NMR insights into ß-Lactamase activity of UVI31+ Protein from Chlamydomonas reinhardtii.

ß-Lactamases (EC 3.5.2.6) confer resistance against ß-lactam group-containing antibiotics in bacteria and higher eukaryotes, including humans. Pathogenic bacterial resistance against ß-lactam antibiotics is a primary concern for potential therapeutic developments and drug targets. Here, we report putative ß-lactamase activity, sulbactam binding (a ß-lactam analogue) in the low µM affinity range, and site-specific interaction studies of a 14 kDa UV- and dark-inducible protein (abbreviated as UVI31+, a BolA homologue) from Chlamydomonas reinhartii. Intriguingly, the solution NMR structure of UVI31 + bears no resemblance to other known ß-lactamases; however, the sulbactam binding is found at two sites rich in positively charged residues, mainly at the L2 loop regions and the N-terminus. Using NMR spectroscopy, ITC and MD simulations, we map the ligand binding sites in UVI31 + providing atomic-level insights into its ß-lactamase activity. Current study is the first report on ß-lactamase activity of UVI31+, a BolA analogue, from C. reinhartii. Furthermore, our mutation studies reveal that the active site serine-55 is crucial for ß-lactamase activity.

Novel strains of a pandemic plant virus, tomato spotted wilt orthotospovirus, increase vector fitness and modulate virus transmission in a resistant host.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single-gene resistant cultivars of tomato ("Sw-5b" gene) and pepper ("Tsw" gene) deployed worldwide. However, the emergence of resistance-breaking strains (RB) in recent years has compounded the threat of TSWV to agricultural production worldwide. Despite this, an extensive study on the thrips transmission biology of RB strains is currently lacking. It is also unclear whether mutualistic TSWV-thrips interactions vary across different novel strains with disparate geographical origins. To address both critical questions, we studied whether and how four novel RB strains of TSWV (two sympatric and two allopatric), along with a non-RB strain, impact western flower thrips (WFT) fitness and whether this leads to differences in TSWV incidence, symptom severity (virulence), and virus accumulation in two differentially resistant tomato cultivars. Our findings show that all RB strains increased WFT fitness by prolonging the adult period and increasing fecundity compared to non-RB and non-viruliferous controls, regardless of the geographical origin of strains or the TSWV titers in individual thrips, which were substantially low in allopatric strains. TSWV accumulation in thrips varied at different developmental stages and was unrelated to the infected tissues from which thrips acquired the virus. However, it was significantly positively correlated to that in WFT-inoculated susceptible plants, but not the resistant ones. The TSW incidences were high in tomato plants infected with all RB strains, ranging from 80% to 90% and 100% in resistant and susceptible plants, respectively. However, TSW incidence in the non-RB-infected susceptible tomato plants was 80%. Our findings provide new insights into how novel strains of TSWV, by selectively offering substantial fitness benefits to vectors, modulate transmission and gain a potential epidemiological advantage over non-RB strains. This study presents the first direct evidence of how vector-imposed selection pressure, besides the one imposed by resistant cultivars, may contribute to the worldwide emergence of RB strains.

Effects of Host Plants and Their Infection Status on Acquisition and Inoculation of A Plant Virus by Its Hemipteran Vector.

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

Seed Transmission of Wheat Streak Mosaic Virus and Triticum Mosaic Virus in Differentially Resistant Wheat Cultivars.

Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are important viral pathogens of wheat in the Great Plains. These viruses individually or in mixed infections with High Plains wheat mosaic virus cause a devastating wheat streak mosaic (WSM) disease. Although seed transmission of WSMV has been studied, no information is currently available on that of TriMV. Furthermore, no study has explored the implications of mixed infections of WSMV and TriMV on seed transmission of one or both viruses. To study both aspects, seeds from differentially resistant field-grown wheat plants (cv. TAM 304 (susceptible), Joe (WSMV resistant, Wsm2 gene), and Breakthrough (BT) (WSMV and TriMV resistant, Wsm1 gene)) showing characteristic WSM symptoms were collected and analyzed to quantify both viruses using qRT-PCR. The percentage of seeds tested positive for WSMV or TriMV individually and in mixed infection varied with cultivar and virus combinations; 13% of TAM 304 seeds tested positive for WSMV, followed by 8% of BT and 4% of Joe seeds. Similarly, TriMV was detected in 12% of BT seeds, followed by 11% of TAM 304 and 8% of Joe seeds. Lastly, mixed infection was detected in 7% of TAM 304 seeds, followed by 4% in BT, and 2% in Joe. Dissection of field-collected seeds into three parts, embryo, endosperm, and seed coat, revealed both WSMV and TriMV accumulated only in the seed coat. Consistent with seeds, percent infection of WSMV or TriMV in the plants that emerged from infected seeds in each treatment varied with cultivar and virus combinations (WSMV: BT 3%; Joe 2%; TAM 304 9%; TriMV: BT 7%; Joe 8%; and TAM 304 10%). Plants infected with mixed viruses showed more pronounced WSM symptoms compared to individual infections. However, both viruses were present only in a few plants (BT: 2%, Joe: 1%, and TAM 304: 4%). Taken together, this study showed that TriMV was transmitted vertically at a higher frequency than WSMV in resistant cultivars, and the seed transmission of TriMV with WSMV increased the virulence of both pathogens (measured via WSM symptom severity) in the emerged plants. Furthermore, Wsm1 and Wsm2 genes considerably reduced WSMV transmission via infected seeds. However, no such effects were observed on TriMV, especially in progeny plants. These results reiterated the importance of planting clean seeds and highlighted the immediate need to identify/develop new sources of TriMV resistance to effectively manage the recurring WSM epidemic.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Sida Golden Mosaic Virus, an Emerging Pathogen of Snap Bean (Phaseolus vulgaris L.) in the Southeastern United States.

Sida golden mosaic virus (SiGMV) was first detected from snap bean (Phaseolus vulgaris L.) in Florida in 2006 and recently in Georgia in 2018. Since 2018, it has caused significant economic losses to snap bean growers in Georgia. This study, using a SiGMV isolate field-collected from prickly sida (Sida spinosa L.), examined the putative host range, vector-mediated transmission, and SiGMV-modulated effects on host-vector interactions. In addition, this study analyzed the phylogenetic relationships of SiGMV with other begomoviruses reported from Sida spp. Host range studies confirmed that SiGMV can infect seasonal crops and perennial weed species such as snap bean, hollyhock (Alcea rosea L.), marsh mallow (Althaea officinalis L.), okra (Abelmoschus esculentus (L.) Moench), country mallow (Sida cordifolia L.), prickly sida (S. spinosa), and tobacco (Nicotiana tabacum L.). The incidence of infection ranged from 70 to 100%. SiGMV-induced symptoms and virus accumulation varied between hosts. The vector, Bemisia tabaci Gennadius, was able to complete its life cycle on all plant species, irrespective of SiGMV infection status. However, SiGMV infection in prickly sida and country mallow positively increased the fitness of whiteflies, whereas SiGMV infection in okra negatively influenced whitefly fitness. Whiteflies efficiently back-transmitted SiGMV from infected prickly sida, hollyhock, marsh mallow, and okra to snap bean, and the incidence of infection ranged from 27 to 80%. Complete DNA-A sequence from this study shared 97% identity with SiGMV sequences reported from Florida and it was determined to be closely related with sida viruses reported from the New World. These results suggest that SiGMV, a New World begomovirus, has a broad host range that would allow its establishment in the farmscapes/landscapes of the southeastern United States and is an emerging threat to snap bean and possibly other crops.

The AAA+ chaperone VCP disaggregates Tau fibrils and generates aggregate seeds in a cellular system.

Amyloid-like aggregates of the microtubule-associated protein Tau are associated with several neurodegenerative disorders including Alzheimer's disease. The existence of cellular machinery for the removal of such aggregates has remained unclear, as specialized disaggregase chaperones are thought to be absent in mammalian cells. Here we show in cell culture and in neurons that the hexameric ATPase valosin-containing protein (VCP) is recruited to ubiquitylated Tau fibrils, resulting in their efficient disaggregation. Aggregate clearance depends on the functional cooperation of VCP with heat shock 70 kDa protein (Hsp70) and the ubiquitin-proteasome machinery. While inhibition of VCP activity stabilizes large Tau aggregates, disaggregation by VCP generates seeding-active Tau species as byproduct. These findings identify VCP as a core component of the machinery for the removal of neurodegenerative disease aggregates and suggest that its activity can be associated with enhanced aggregate spreading in tauopathies.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Single-step rapid chromatographic purification and characterization of clinical stage oncolytic VSV-GP.

Purification of viruses, especially for therapeutic purposes, is a tedious and challenging task. The challenges arise due to the size and surface complexity of the virus particles. VSV-GP is a promising oncolytic virus, which has been approved for phase I clinical trials by the Food and Drug Administration (FDA) of United States and Paul Ehrlich Institute (PEI) of Germany. The virus particles of VSV-GP are larger in size than vectors commonly used for gene therapy (e.g., adenovirus, adeno-associated virus, etc.). The current established proprietary clinical-grade manufacturing process for the purification of VSV-GP encompasses several chromatographic and non-chromatographic steps. In this study, we describe a new single-step purification process for the purification of VSV-GP virus, using cation exchange convective flow column with relatively higher yields. The purified virus was characterized for its quality attributes using TCID50 assay (for viral infectivity), host cell protein contaminant ELISA, SDS-PAGE, size exclusion chromatography (SEC), and cryo-electron microscopy. Furthermore, the purified viral therapeutic material was tested in vivo for its efficacy and safety. All these characterization methods demonstrated a therapeutic virus preparation of high purity and yield, which can be readily used for various studies.

Differential Transcriptional Responses in Two Old World Bemisia tabaci Cryptic Species Post Acquisition of Old and New World Begomoviruses.

Begomoviruses are transmitted by several cryptic species of the sweetpotato whitefly, Bemisia tabaci (Gennadius), in a persistent and circulative manner. Upon virus acquisition and circulative translocation within the whitefly, a multitude of molecular interactions occur. This study investigated the differentially expressed transcript profiles associated with the acquisition of the Old World monopartite begomovirus, tomato yellow leaf curl virus (TYLCV), and two New World bipartite begomoviruses, sida golden mosaic virus (SiGMV) and cucurbit leaf crumple virus (CuLCrV), in two invasive B. tabaci cryptic species, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED). A total of 881 and 559 genes were differentially expressed in viruliferous MEAM1 and MED whiteflies, respectively, compared with their non-viruliferous counterparts, of which 146 genes were common between the two cryptic species. For both cryptic species, the number of differentially expressed genes (DEGs) associated with TYLCV and SiGMV acquisition were higher compared with DEGs associated with CuLCrV acquisition. Pathway analysis indicated that the acquisition of begomoviruses induced differential changes in pathways associated with metabolism and organismal systems. Contrasting expression patterns of major genes associated with virus infection and immune systems were observed. These genes were generally overexpressed and underexpressed in B. tabaci MEAM1 and MED adults, respectively. Further, no specific expression pattern was observed among genes associated with fitness (egg production, spermatogenesis, and aging) in viruliferous whiteflies. The weighted gene correlation network analysis of viruliferous B. tabaci MEAM1 and MED adults identified different hub genes potentially implicated in the vector competence and circulative tropism of viruses. Taken together, the results indicate that both vector cryptic species and the acquired virus species could differentially affect gene expression.

Differential Transmission of Old and New World Begomoviruses by Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) Cryptic Species of Bemisia tabaci.

Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) are two of the most invasive members of the sweetpotato whitefly, Bemisia tabaci, cryptic species complexes and are efficient vectors of begomoviruses. Bemisia tabaci MEAM1 is the predominant vector of begomoviruses in open-field vegetable crops in the southeastern United States. However, recently B. tabaci MED also has been detected in the landscape outside of greenhouses in Florida and Georgia. This study compared the transmission efficiency of one Old-World (OW) and two New-World (NW) begomoviruses prevalent in the southeastern United States, viz., tomato yellow leaf curl virus (TYLCV), cucurbit leaf crumple virus (CuLCrV), and sida golden mosaic virus (SiGMV) between B. tabaci MEAM1 and B. tabaci MED. Bemisia tabaci MEAM1 efficiently transmitted TYLCV, CuLCrV, or SiGMV, whereas B. tabaci MED only transmitted TYLCV. Percent acquisition and retention of OW TYLCV following a 72 h acquisition access period was significantly higher for B. tabaci MED than B. tabaci MEAM1. In contrast, B. tabaci MEAM1 acquired and retained significantly more NW bipartite begomoviruses, CuLCrV or SiGMV, than B. tabaci MED. Quantitative analysis (qPCR) of virus DNA in whitefly internal tissues revealed reduced accumulation of CuLCrV or SiGMV in B. tabaci MED than in B. tabaci MEAM1. Fluorescent in situ hybridization (FISH) showed localization of CuLCrV or SiGMV in the midgut of B. tabaci MED and B. tabaci MEAM1. However, localization of CuLCrV or SiGMV was only observed in the primary salivary glands of B. tabaci MEAM1 and not B. tabaci MED. TYLCV localization was observed in all internal tissues of B. tabaci MEAM1 and B. tabaci MED. Overall, results demonstrate that both B. tabaci MEAM1 and B. tabaci MED are efficient vectors of OW TYLCV. However, for the NW begomoviruses, CuLCrV and SiGMV, B. tabaci MEAM1 seems to a better vector.

Whitefly-Mediated Transmission and Subsequent Acquisition of Highly Similar and Naturally Occurring Tomato Yellow Leaf Curl Virus Variants.

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids, resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (variant #2 and variant #4) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants' concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than that of variant #2 in tomato plants. Despite differences in variants' accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

The Hsc70 disaggregation machinery removes monomer units directly from α-synuclein fibril ends.

Molecular chaperones contribute to the maintenance of cellular protein homoeostasis through assisting de novo protein folding and preventing amyloid formation. Chaperones of the Hsp70 family can further disaggregate otherwise irreversible aggregate species such as α-synuclein fibrils, which accumulate in Parkinson's disease. However, the mechanisms and kinetics of this key functionality are only partially understood. Here, we combine microfluidic measurements with chemical kinetics to study α-synuclein disaggregation. We show that Hsc70 together with its co-chaperones DnaJB1 and Apg2 can completely reverse α-synuclein aggregation back to its soluble monomeric state. This reaction proceeds through first-order kinetics where monomer units are removed directly from the fibril ends with little contribution from intermediate fibril fragmentation steps. These findings extend our mechanistic understanding of the role of chaperones in the suppression of amyloid proliferation and in aggregate clearance, and inform on possibilities and limitations of this strategy in the development of therapeutics against synucleinopathies.

Field Screen and Genotyping of Phaseolus vulgaris against Two Begomoviruses in Georgia, USA.

The production and quality of Phaseolus vulgaris (snap bean) have been negatively impacted by leaf crumple disease caused by two whitefly-transmitted begomoviruses: cucurbit leaf crumple virus (CuLCrV) and sida golden mosaic Florida virus (SiGMFV), which often appear as a mixed infection in Georgia. Host resistance is the most economical management strategy against whitefly-transmitted viruses. Currently, information is not available with respect to resistance to these two viruses in commercial cultivars. In two field seasons (2018 and 2019), we screened Phaseolus spp. genotypes (n = 84 in 2018; n = 80 in 2019; most of the genotypes were common in both years with a few exceptions) for resistance against CuLCrV and/or SiGMFV. We also included two commonly grown Lima bean (Phaseolus lunatus) varieties in our field screening. Twenty Phaseolus spp. genotypes with high to moderate-levels of resistance (disease severity ranging from 5%-50%) to CuLCrV and/or SiGMFV were identified. Twenty-one Phaseolus spp. genotypes were found to be highly susceptible with a disease severity of ≥66%. Furthermore, based on the greenhouse evaluation with two genotypes-each (two susceptible and two resistant; identified in field screen) exposed to viruliferous whiteflies infected with CuLCrV and SiGMFV, we observed that the susceptible genotypes accumulated higher copy numbers of both viruses and displayed severe crumple severity compared to the resistant genotypes, indicating that resistance might potentially be against the virus complex rather than against the whiteflies. Adult whitefly counts differed significantly among Phaseolus genotypes in both years. The whole genome of these Phaseolus spp. [snap bean (n = 82); Lima bean (n = 2)] genotypes was sequenced and genetic variability among them was identified. Over 900 giga-base (Gb) of filtered data were generated and >88% of the resulting data were mapped to the reference genome, and SNP and Indel variants in Phaseolus spp. genotypes were obtained. A total of 645,729 SNPs and 68,713 Indels, including 30,169 insertions and 38,543 deletions, were identified, which were distributed in 11 chromosomes with chromosome 02 harboring the maximum number of variants. This phenotypic and genotypic information will be helpful in genome-wide association studies that will aid in identifying the genetic basis of resistance to these begomoviruses in Phaseolus spp.

Tomato Yellow Leaf Curl Virus-Resistant and -Susceptible Tomato Genotypes Similarly Impact the Virus Population Genetics.

Tomato yellow leaf curl virus is a species in the genus Begomovirus and family Geminiviridae. Tomato yellow leaf curl virus (TYLCV) infection induces severe symptoms on tomato plants and causes serious yield losses worldwide. TYLCV is persistently transmitted by the sweetpotato whitefly, Bemisia tabaci (Gennadius). Cultivars and hybrids with a single or few genes conferring resistance against TYLCV are often planted to mitigate TYLCV-induced losses. These resistant genotypes (cultivars or hybrids) are not immune to TYLCV. They typically develop systemic infection, display mild symptoms, and produce more marketable tomatoes than susceptible genotypes under TYLCV pressure. In several pathosystems, extensive use of resistant cultivars with single dominant resistance-conferring gene has led to intense selection pressure on the virus, development of highly virulent strains, and resistance breakdown. This study assessed differences in TYLCV genomes isolated from susceptible and resistant genotypes in Florida and Georgia. Phylogenetic analyses indicated that Florida and Georgia isolates were distinct from each other. Population genetics analyses with genomes field-collected from resistant and susceptible genotypes from Florida and/or Georgia provided no evidence of a genetic structure between the resistant and susceptible genotypes. No codons in TYLCV genomes from TYLCV-resistant or susceptible genotypes were under positive selection, suggesting that highly virulent or resistance-breaking TYLCV strains might not be common in tomato farmscapes in Florida and Georgia. With TYLCV-resistant genotypes usage increasing recently and multiple tomato crops being planted during a calendar year, host resistance-induced selection pressure on the virus remains a critical issue. To address the same, a greenhouse selection experiment with one TYLCV-resistant and susceptible genotype was conducted. Each genotype was challenged with TYLCV through whitefly-mediated transmission serially 10 times (T1-T10). Population genetics parameters at the genome level were assessed at T1, T5, and T10. Results indicated that genomes from resistant and susceptible genotypes did not differentiate with increasing transmission number, no specific mutations were repeatedly observed, and no positive selection was detected. These results reiterate that resistance in tomato might not be exerting selection pressure against TYLCV to facilitate development of resistance-breaking strains. TYLCV populations rather seem to be shaped by purifying selection and/or population expansion.

Low Genetic Variability in Bemisia tabaci MEAM1 Populations within Farmscapes of Georgia, USA.

Bemisia tabaci is a whitefly species complex comprising important phloem feeding insect pests and plant virus vectors of many agricultural crops. Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) are the two most invasive members of the B. tabaci species complex worldwide. The diversity of agroecosystems invaded by B. tabaci could potentially influence their population structure, but this has not been assessed at a farmscape level. A farmscape in this study is defined as heterogenous habitat with crop and non-crop areas spanning ~8 square kilometers. In this study, mitochondrial COI gene (mtCOI) sequences and six microsatellite markers were used to examine the population structure of B. tabaci MEAM1 colonizing different plant species at a farmscape level in Georgia, United States. Thirty-five populations of adult whiteflies on row and vegetable crops and weeds across major agricultural regions of Georgia were collected from fifteen farmscapes. Based on morphological features and mtCOI sequences, five species/cryptic species of whiteflies (B. tabaci MEAM1, B. tabaci MED, Dialeurodes citri, Trialeurodes abutiloneus, T. vaporariorum) were found. Analysis of 102 mtCOI sequences revealed the presence of a single B. tabaci MEAM1 haplotype across farmscapes in Georgia. Population genetics analyses (AMOVA, PCA and STRUCTURE) of B. tabaci MEAM1 (microsatellite data) revealed only minimal genetic differences among collected populations within and among farmscapes. Overall, our results suggest that there is a high level of gene flow among B. tabaci MEAM1 populations among farmscapes in Georgia. Frequent whitefly population explosions driven by a single or a few major whitefly-suitable hosts planted on a wide spatial scale may be the key factor behind the persistence of a single panmictic population over Georgia's farmscapes. These population structuring effects are useful for delineating the spatial scale at which whiteflies must be managed and predicting the speed at which alleles associated with insecticide resistance might spread.

Specific and Spillover Effects on Vectors Following Infection of Two RNA Viruses in Pepper Plants.

Mixed infection of plant viruses is ubiquitous in nature and can affect virus-plant-vector interactions differently than single virus infection. While several studies have examined virus-virus interactions involving mixed virus infection, relatively few have examined effects of mixed virus infection on vector preference and fitness, especially when multiple vectors are involved. This study explored how single and mixed viral infection of a non-persistently transmitted cucumber mosaic virus (CMV) and propagative and persistently-transmitted tomato spotted wilt orthotospovirus (TSWV) in pepper, Capsicum annum L., influenced the preference and fitness of their vectors, the green peach aphid, Myzus persicae (Sulzer), and the tobacco thrips, Frankliniella fusca (Hinds), respectively. In general, mixed infected plants exhibited severe symptoms compared with individually infected plants. An antagonistic interaction between the two viruses was observed when CMV titer was reduced following mixed infection with TSWV in comparison with the single infection. TSWV titer did not differ between single and mixed infection. Myzus persicae settling preference and median developmental were not significantly different between CMV and/or TSWV-infected and non-infected plants. Moreover, M. persicae fecundity did not differ between CMV-infected and non-infected pepper plants. However, M. persicae fecundity was substantially greater on TSWV-infected plants than non-infected plants. Myzus persicae fecundity on mixed-infected plants was significantly lower than on singly-infected and non-infected plants. Frankliniella fusca fecundity was higher on CMV and/or TSWV-infected pepper plants than non-infected pepper plants. Furthermore, F. fusca-induced feeding damage was higher on TSWV-infected than on CMV-infected, mixed-infected, or non-infected pepper plants. Overall, our results indicate that the effects of mixed virus infection on vectors were not different from those observed following single virus infection. Virus-induced host phenotype-modulated effects were realized on both specific and non-specific vectors, suggesting crosstalk involving all vectors and viruses in this pathosystem. The driving forces of these interactions need to be further examined. The effects of interactions between two viruses and two vectors towards epidemics of one or both viruses also need to be examined.

Aphid Transmission of Potyvirus: The Largest Plant-Infecting RNA Virus Genus.

Potyviruses are the largest group of plant infecting RNA viruses that cause significant losses in a wide range of crops across the globe. The majority of viruses in the genus Potyvirus are transmitted by aphids in a non-persistent, non-circulative manner and have been extensively studied vis-à-vis their structure, taxonomy, evolution, diagnosis, transmission, and molecular interactions with hosts. This comprehensive review exclusively discusses potyviruses and their transmission by aphid vectors, specifically in the light of several virus, aphid and plant factors, and how their interplay influences potyviral binding in aphids, aphid behavior and fitness, host plant biochemistry, virus epidemics, and transmission bottlenecks. We present the heatmap of the global distribution of potyvirus species, variation in the potyviral coat protein gene, and top aphid vectors of potyviruses. Lastly, we examine how the fundamental understanding of these multi-partite interactions through multi-omics approaches is already contributing to, and can have future implications for, devising effective and sustainable management strategies against aphid-transmitted potyviruses to global agriculture.

Virus-virus interactions in a plant host and in a hemipteran vector: Implications for vector fitness and virus epidemics.

Mixed virus infection in host plants can differentially alter the plant phenotype, influence vector fitness, and affect virus acquisition and inoculation by vectors than single-virus infection. Vector acquisition of multiple viruses from multiple host plants could also differentially affect vector fitness and virus inoculation than acquisition of one virus. Whitefly-virus pathosystems in the southern United States include both the above-stated facets. For the first facet, this study examined the effects of single and mixed infection of cucurbit leaf crumple virus (CuLCrV, a begomovirus) and cucurbit yellow stunting disorder virus (CYSDV, a crinivirus) infecting squash on whitefly (Bemisia tabaci Gennadius MEAM1) host preference and fitness. Mixed infection of CuLCrV and CYSDV in squash plants severely altered their phenotype than single infection. The CYSDV load was reduced in mixed-infected squash plants than in singly-infected plants. Consequently, whiteflies acquired reduced amounts of CYSDV from mixed-infected plants than singly-infected plants. No differences in CuLCrV load were found between singly- and mixed-infected squash plants, and acquisition of CuLCrV by whiteflies did not vary between singly- and mixed-infected squash plants. Both singly- and mixed-infected plants similarly affected whitefly preference, wherein non-viruliferous and viruliferous (CuLCrV and/or CYSDV) whiteflies preferred non-infected plants over infected plants. The fitness study involving viruliferous and non-viruliferous whiteflies revealed no differences in developmental time and fecundity. For the second facet, this study evaluated the effects of individual or combined acquisition of tomato-infecting tomato yellow leaf curl virus (TYLCV, a begomovirus) and squash-infecting CuLCrV on whitefly host preference and fitness. Whiteflies that acquired both CuLCrV and TYLCV had significantly lower CuLCrV load than whiteflies that acquired CuLCrV alone, whereas TYLCV load remained unaltered when acquired individually or in conjunction with CuLCrV. Whitefly preference was not affected following individual or combined virus acquisition. Viruliferous (CuLCrV and/or TYLCV) whiteflies preferred to settle on non-infected tomato and squash plants. The mere presence of CuLCrV and/or TYLCV in whiteflies did not affect their fitness. Taken together, these results indicate that mixed infection of viruses in host plants and acquisition of multiple viruses by the vector could have implications for virus accumulation, virus acquisition, vector preference, and epidemics that sometimes are different from single-virus infection or acquisition.

Low Frequency of Horizontal and Vertical Transmission of Cucurbit Leaf Crumple Virus in Whitefly Bemisia tabaci Gennadius.

Cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus, is transmitted by whiteflies in a persistent and circulative manner. Like other begomoviruses, CuLCrV transmission via feeding is well understood; however, whether and how CuLCrV is transmitted by horizontal and vertical modes in its vector, Bemisia tabaci, remains unexplored. We studied transovarial and mating transmission of CuLCrV, and comparatively analyzed virus accumulation in whiteflies through feeding and nonfeeding modes. Furthermore, we quantified CuLCrV DNA A accumulation at different time points to determine whether this virus propagates in whiteflies. CuLCrV DNA A was transmitted vertically and horizontally by B. tabaci, with low frequency in each case. Transovarial transmission of CuLCrV DNA A was only 3.93% in nymphs and 3.09% in adults. Similarly, only a single viruliferous male was able to transmit CuLCrV DNA A to its nonviruliferous female counterparts via mating. In contrast, viruliferous females were unable to transmit CuLCrV DNA A to nonviruliferous males. Additionally, the recipient adults that presumably acquired CuLCrV transovarially and via mating were not able to transmit the virus to squash plants. We further report that the CuLCrV DNA A viral copy numbers were significantly lower in nonfeeding modes of transmission than in feeding ones. The viral copy numbers significantly decreased at succeeding time points throughout adulthood, suggesting no CuLCrV propagation in B. tabaci. Altogether, the low frequency of nonfeeding transmission, reduced virus accumulation in whiteflies, and absence of plant infectivity through nonfeeding transmission suggest that transovarial and mating CuLCrV transmission might not substantially contribute to CuLCrV epidemics.