First Report of Sweet potato leaf curl virus on Blue Morning Glory in Greece.

Blue morning glory (Ipomoea indica, Convolvulaceae) plants are widespread along the Greek coast, where they grow as weeds in addition to being cultivated as ornamentals. Yellow vein symptoms are frequently observed on these plants. These symptoms are similar to those reported for isolates of Sweet potato leaf curl virus (SPLCV) infecting I. indica in Italy and Spain (1,3). SPLCV belongs to the sweepoviruses, a unique group within the genus Begomovirus in the family Geniminiviridae that infects sweet potato (I. batatas) crops around the world. In May 2013, three leaf samples of I. indica showing yellow vein symptoms were collected in Kolymbari (Crete Island), where ~50% of the observed plants were symptomatic, and five asymptomatic leaf samples were collected in Kremasti and Mandriko (Rhodes Island). Total DNA, isolated from all samples, was used as a template in rolling-circle amplification (RCA) using ϕ29 DNA polymerase (TempliPhi kit, GE Healthcare, Little Chalfont, UK) and the product was digested with a set of restriction endonucleases. The samples from Kolymbari and one sample from Kremasti yielded amplification products that were shown to contain a single BamHI site. The DNA fragments of ~2.8 kbp obtained from one sample from each island were cloned into pBluescript II SK(+) (Stratagene, La Jolla, CA). Inserts of two clones from the Kolymbari sample and one clone from the Kremasti sample were completely sequenced (Macrogen, Seoul, South Korea). Sequences were aligned with available sequences of sweepoviruses using MUSCLE and pairwise identity scores were calculated with SDT as described (4). The sequences obtained from Kolymbari (2,830 nt, GenBank Accession Nos. KF697069 and KF697070) were 98.8% similar between them and showed the highest nucleotide identity (97.7%) with a SPLCV isolate obtained from an I. indica plant in Sicily Island (Italy) (AJ586885) (1). The sequence obtained from Kremasti (2,804 nt, KF697071) showed the highest nucleotide identity (92.4%) with a SPLCV isolate (previously named as Ipomoea yellow vein virus, which is currently a synonym of SPLCV [2]) obtained from an I. indica plant from southern Spain (EU839578) (3). Nucleotide sequence identities were above the 91% threshold for begomovirus species demarcation (2), thus confirming that the begomoviruses found infecting I. indica in Greece are isolates of SPLCV. It is worth to note that the infected I. indica plant from Kremasti did not show any conspicuous symptoms, thus highlighting the importance of this species as an alternative host for SPLCV, which could thus affect the sweet potato crop that is grown in Greece in familiar plots. To our knowledge, this is the first report of SPLCV in Greece. References: (1) R. W. Briddon et al. Plant Pathol. 55:286, 2006. (2) ICTV Geminiviridae Study Group. New species and revised taxonomy proposal for the genus Begomovirus (Geminiviridae). ICTV. Retrieved from http://talk.ictvonline.org/files/proposals/taxonomy_proposals_plant1/ m/plant04/4720.aspx , 20 November 2013. (3) G. Lozano et al. J. Gen. Virol. 90:2550, 2009. (4) B. Muhire et al. Arch. Virol. 158:1411, 2013.

First Detection of Tomato leaf curl New Delhi virus Infecting Zucchini in Spain.

In September 2012, a novel disease syndrome was observed in zucchini (Cucurbita pepo L.) crops in Murcia Province (southeastern Spain). Symptoms included curling, vein swelling, and severe mosaic in young leaves, short internodes, and fruit skin roughness, resembling begomovirus infection. Similar symptoms were observed in May 2013 in Almería Province (southern Spain). DNA was isolated from 8 and 7 symptomatic leaf samples collected in Murcia and Almería, respectively, and analyzed by PCR with primers GemCP-V-5' and GemCP-C-3' designed to detect begomoviruses by amplifying the core of coat protein gene (CP) (3). DNA fragments of the expected size (~600 bp) were amplified supporting a begomovirus infection. The DNA sequences obtained from four samples were identical. BLAST analysis showed the highest nucleotide identity (98%) with partial CP gene sequences from isolates of Tomato leaf curl New Delhi virus (ToLCNDV) infecting cucumber in India (GenBank Accession No. KC846817). ToLCNDV, a bipartite begomovirus first reported from tomato, also infects other solanaceous and cucurbitaceous crops in India and neighboring countries (1). DNA from two samples from Murcia and three from Almería was used for rolling-circle amplification using ϕ29 DNA polymerase (TempliPhi kit, GE Healthcare, Little Chalfont, UK) and digested with a set of restriction endonucleases. All five samples yielded amplification products with identical restriction patterns. Two samples from Murcia (MU-8.1 and MU-11.1) and one from Almería (AL-661) were selected to clone the putative DNA-A and DNA-B begomovirus genome components by using single BamHI or NcoI sites. Inserts of two clones from each sample, one corresponding to DNA-A and one to DNA-B, were completely sequenced. The cloned genomes exhibited the typical organization of Old World bipartite begomoviruses (1). Sequences were aligned with begomovirus sequences available in databases using MUSCLE and pairwise identity scores were calculated with SDT (species demarcation tool [4]). DNA-A sequences obtained from Murcia (2,738 nt, KF749224 and KF749225) and Almería (2,738 nt, KF749223) shared >99% nucleotide identity, with the highest nucleotide identity (91.3 to 91.5%) with that of an Indian ToLCNDV isolate from chilli (HM007120). DNA-B sequences (2,684 nt, KF749226, KF749227, and KF749228) shared >99% nucleotide identity, and showed the highest nucleotide identity (83.1 to 83.3%) with that of a Pakistani ToLCNDV isolate from Solanum nigrum (AJ620188). Nucleotide sequence identity of DNA-A with the most closely related begomoviruses was above the 91% threshold for species demarcation (2), thus confirming that the begomoviruses found infecting zucchini in Spain are isolates of ToLCNDV. In fall 2013, the disease was widespread in zucchini both in Murcia and Almería, and ToLCNDV has also been found infecting melon and cucumber crops. To our knowledge, this is the first report of a bipartite begomovirus in Spain and Europe. References: (1) J. K. Brown et al. Page 351 in: Virus Taxonomy. Ninth Report of the ICTV. A. M. Q. King et al., eds. Elsevier/Academic Press, London, 2012. (2) ICTV Geminiviridae Study Group. New species and revised taxonomy proposal for the genus Begomovirus (Geminiviridae). ICTV. Retrieved from http://talk.ictvonline.org/files/proposals/ taxonomy_proposals_plant1/m/plant04/4720.aspx , 10 October 2013. (3) H. Lecoq and C. Desbiez. Adv. Virus Res. 84:67, 2012. (4) B. Muhire et al. Arch. Virol. 158:1411, 2013.

Tobacco: A New Natural Host of Tomato chlorosis virus in Spain.

In March 2013, symptoms of mild leaf curling, mosaic, and interveinal yellowing were observed in tobacco (Nicotiana tabacum) plants grown in a row surrounding the exterior of a greenhouse containing a tomato crop in Guía de Isora, Tenerife (Canary Islands, Spain). The tobacco plants were found lightly infested by the whitefly (Hemiptera: Aleyrodidae) Bemisia tabaci. The greenhouses in this area are devoted to the commercial production of tomato. The farmers grow some tobacco plants inside and outside of them as a reservoir of parasitoids and depredators of B. tabaci. This insect is the natural vector of the main viruses severely affecting tomato in the Canary Islands, the begomovirus Tomato yellow leaf curl virus and the crinivirus Tomato chlorosis virus (ToCV). ToCV was detected in Spain in 1997 (2) and has become established in most of the coastal provinces of eastern and southern continental Spain and in the Canary Islands. Approximately 50% of the tomato plants grown inside the greenhouse close to the tobacco plants showed typical ToCV symptoms, and infection by this virus was confirmed in the seven plants tested by reverse transcription (RT)-PCR using specific coat protein gene (CP) primers (see below). Total RNA was extracted with TRIzol Reagent (Invitrogen) from leaves of five tobacco plants showing the symptoms mentioned above and analyzed by dot-blot hybridization using digoxigenin-labeled RNA probes to the CP gene of ToCV. Positive signal was obtained for all five plants. RT-PCR reactions were performed with specific primers for the detection of ToCV, MA380(+) (5'-GTGAGACCCCGATGACAGAT-3') and MA381(-) (5'-TACAGTTCCTTGCCCTCGTT-3'), specific to the CP gene (ToCV RNA 2) (3), and MA396(+) (5'-TGGTCGAACAGTTTGAGAGC-3') and MA397(-) (5'-TGAACTCGAATTGGGACAGA-3'), specific to the RNA-dependent RNA polymerase (RdRp) gene (ToCV RNA 1) (1). DNA fragments of the expected size (436 and 763 bp, respectively) were obtained, thus supporting the presence of ToCV in the symptomatic samples. The amplified product of the RdRp gene fragment from one sample was directly sequenced (Macrogen Inc., South Korea) and resulted closely related to ToCV isolates from Sudan (GenBank Accession No. JN411686, 99.6% nt identity) and Spain (DQ983480, 99.4% nt identity), thereby confirming the infection by this virus. Partial sequence of the ToCV isolate from tobacco was deposited in GenBank under accession no. KJ175084. In addition, all five plants resulted positive when analyzed by ELISA for Tomato spotted wilt virus and Potato virus Y and by PCR for Tomato yellow leaf curl virus (data not shown), all three viruses reported to infect naturally tobacco. Although tobacco has been reported as an experimental host of ToCV (4), to our knowledge, this is the first report of this species as a natural host of this virus. The finding of ToCV infecting tobacco raises the question of whether this virus could emerge as a pathogen of this crop and questions the use that farmers make of tobacco as reservoirs of natural enemies for whitefly control in tomato. References: (1) G. Lozano et al. J. Virol. 83:12973, 2009. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) H. P. Trenado et al. Eur. J. Plant Pathol. 118:193, 2007 (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

First Report of China Rose (Hibiscus rosa-sinensis) as a Host of Alfalfa mosaic virus in Spain.

China rose (Hibiscus rosa-sinensis L.) is an ornamental plant grown throughout the tropics and subtropics. In June 2011, a China rose plant (sample CV-1) showing bright yellow "aucuba"-type mosaic, mainly at the center of the leaves, was found in a public garden in Caleta de Vélez (Málaga Province, southern Spain). Electron microscope examination of negatively stained preparations from the symptomatic plant revealed the presence of semispherical to bacilliform virus-like particles of 30 to 56 × 16 nm. Sap extracts also reacted positively in double-antibody sandwich (DAS)-ELISA to antiserum against Alfalfa mosaic virus (AMV) (Bioreba AG, Reinach, Switzerland). RNA of this sample was extracted with the RNeasy Kit (Qiagen, Valencia, CA) and tested by reverse-transcription (RT)-PCR with AMV specific primers (2), using AMV and GoTaq Master Mixes (Promega, Madison, WI) for cDNA synthesis and amplification, respectively. After cloning and sequencing, the ~750-bp DNA fragment was confirmed as the coat protein (CP) gene of AMV (GenBank Accession No. HE591387) with the highest nucleotide identity of 96% to AMV isolates belonging to subgroup IIA (e.g., GenBank Accession No. AJ130707). Sap from affected leaves of sample CV-1 was mechanically inoculated onto herbaceous indicator plants (Chenopodium amaranticolor, C. quinoa, and Ocimum basilicum). Both Chenopodium species developed chlorotic local lesions followed by mosaic within 3 days after inoculation, and O. basilicum showed bright yellow mosaic of calico type 2 weeks postinoculation. These symptoms are consistent with those reported for AMV in these hosts (1). Virus infection in the inoculated plants was confirmed by DAS-ELISA and RT-PCR. To gain insight on the prevalence and genetic variability of AMV in China rose, a survey was carried out in nearby locations in the provinces of Málaga (14 samples from Torre del Mar and 5 samples from Rincón de la Victoria) and Granada (12 samples from La Herradura). Leaf samples were analyzed by tissue blot hybridization with an AMV-specific digoxigenin-labeled RNA probe obtained from the RNA 1 of the Spanish isolate Tec1 (3), and only two samples from Torre del Mar tested positive. One of these samples (TM-2) was used to amplify by RT-PCR the AMV CP gene that was cloned and sequenced (GenBank Accession No. HE591386). The highest nucleotide identity of the TM-2 CP gene (98%) was with the subgroup IIB Spanish isolate Tec1, whereas identity with the CV-1 isolate was 95%. Nevertheless, phylogenetic analysis (neighbor-joining method) showed that both CV-1 and TM-2 isolates belong to the recently proposed AMV subgroup IIB (3), which includes the Tec1 isolate and two other isolates from ornamental plants, Phlox paniculata from the United States (GenBank Accession No. DQ124429) and Viburnum lucidum from Spain (GenBank Accession No. EF427449). These results show that AMV subgroup IIB is emerging as a complex cluster of virus isolates that currently are reported to infect only ornamentals. To our knowledge, this is the first report of AMV naturally occurring in China rose. References: (1) G. Marchoux et al. Page 163 in: Virus des Solanacées. Quae éditions, Versailles, 2008. (2) G. Parrella et al. Arch. Virol. 145:2659, 2000. (3) G. Parrella et al. Arch. Virol. 156:1049, 2011.

First Report of Tomato chlorosis virus Infecting Tomato in Sudan.

In March 2011, interveinal yellowing and necrosis symptoms on middle and lower leaves were observed in tomato (Solanum lycopersicum L., cv. Castle Rock) plants grown in three adjacent greenhouses of the Agricultural Research Corporation at Wad Medani (Gezira State, Sudan). These symptoms resembled those caused by Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) (4) (genus Crinivirus, family Closteroviridae). Whitefly (Bemisia tabaci) infestation was also observed in these greenhouses. Total RNA was extracted by TRIzol Reagent (Invitrogen, Carlsbad, CA) from symptomatic leaves and analyzed by dot-blot hybridization with digoxigenin-labelled RNA probes to the coat protein (CP) gene of ToCV and to the minor coat protein (CPm) gene of TICV. Positive signal was obtained only with the ToCV probe. Reverse transcription (RT)-PCR reactions were performed with two pairs of primers specific for the detection of ToCV, MA380(+) (5'-GTGAGACCCCGATGACAGAT-3') and MA381(-) (5'-TACAGTTCCTTGCCCTCGTT-3'), specific to the CP gene (ToCV RNA 2) (3), and MA396(+) (5'-TGGTCGAACAGTTTGAGAGC-3') and MA397(-) (5'-TGAACTCGAATTGGGACAGA-3'), specific to the RNA-dependent RNA polymerase (RdRp) gene (ToCV RNA 1) (1). DNA fragments of the expected sizes (436 and 763 bp, respectively) were obtained, thus supporting the presence of ToCV in the symptomatic samples. Amplified DNA fragments were cloned in pGEM-T Easy vector (Promega, Madison, WI) and one clone per amplicon was sequenced (Macrogen Inc., Seoul, South Korea). The highest nucleotide sequence identity of the CP gene fragment obtained (GenBank Accession No. JN411685) was 99.2% related with North American ToCV isolates from Florida (DQ234674), Colorado (DQ234675), and Georgia (HQ879842), while the RdRp gene fragment (JN411686) was more closely related (99.0%) to the Spanish AT80/99 isolate (DQ983480). Although yellowing symptoms similar to those reported here have been observed sporadically during the last few years in open-field tomato crops in the state of Gezira, additional studies are needed to determine the prevalence and economic impact of ToCV infections in tomato cultivation in Sudan. To our knowledge, ToCV has been found in continental Africa only in Morocco and South Africa, in the Mediterranean climate areas in the northern and southern edges of the continent, respectively (2). The finding of ToCV infecting tomato in Sudan raises the question of whether this virus is emerging also in other tropical areas of the continent and illustrates the need to monitor whitefly-infested areas within Africa for the presence of ToCV. References: (1) G. Lozano et al. J. Virol. 83:12973, 2009. (2) J. Navas-Castillo et al. Annu. Rev. Phytopathol. 49:219, 2011. (3) H. P. Trenado et al. Eur. J. Plant Pathol. 118:193, 2007. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba.

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.