Effects of Thermal Exposure on the Microstructure and Mechanical Properties of a Ti-48Al-3Nb-1.5Ta Alloy via Powder Hot Isostatic Pressing.

Research on how thermal exposure affects the microstructure and mechanical properties of the Ti-48Al-3Nb-1.5Ta (at. %) alloy, which is prepared via powder hot isostatic pressing (P-HIP), is essential since this low-density alloy shows promise for use in high-temperature applications, particularly for aero-engines, which require long-term stable service. In this study, a P-HIP Ti-48Al-3Nb-1.5Ta (at. %) alloy was exposed to high temperatures for long durations. The phase, microstructure and mechanical properties of the P-HIP Ti-48Al-3Nb-1.5Ta alloy after thermal exposure under different conditions were analyzed using XRD, SEM, EBSD, EPMA, TEM, nanomechanical testing and tensile testing. The surface scale is composed of oxides and nitrides, primarily Al2O3, TiO2, and TiN, among which Al2O3 is preferentially generated and then covered by rapidly growing TiO2 as the thermal exposure duration increases. The nitrides appear later than the oxides and exist between the oxides and the substrate. With increasing exposure temperature and duration, the surface scale becomes more continuous, TiO2 particles grow larger, and the oxide layer thickens or even falls off. The addition of Ta and Nb can improve the oxidation resistance because Ta5+ and Nb5+ replace Ti4+ in the rutile lattice and weaken O diffusion. Compared with the P-HIP Ti-48Al-3Nb-1.5Ta alloy, after thermal exposure, the grain size does not increase significantly, and the γ phase increases slightly (by less than 3%) with the decomposition of the α2 phase. With increasing thermal exposure duration, the γ phase exhibits discontinuous coarsening (DC). Compared with the P-HIP Ti-48Al-3Nb-1.5Ta alloy, the hardness increases by about 2 GPa, the tensile strength increases by more than 50 MPa, and the fracture strain decreases by about 0.1% after thermal exposure. When the depth extends from the edge of the thermally exposed specimens, the hardness decreases overall.

Pan-cancer analyses of bromodomain containing 9 as a novel therapeutic target reveals its diagnostic, prognostic potential and biological mechanism in human tumours.

BACKGROUND: Mutations in one or more genes responsible for encoding subunits within the SWItch/Sucrose Non-Fermentable (SWI/SNF) chromatin-remodelling complexes are found in approximately 25% of cancer patients. Bromodomain containing 9 (BRD9) is a more recently identified protein coding gene, which can encode SWI/SNF chromatin-remodelling complexes subunits. Although initial evaluations of the potential of BRD9-based targeted therapy have been explored in the clinical application of a small number of cancer types, more detailed study of the diagnostic and prognostic potential, as well as the detailed biological mechanism of BRD9 remains unreported. METHODS: We used various bioinformatics tools to generate a comprehensive, pan-cancer analyses of BRD9 expression in multiple disease types described in The Cancer Genome Atlas (TCGA). Experimental validation was conducted in tissue microarrays and cell lines derived from lung and colon cancers. RESULTS: Our study revealed that BRD9 exhibited elevated expression in a wide range of tumours. Analysis of survival data and DNA methylation for BRD9 indicated distinct conclusions for multiple tumours. mRNA splicing and molecular binding were involved in the functional mechanism of BRD9. BRD9 may affect cancer progression through different phosphorylation sites or N6 -methyladenosine site modifications. BRD9 could potentially serve as a novel biomarker for diagnosing different cancer types, especially could accurately forecast the prognosis of melanoma patients receiving anti-programmed cell death 1 immunotherapy. BRD9 has the potential to serve as a therapeutic target, when pairing with etoposide in patients with melanoma. The BRD9/SMARCD1 axis exhibited promising discriminative performance in forecasting the prognosis of patients afflicted with liver hepatocellular carcinoma (LIHC) and mesothelioma. Additionally, this axis appears to potentially influence the immune response in LIHC by regulating the programmed death-ligand 1 immune checkpoint. For experimental validation, high expression levels of BRD9 were observed in tumour tissue samples from both lung and colon cancer patients. Knocking down BRD9 led to the inhibition of lung and colon cancer development, likely via the Wnt/ß-catenin signalling pathway. CONCLUSIONS: These pan-cancer study revealed the diagnostic and prognostic potential, along with the biological mechanism of BRD9 as a novel therapeutic target in human tumours.

Mitochondria-derived small RNAs as diagnostic biomarkers in lung cancer patients through a novel ratio-based expression analysis methodology.

Small non-coding RNAs are potential diagnostic biomarkers for lung cancer. Mitochondria-derived small RNA (mtRNA) is a novel regulatory small non-coding RNA that only recently has been identified and cataloged. Currently, there are no reports of studies of mtRNA in human lung cancer. Currently, normalization methods are unstable, and they often fail to identify differentially expressed small non-coding RNAs (sncRNAs). In order to identify reliable biomarkers for lung cancer screening, we used a ratio-based method using mtRNAs newly discovered in human peripheral blood mononuclear cells. In the discovery cohort (AUC = 0.981) and independent validation cohort (AUC = 0.916) the prediction model of eight mtRNA ratios distinguished lung cancer patients from controls. The prediction model will provide reliable biomarkers that will allow blood-based screening to become more feasible and will help make lung cancer diagnosis more accurate in clinical practice.

Integrated Analysis of Bulk RNA-Seq and Single-Cell RNA-Seq Unravels the Influences of SARS-CoV-2 Infections to Cancer Patients.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a highly contagious and pathogenic coronavirus that emerged in late 2019 and caused a pandemic of respiratory illness termed as coronavirus disease 2019 (COVID-19). Cancer patients are more susceptible to SARS-CoV-2 infection. The treatment of cancer patients infected with SARS-CoV-2 is more complicated, and the patients are at risk of poor prognosis compared to other populations. Patients infected with SARS-CoV-2 are prone to rapid development of acute respiratory distress syndrome (ARDS) of which pulmonary fibrosis (PF) is considered a sequelae. Both ARDS and PF are factors that contribute to poor prognosis in COVID-19 patients. However, the molecular mechanisms among COVID-19, ARDS and PF in COVID-19 patients with cancer are not well-understood. In this study, the common differentially expressed genes (DEGs) between COVID-19 patients with and without cancer were identified. Based on the common DEGs, a series of analyses were performed, including Gene Ontology (GO) and pathway analysis, protein-protein interaction (PPI) network construction and hub gene extraction, transcription factor (TF)-DEG regulatory network construction, TF-DEG-miRNA coregulatory network construction and drug molecule identification. The candidate drug molecules (e.g., Tamibarotene CTD 00002527) obtained by this study might be helpful for effective therapeutic targets in COVID-19 patients with cancer. In addition, the common DEGs among ARDS, PF and COVID-19 patients with and without cancer are TNFSF10 and IFITM2. These two genes may serve as potential therapeutic targets in the treatment of COVID-19 patients with cancer. Changes in the expression levels of TNFSF10 and IFITM2 in CD14+/CD16+ monocytes may affect the immune response of COVID-19 patients. Specifically, changes in the expression level of TNFSF10 in monocytes can be considered as an immune signature in COVID-19 patients with hematologic cancer. Targeting N6-methyladenosine (m6A) pathways (e.g., METTL3/SERPINA1 axis) to restrict SARS-CoV-2 reproduction has therapeutic potential for COVID-19 patients.

Comprehensive landscape of tRNA-derived fragments in lung cancer.

Transfer RNA (tRNA)-derived fragment (tRDF) is a novel small non-coding RNA that presents in different types of cancer. The comprehensive understanding of tRDFs in non-small cell lung cancer remains largely unknown. In this study, 1,550 patient samples of non-small cell lung cancer (NSCLC) were included, and 52 tRDFs with four subtypes were identified. Six tRDFs were picked as diagnostic signatures based on the tRDFs expression patterns, and area under the curve (AUC) in independent validations is up to 0.90. Two signatures were validated successfully in plasma samples, and six signatures confirmed the consistency of distinguished expression in NSCLC cell lines. Ten tRDFs along with independent risk scores can be used to predict survival outcomes by stages; 5a_tRF-Ile-AAT/GAT can be a prognosis biomarker for early stage. Association analysis of tRDFs-signatures-correlated mRNAs and microRNA (miRNA) were targeted to the cell cycle and oocyte meiosis signaling pathways. Five tRDFs were assessed to associate with PD-L1 immune checkpoint and correlated with the genes that target in PD-L1 checkpoint signaling pathway. Our study is the first to provide a comprehensive analysis of tRDFs in lung cancer, including four subtypes of tRDFs, investigating the diagnostic and prognostic values, and demonstrated their biological function and transcriptional role as well as potential immune therapeutic value.

Association of Septic Shock with Mortality in Hospitalized COVID-19 Patients in Wuhan, China.

Purpose: Septic shock is a severe complication of COVID-19 patients. We aim to identify risk factors associated with septic shock and mortality among COVID-19 patients. Methods: A total of 212 COVID-19 confirmed patients in Wuhan were included in this retrospective study. Clinical outcomes were designated as nonseptic shock and septic shock. Log-rank test was conducted to determine any association with clinical progression. A prediction model was established using random forest. Results: The mortality of septic shock and nonshock patients with COVID-19 was 96.7% (29/30) and 3.8% (7/182). Patients taking hypnotics had a much lower chance to develop septic shock (HR = 0.096, p=0.0014). By univariate logistic regression analysis, 40 risk factors were significantly associated with septic shock. Based on multiple regression analysis, eight risk factors were shown to be independent risk factors and these factors were then selected to build a model to predict septic shock with AUC = 0.956. These eight factors included disease severity (HR = 15, p < 0.001), age > 65 years (HR = 2.6, p=0.012), temperature > 39.1°C (HR = 2.9, p=0.047), white blood cell count > 10 × 109 (HR = 6.9, p < 0.001), neutrophil count > 75 × 109 (HR = 2.4, p=0.022), creatine kinase > 5 U/L (HR = 1.8, p=0.042), glucose > 6.1 mmol/L (HR = 7, p < 0.001), and lactate > 2 mmol/L (HR = 22, p < 0.001). Conclusions: We found 40 risk factors were significantly associated with septic shock. The model contained eight independent factors that can accurately predict septic shock. The administration of hypnotics could potentially reduce the incidence of septic shock in COVID-19 patients.

Analysis and Performance Assessment of the Whole Genome Bisulfite Sequencing Data Workflow: Currently Available Tools and a Practical Guide to Advance DNA Methylation Studies.

DNA methylation is associated with transcriptional repression, genomic imprinting, stem cell differentiation, embryonic development, and inflammation. Aberrant DNA methylation can indicate disease states, including cancer and neurological disorders. Therefore, the prevalence and location of 5-methylcytosine in the human genome is a topic of interest. Whole-genome bisulfite sequencing (WGBS) is a high-throughput method for analyzing DNA methylation. This technique involves library preparation, alignment, and quality control. Advancements in epigenetic technology have led to an increase in DNA methylation studies. This review compares the detailed experimental methodology of WGBS using accessible and up-to-date analysis tools. Practical codes for WGBS data processing are included as a general guide to assist progress in DNA methylation studies through a comprehensive case study.

The miRNA Profile of Inflammatory Colorectal Tumors Identify TGF-ß as a Companion Target for Checkpoint Blockade Immunotherapy.

Extrinsic factors such as expression of PD-L1 (programmed dealth-ligand 1) in the tumor microenvironment (TME) have been shown to correlate with responses to checkpoint blockade therapy. More recently two intrinsic factors related to tumor genetics, microsatellite instability (MSI), and tumor mutation burden (TMB), have been linked to high response rates to checkpoint blockade drugs. These response rates led to the first tissue-agnostic approval of any cancer therapy by the FDA for the treatment of metastatic, MSI-H tumors with anti-PD-1 immunotherapy. But there are still very few studies focusing on the association of miRNAs with immune therapy through checkpoint inhibitors. Our team sought to explore the biology of such tumors further and suggest potential companion therapeutics to current checkpoint inhibitors. Analysis by Pearson Correlation revealed 41 total miRNAs correlated with mutation burden, 62 miRNAs correlated with MSI, and 17 miRNAs correlated with PD-L1 expression. Three miRNAs were correlated with all three of these tumor features as well as M1 macrophage polarization. No miRNAs in any group were associated with overall survival. TGF-ß was predicted to be influenced by these three miRNAs (p = 0.008). Exploring miRNA targets as companions to treatment by immune checkpoint blockade revealed three potential miRNA targets predicted to impact TGF-ß. M1 macrophage polarization state was also associated with tumors predicted to respond to therapy by immune checkpoint blockade.

Risk Factors Associated With Clinical Outcomes in 323 Coronavirus Disease 2019 (COVID-19) Hospitalized Patients in Wuhan, China.

BACKGROUND: With evidence of sustained transmission in more than 190 countries, coronavirus disease 2019 (COVID-19) has been declared a global pandemic. Data are urgently needed about risk factors associated with clinical outcomes. METHODS: A retrospective review of 323 hospitalized patients with COVID-19 in Wuhan was conducted. Patients were classified into 3 disease severity groups (nonsevere, severe, and critical), based on initial clinical presentation. Clinical outcomes were designated as favorable and unfavorable, based on disease progression and response to treatments. Logistic regression models were performed to identify risk factors associated with clinical outcomes, and log-rank test was conducted for the association with clinical progression. RESULTS: Current standard treatments did not show significant improvement in patient outcomes. By univariate logistic regression analysis, 27 risk factors were significantly associated with clinical outcomes. Multivariate regression indicated age >65 years (P < .001), smoking (P = .001), critical disease status (P = .002), diabetes (P = .025), high hypersensitive troponin I (>0.04 pg/mL, P = .02), leukocytosis (>10 × 109/L, P < .001), and neutrophilia (>75 × 109/L, P < .001) predicted unfavorable clinical outcomes. In contrast, the administration of hypnotics was significantly associated with favorable outcomes (P < .001), which was confirmed by survival analysis. CONCLUSIONS: Hypnotics may be an effective ancillary treatment for COVID-19. We also found novel risk factors, such as higher hypersensitive troponin I, predicted poor clinical outcomes. Overall, our study provides useful data to guide early clinical decision making to reduce mortality and improve clinical outcomes of COVID-19.

Microbial Community Changes in the Rhizosphere Soil of Healthy and Rusty Panax ginseng and Discovery of Pivotal Fungal Genera Associated with Rusty Roots.

Panax ginseng Meyer, a valuable medicinal plant, is severely threatened by rusty root, a condition that greatly affects its yield and quality. Studies investigating the relationship between soil microbial community composition and rusty roots are vital for the production of high-quality ginseng. Here, high-throughput sequencing was employed to systematically characterize changes in the soil microbial community associated with rusty roots. Fungal diversity was lower in the soils of rusty root-affected P. ginseng than in those of healthy plants. Importantly, principal coordinate analysis separated the fungal communities in the rhizosphere soils of rusty root-affected ginseng from those of healthy plants. The dominant bacterial and fungal genera differed significantly between rhizosphere soils of healthy and rusty root-affected P. ginseng, and linear discriminant analysis effect size (LEfSe) further indicated a strong imbalance in the soil microbial community of diseased plants. Significantly enriched bacterial genera (including Rhodomicrobium, Knoellia, Nakamurella, Asticcacaulis, and Actinomadura) were mainly detected in the soil of rusty root-affected P. ginseng, whereas significantly enriched fungal genera (including Xenopolyscytalum, Arthrobotrys, Chalara, Cryptococcus, and Scutellinia) were primarily detected in the soil of healthy plants. Importantly, five fungal genera (Cylindrocarpon, Acrophialophora, Alternaria, Doratomyces, and Fusarium) were significantly enriched in the soil of rusty root-affected plants compared with that of healthy plants, suggesting that an increase in the relative abundance of these pathogenic fungi (Cylindrocarpon, Alternaria, and Fusarium) may be associated with ginseng rusty roots. Additionally, this study is the first to report that an increase in the relative abundances of Acrophialophora and Doratomyces in the rhizosphere of P. ginseng may be associated with the onset of rusty root symptoms in this plant. Our findings provide potentially useful information for developing biological control strategies against rusty root, as well as scope for future screening of fungal pathogens in rusty roots of P. ginseng.

Isolation and Identification of Porcine Deltacoronavirus and Alteration of Immunoglobulin Transport Receptors in the Intestinal Mucosa of PDCoV-Infected Piglets.

Porcine deltacoronavirus (PDCoV) is a porcine enteropathogenic coronavirus that causes watery diarrhea, vomiting, and frequently death in piglets, causing serious economic losses to the pig industry. The strain CHN-JS-2017 was isolated and identified by cytopathology, immunofluorescence assays, transmission electron microscopy, and sequence analysis. A nucleotide sequence alignment showed that the whole genome of CHN-JS-2017 is 97.4%-99.6% identical to other PDCoV strains. The pathogenicity of the CHN-JS-2017 strain was investigated in orally inoculated five-day-old piglets; the piglets developed acute, watery diarrhea, but all recovered and survived. CHN-JS-2017 infection-induced microscopic lesions were observed, and viral antigens were detected mainly by immunohistochemical staining in the small intestine. The neonatal Fc receptor (FcRn) and polymeric immunoglobulin receptor (pIgR) are crucial immunoglobulin (Ig) receptors for the transcytosis ofimmunoglobulin G (IgG), IgA, or IgM. Importantly, CHN-JS-2017 infected five-day-old piglets could significantly down-regulate the expression of FcRn, pIgR, and nuclear factor-kappa B (NF-κB)in the intestinal mucosa. Note that the level of FcRn mRNA in the intestinal mucosa of normal piglets is positively correlated with pIgR and NF-κB. At the same time, the expressions of FcRn, pIgR, and NF-κB mRNA are also positively correlated in infected piglets. These results may help explain the immunological and pathological changes associated with porcine deltacorononirus infection.

DNA Mini-Barcoding: A Derived Barcoding Method for Herbal Molecular Identification.

In recent years, the demand for natural herbal products (NHP) has increased; however, the quality of these products is difficult to confirm due to the lack of a comprehensive quality control system. Traditional methods are not effective in detecting processed ingredients. DNA barcoding is an established technique that has been used for more than 10 years. This technique uses short standard sequences (generally 200-600 bp) to identify species. While a complete DNA barcode is difficult to obtain from NHP due to DNA degradation, mini-barcoding is a complementary tool to identify species in NHP. DNA mini-barcoding uses smaller DNA segments for polymerase chain reaction amplification and can be applied to identify species rapidly. The present review summarizes the development and application of DNA mini-barcodes over recent years and discusses the limitations of this technique. This review also compares mini-barcoding and meta-barcoding, a technique using universal polymerase chain reaction primers to simultaneously amplify multiple DNA barcodes and identify many species in a single environmental sample. Additionally, other detection methods that can be combined with mini-barcodes, such as nucleotide signatures, high-resolution DNA melting analysis, and gold nanoparticles, are discussed. DNA mini-barcoding can fill the gaps left by other methods in the field of herbal molecular identification.

Transmissible Gastroenteritis Virus Infection Up-Regulates FcRn Expression via Nucleocapsid Protein and Secretion of TGF-ß in Porcine Intestinal Epithelial Cells.

Transmissible gastroenteritis virus (TGEV) is a porcine intestinal coronavirus that causes fatal severe watery diarrhea in piglets. The neonatal Fc receptor (FcRn) is the only IgG transport receptor, its expression on mucosal surfaces is triggered upon viral stimulation, which significantly enhances mucosal immunity. We utilized TGEV as a model pathogen to explore the role of FcRn in resisting viral invasion in overall intestinal mucosal immunity. TGEV induced FcRn expression by activating NF-κB signaling in porcine small intestinal epithelial (IPEC-J2) cells, however, the underlying mechanisms are unclear. First, using small interfering RNAs, we found that TGEV up-regulated FcRn expression via TLR3, TLR9 and RIG-I. Moreover, TGEV induced IL-1ß, IL-6, IL-8, TGF-ß, and TNF-α production. TGF-ß-stimulated IPEC-J2 cells highly up-regulated FcRn expression, while treatment with a JNK-specific inhibitor down-regulated the expression. TGEV nucleocapsid (N) protein also enhanced FcRn promoter activity via the NF-κB signaling pathway and its central region (aa 128-252) was essential for FcRn activation. Additionally, N protein-mediated FcRn up-regulation promotes IgG transcytosis. Thus, TGEV N protein and TGF-ß up-regulated FcRn expression, further clarifying the molecular mechanism of up-regulation of FcRn expression by TGEV.

Rapid Authentication of Ginkgo biloba Herbal Products Using the Recombinase Polymerase Amplification Assay.

Species adulteration in herbal products (HPs) exposes consumers to health risks. Chemical and morphological methods have their own deficiencies when dealing with the detection of species containing the same active compounds in HPs. In this study, we developed a rapid identification method using the recombinase polymerase amplification (RPA) assay to detect two species, Ginkgo biloba and Sophora japonica (as adulteration), in Ginkgo biloba HPs. Among 36 Ginkgo biloba HP samples, 34 were found to have Ginkgo biloba sequences, and 9 were found to have Sophora japonica sequences. During the authentication process, the RPA-LFS assay showed a higher specificity, sensitivity and efficiency than PCR-based methods. We initially applied the RPA-LSF technique to detect plant species in HPs, demonstrating that this assay can be developed into an efficient tool for the rapid on-site authentication of plant species in Ginkgo biloba HPs.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers.

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.