of early cytokinesis. In addition, we observed the occurrence of splicing factors in the nuclear blebs and micronuclei, which are also sites of both transcription and splicing. This conclusion supports the fact that splicing proceeds transcriptionally. According to our data, this process is A-type lamin-dependent. Lamin depletion also reduces the interaction between SC35 and ß-catenin in mitotic cells.


Assuntos
Laminas/metabolismo , Inibidores de Poli(ADP-Ribose) Polimerases/uso terapêutico , RNA Polimerase II/metabolismo , Fatores de Processamento de RNA/metabolismo , Linhagem Celular Tumoral , Células HeLa , Humanos , Poli(ADP-Ribose) Polimerase-1
4.
Cells ; 9(2)2020 02 04.
Artigo em Inglês | MEDLINE | ID: mdl-32033081

RESUMO

The DNA damage response is mediated by both DNA repair proteins and epigenetic markers. Here, we observe that N6-methyladenosine (m6A), a mark of the epitranscriptome, was common in RNAs accumulated at UV-damaged chromatin; however, inhibitors of RNA polymerases I and II did not affect the m6A RNA level at the irradiated genomic regions. After genome injury, m6A RNAs either diffused to the damaged chromatin or appeared at the lesions enzymatically. DNA damage did not change the levels of METTL3 and METTL14 methyltransferases. In a subset of irradiated cells, only the METTL16 enzyme, responsible for m6A in non-coding RNAs as well as for splicing regulation, was recruited to microirradiated sites. Importantly, the levels of the studied splicing factors were not changed by UVA light. Overall, if the appearance of m6A RNAs at DNA lesions is regulated enzymatically, this process must be mediated via the coregulatory function of METTL-like enzymes. This event is additionally accompanied by radiation-induced depletion of 2,2,7-methylguanosine (m3G/TMG) in RNA. Moreover, UV-irradiation also decreases the global cellular level of N1-methyladenosine (m1A) in RNAs. Based on these results, we prefer a model in which m6A RNAs rapidly respond to radiation-induced stress and diffuse to the damaged sites. The level of both (m1A) RNAs and m3G/TMG in RNAs is reduced as a consequence of DNA damage, recognized by the nucleotide excision repair mechanism.


Assuntos
Adenosina/análogos & derivados , RNA não Traduzido/metabolismo , RNA/metabolismo , Raios Ultravioleta , Adenosina/metabolismo , Animais , Linhagem Celular Tumoral , Cromatina/metabolismo , Dano ao DNA , Desmetilação do DNA/efeitos da radiação , Metilação de DNA/genética , Metilação de DNA/efeitos da radiação , Instabilidade Genômica/efeitos da radiação , Guanosina/análogos & derivados , Guanosina/metabolismo , Metilação/efeitos da radiação , Camundongos , Estresse Fisiológico/efeitos da radiação
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA