Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 85
Filtrar
2.
Arch Virol ; 165(1): 253-256, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31758274

RESUMO

In Brazil, non-cultivated plants, especially weeds, are infected with a diversity of begomoviruses and often show striking golden mosaic symptoms. In the present study, leaves showing these symptoms were collected from Sida sp. plants in Guadalupe, Piaui State, Northeastern Brazil, in 2015 and 2016. PCR tests with degenerate primers revealed the presence of begomovirus DNA-A and DNA-B components. Restriction enzyme digestion of rolling circle-amplified DNA revealed fragments totaling ~5.2 kb, indicating infection by a bipartite begomovirus. The DNA-A and DNA-B components have a genome organization typical of New World (NW) bipartite begomoviruses and a common region of 220 nucleotides (nt) with 96% identity, indicating these are cognate components. Comparisons performed with the DNA-A sequence revealed the highest nt sequence identity (84%) with that of sida angular mosaic virus (SiAMV), whereas those performed with the DNA-B sequence revealed highest identity (77%) with that of sida chlorotic vein virus (SiCVV). In phylogenetic analyses, the DNA-A sequence was placed in a strongly supported clade with SiAMV and SiCVV from Piaui, whereas the DNA-B sequence was placed in a clade with SiCVV and corchorus mottle virus. Based on the current ICTV criteria for the demarcation of begomovirus species (<91% nt sequence identity for the DNA-A component), this is a member of a new species for which the name "Sida yellow golden mosaic virus" is proposed.


Assuntos
Begomovirus/genética , Sida (Planta)/virologia , Sequenciamento Completo do Genoma/métodos , Begomovirus/classificação , Brasil , Genoma Viral , Guadalupe , Filogenia
3.
Arch Virol ; 163(3): 737-743, 2018 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-29224131

RESUMO

A new begomovirus species was identified from tomato plants with upward leaf curling and purple vein symptoms, which was first identified in the Piaui state of Northeast (NE) Brazil in 2014. Tomato leaf samples were collected in 2014 and 2016, and PCR with degenerate primers revealed begomovirus infection. Rolling circle amplification and restriction enzyme digestion indicated a single genomic DNA of ~ 2.6 kb. Cloning and sequencing revealed a genome organization similar to DNA-A components of New World (NW) bipartite begomoviruses, with no DNA-B. The complete nucleotide sequence had the highest identity (80%) with the DNA-A of Macroptilium yellow spot virus (MacYSV), and phylogenetic analyses showed it is a NW begomovirus that clusters with MacYSV and Blainvillea yellow spot virus, also from NE Brazil. Tomato plants agroinoculated with a dimeric clone of this genomic DNA developed upward leaf curling and purple vein symptoms, indistinguishable from those observed in the field. Based on agroinoculation, this virus has a narrow host range, mainly within the family Solanaceae. Co-inoculation experiments with tomato severe rugose virus and tomato mottle leaf curl virus, the two predominant begomoviruses infecting tomato in Brazil, revealed a synergistic interaction among these begomoviruses. The name Tomato leaf curl purple vein virus (ToLCPVV) is proposed for this new begomovirus.


Assuntos
Begomovirus/genética , DNA Viral/genética , Genoma Viral , Filogenia , Folhas de Planta/virologia , Solanum lycopersicum/virologia , Begomovirus/classificação , Begomovirus/isolamento & purificação , Brasil , Sequenciamento de Nucleotídeos em Larga Escala , Especificidade de Hospedeiro , Doenças das Plantas/virologia , Análise de Sequência de DNA
4.
Oncogene ; 36(37): 5231-5242, 2017 09 14.
Artigo em Inglês | MEDLINE | ID: mdl-28504719

RESUMO

Group3 medulloblastoma (MBG3) that predominantly occur in young children are usually associated with MYC amplification and/or overexpression, frequent metastasis and a dismal prognosis. Physiologically relevant MBG3 models are currently lacking, making inferences related to their cellular origin thus far limited. Using in utero electroporation, we here report that MBG3 mouse models can be developed in situ from different multipotent embryonic cerebellar progenitor cells via conditional expression of Myc and loss of Trp53 function in several Cre driver mouse lines. The Blbp-Cre driver that targets embryonic neural progenitors induced tumors exhibiting a large-cell/anaplastic histopathology adjacent to the fourth ventricle, recapitulating human MBG3. Enforced co-expression of luciferase together with Myc and a dominant-negative form of Trp53 revealed that GABAergic neuronal progenitors as well as cerebellar granule cells give rise to MBG3 with their distinct growth kinetics. Cross-species gene expression analysis revealed that these novel MBG3 models shared molecular characteristics with human MBG3, irrespective of their cellular origin. We here developed MBG3 mouse models in their physiological environment and we show that oncogenic insults drive this MB subgroup in different cerebellar lineages rather than in a specific cell of origin.


Assuntos
Neoplasias Cerebelares/genética , Cerebelo/embriologia , Cerebelo/patologia , Meduloblastoma/genética , Proteínas Proto-Oncogênicas c-myc/genética , Animais , Neoplasias Cerebelares/metabolismo , Neoplasias Cerebelares/patologia , Cerebelo/citologia , Cerebelo/metabolismo , Modelos Animais de Doenças , Feminino , Humanos , Masculino , Meduloblastoma/metabolismo , Meduloblastoma/patologia , Camundongos , Camundongos Transgênicos , Proteínas Proto-Oncogênicas c-myc/metabolismo , Transfecção
5.
CPT Pharmacometrics Syst Pharmacol ; 5(4): 211-221, 2016 04.
Artigo em Inglês | MEDLINE | ID: mdl-27104090

RESUMO

We previously investigated novel therapies for pediatric ependymoma and found 5-fluorouracil (5-FU) i.v. bolus increased survival in a representative mouse model. However, without a quantitative framework to derive clinical dosing recommendations, we devised a translational pharmacokinetic-pharmacodynamic (PK-PD) modeling and simulation approach. Results from our preclinical PK-PD model suggested tumor concentrations exceeded the 1-hour target exposure (in vitro IC90), leading to tumor growth delay and increased survival. Using an adult population PK model, we scaled our preclinical PK-PD model to children. To select a 5-FU dosage for our clinical trial in children with ependymoma, we simulated various 5-FU dosages for tumor exposures and tumor growth inhibition, as well as considering tolerability to bolus 5-FU administration. We developed a pediatric population PK model of bolus 5-FU and simulated tumor exposures for our patients. Simulations for tumor concentrations indicated that all patients would be above the 1-hour target exposure for antitumor effect.


Assuntos
Ependimoma/tratamento farmacológico , Fluoruracila/administração & dosagem , Animais , Antimetabólitos Antineoplásicos/administração & dosagem , Antimetabólitos Antineoplásicos/sangue , Antimetabólitos Antineoplásicos/farmacocinética , Proteínas Sanguíneas/metabolismo , Criança , Pré-Escolar , Simulação por Computador , Cálculos da Dosagem de Medicamento , Ependimoma/sangue , Ependimoma/metabolismo , Fluoruracila/sangue , Fluoruracila/farmacocinética , Humanos , Camundongos , Modelos Biológicos , Dinâmica não Linear , Ligação Proteica , Distribuição Aleatória
6.
Oncogene ; 34(13): 1736-42, 2015 Mar 26.
Artigo em Inglês | MEDLINE | ID: mdl-24747973

RESUMO

High-throughput screens (HTS) of compound toxicity against cancer cells can identify thousands of potential new drug-leads. But only limited numbers of these compounds can progress to expensive and labor-intensive efficacy studies in mice, creating a 'bottle neck' in the drug development pipeline. Approaches that triage drug-leads for further study are greatly needed. Here we provide an intermediary platform between HTS and mice by adapting mouse models of pediatric brain tumors to grow as orthotopic xenografts in the brains of zebrafish. Freshly isolated mouse ependymoma, glioma and choroid plexus carcinoma cells expressing red fluorescence protein were conditioned to grow at 34 °C. Conditioned tumor cells were then transplanted orthotopically into the brains of zebrafish acclimatized to ambient temperatures of 34 °C. Live in vivo fluorescence imaging identified robust, quantifiable and reproducible brain tumor growth as well as spinal metastasis in zebrafish. All tumor xenografts in zebrafish retained the histological characteristics of the corresponding parent mouse tumor and efficiently recruited fish endothelial cells to form a tumor vasculature. Finally, by treating zebrafish harboring ERBB2-driven gliomas with an appropriate cytotoxic chemotherapy (5-fluorouracil) or tyrosine kinase inhibitor (erlotinib), we show that these models can effectively assess drug efficacy. Our data demonstrate, for the first time, that mouse brain tumors can grow orthotopically in fish and serve as a platform to study drug efficacy. As large cohorts of brain tumor-bearing zebrafish can be generated rapidly and inexpensively, these models may serve as a powerful tool to triage drug-leads from HTS for formal efficacy testing in mice.


Assuntos
Neoplasias Encefálicas/patologia , Modelos Animais de Doenças , Glioma/patologia , Animais , Criança , Descoberta de Drogas , Ensaios de Triagem em Larga Escala , Humanos , Camundongos , Transplante de Neoplasias , Transcriptoma , Transplante Heterólogo , Peixe-Zebra
7.
Plant Dis ; 98(11): 1592, 2014 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-30699825

RESUMO

In the early 1990s, the monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) was introduced into the Dominican Republic (DO), and molecular characterization revealed it was an isolate of TYLCV-Israel (TYLCV-IL[DO]) (3,5). In 2006, a study of the variability of TYLCV in DO revealed that TYLCV-IL[DO] was associated with all samples of tomato yellow leaf curl (TYLC) tested and, thus, that the virus had been genetically stable for >15 years (2). However, in 2010 and 2011, 2 of 10 and 11 of 18 samples of TYLC, respectively, were negative for TYLCV infection based upon PCR with the TYLCV-specific primer pair, 2560v (5'-GAGAACAATTGGGATATG-3')/1480c (5'-AATCATGGATTCACGCAC-3'), which directs the amplification of a ~1.7 kb fragment. In 2011, two such samples from the Azua Valley were tested by PCR with the 1470v (5'-AGTGATGAGTTCCCCTGTGC-3')/UPC2 primer pair (1), and sequence analysis of the ~0.4 kb fragment amplified from both samples revealed infection with the mild strain of TYLCV (TYLCV-Mld). A primer specific for TYLCV-Mld was designed (2070v, 5'-AAACGGAGAAATATATAAGGAGCC-3'), and PCR with the 2070v/1480c primer pair directed the amplification of the expected ~2.1 kb fragment from all 11 TYLC samples collected in 2011 that were PCR-negative for TYLCV-IL[DO] infection. Sequence analyses confirmed these were TYLCV-Mld fragments. The complete TYLCV-Mld genome was amplified from two samples from the Azua Valley with Templiphi, the amplified DNA products digested with Sal I, and the resulting ~2.8 kb fragments ligated into Sal I-digested pGEM-11. The complete sequences of these isolates were 2,791 nt and 99% identical to each other and 98% identical to sequences of TYLCV-Mld isolates. The TYLCV-Mld isolates from the DO were designated TYLCV-Mld:DO:TY5:01:2011 (KJ913682) and TYLCV-Mld:DO:TY5:02:2011 (KJ913683). A multimeric clone of TYLCV-Mld:DO:TY5:01:2011 was generated in the binary vector pCAMBIA1300 by cloning a 2.2 kb Sal I-EcoRI fragment containing the intergenic region to generate a 0.8-mer (pCTYMld0.8), and then the full-length Sal I fragment was cloned into the Sal I site of pCTYMld0.8 to generate a 1.8-mer (pCTYMldDO-01-1.8). Tomato plants agroinoculated with Agrobacterium tumefaciens carrying pCTYMldDO-01-1.8 developed severe TYLC disease symptoms 10 to 14 days after inoculation, whereas plants inoculated with a strain carrying the empty vector did not develop symptoms. Samples of processing tomatoes with TYLC were collected in 2012 to 2014 in the DO and tested for TYLCV-IL[DO] and TYLCV-Mld by PCR with the 2560v/1480c and 2070v/1480c primers pairs, respectively; these samples had infections of 93% (13/14), 86% (18/21), and 61% (11/18) with TYLCV-Mld; 29% (4/14), 19% (4/21), and 56% (10/18) with TYLCV-IL[DO]; and 21% (3/14), 5% (1/21), and 28% (5/18) with both viruses, respectively. These results reveal that there has been a striking population shift in the begomovirus causing TYLC in the DO, with TYLCV-Mld becoming predominant. This may reflect selection pressure(s) favoring a small pre-existing population of TYLCV-Mld, such as new tomato varieties, or a recent introduction event, such as that described in Venezuela (4). References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1994. (2) R. L. Gilbertson et al. Page 279 in: Tomato yellow leaf curl virus disease. Springer, 2007. (3) M. K. Nahkla et al. Plant Dis. 78:926, 1994. (4) G. Romay et al. Australasian Plant Dis. Notes, in press, 2014. (5) R. Salati et al. Phytopathology 92:487, 2002.

8.
Plant Dis ; 98(6): 840, 2014 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30708646

RESUMO

Tomato and pepper plants exhibiting wilt symptoms were collected from fields in seven villages in Northern (Vea, Tono, Pwalugu), Ashanti (Agogo, Akumadan), and Brong Ahafo (Tanoso, Tuobodom) regions of western Ghana in November 2012. The plants were wilted without leaf yellowing or necrosis. Disease incidence was generally low, with less than 20% symptomatic plants observed. Most of the plants collected produced visible bacterial ooze in water in the field. Ooze was plated on 2,3,5-triphenyltetrazolium chloride-amended (TZC) medium. Isolated colonies were fluidal, irregularly round, white with pink centers, gram-negative, and oxidase positive. One strain from each of seven fields was selected for further study. All strains induced a hypersensitive reaction on tobacco. Randomly selected strains SM855-12 and SM857-12 tested positive in R. solanacearum ImmunoStrip assays (Agdia Inc., IN). An end-point PCR assay with primer set 759/760 (3) generated an R. solanacearum-specific 280-bp amplicon for all seven strains. Two of these strains were biovar I and the remaining five were biovar III based on utilization of cellobiose, lactose, maltose, dulcitol, mannitol, and sorbitol. A phylotype-specific multiplex PCR assay that recognizes four geographically linked monophyletic groups within R. solanacearum (1) indicated that one strain (SM855-12) was phylotype III (African origin), whereas the other six were phylotype I (Asian origin). All strains were subjected to repetitive sequence-based PCR (Rep-PCR) with BOXA1R and REP1R/REP2 primers (4). Strain SM855-12 was grouped with the phylotype III reference strain UW 368 and the remaining six strains were grouped with the phylotype I reference strain GMI 1000. A pathogenicity test was performed with bacterial wilt-susceptible tomato line OH7814. Inoculum was prepared from 48-h cultures of strains SM855-12, SM856-12, and SM858-12 grown on casamino acid peptone glucose (CPG) medium at 30°C. Roots of ten 4-week-old tomato plants per strain were drench-inoculated with 5 ml of a 108 CFU/ml bacterial suspension after wounding with a sterile scalpel. Non-inoculated control plants were drenched with 5 ml distilled water after root wounding. Plants were kept in a greenhouse at 25 to 30°C. By 12 days after inoculation, 80 to 100% of inoculated plants were wilted, whereas no symptoms appeared in non-inoculated plants. Bacteria re-isolated from wilted plants were confirmed to be R. solanacearum using techniques mentioned above. Although an association of bacterial wilt with tomato/pepper was mentioned previously (2), to our knowledge, this is the first documented report of bacterial wilt caused by R. solanacearum in Ghana. The presence of Asian strains (phylotype I) may be the result of one or more accidental introductions. Awareness of this disease in Ghana will lead to deployment of management strategies including use of resistant varieties and grafting desirable varieties onto disease-resistant rootstocks. References: (1) M. Fegan and P. Prior. Page 449 in Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. C. Allen et al., eds. American Phytopathological Society, St. Paul, MN, 2005. (2) K. A. Oduro. Plant Protection and Regulatory Services Directorate of MOFA, Accra, Ghana, 2000. (3) N. Opina et al. Asia Pac. J. Mol. Biol. Biotechnol. 5:19, 1977. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

9.
Plant Dis ; 98(2): 286, 2014 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30708748

RESUMO

In August 2012, symptoms of stunted growth and leaf epinasty, crumpling, and yellowing, were observed in basil plants (Ocimum basilicum) grown in a shadehouse in Calipatria in the Imperial Valley of California. Populations of the beet leafhopper (Circulifer tenellus) carrying curtoviruses (genus Curtovirus, family Geminiviridae) were detected in the Imperial Valley in May 2012. Together, this suggested a curtovirus etiology for this virus-like disease of basil. Total DNA extracts were prepared from leaves of nine representative symptomatic plants (BA1 through 9) and used in the PCR with the general curtovirus primer pair, BGv377 and BGc1509 (1,2). This primer pair directed the amplification of the expected ~1.1 kb DNA fragments from extracts prepared from all nine plants, and not from equivalent extracts from symptomless plants. The sequences of 1.1 kb fragments amplified from four plants (BA1 through 4) were determined, and BLAST analyses revealed 99% nucleotide sequence identities among these sequences, and 98% identities with the homologous region (V2/CP) of Beet severe curly top virus-Cfh (BSCTV-Cfh; GenBank Accession No. U02311). A second primer pair (BGv981 5'-AACGGTCAGGCTATGCCGTCTAC-3' and BGc479 5'-GAAAGACCTCGCCTTCTTCTAGGG-3') was designed to amplify the remainder of the viral genome. The expected size ~2.4 kb fragments were amplified from the extracts of the BA1 through 9 plants, and the fragments from the BA1 and 2 plants were cloned into the pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. Using the sequences of the overlapping PCR-amplified fragments, the complete viral genome sequences of the BA1 and BA2 isolates were determined. The BA1 and BA2 sequences were 2,934 bp and were 99% identical to each other and to the sequence of BSCTV-Cfh (3). To confirm the infectivity of BSCTV in basil, the BSCTV-Cfh infectious clone, which originated from California, was used for agroinoculation and leafhopper transmission experiments in basil plants (cvs. Sweet aroma and Genovese). Basil plants agroinoculated with the BSCTV-Cfh clone developed stunted growth and leaf crumpling and curling symptoms, similar to symptoms observed in the symptomatic plants from the Imperial Valley. The presence of viral DNA in symptomatic plants was confirmed by PCR with the BGv377/BGc1509 primer pair. Basil plants inoculated with an empty vector control did not develop symptoms, nor was curtovirus DNA amplified from these plants by PCR. Beet leafhoppers were given a 48-h acquisition access period on BSCTV-Cfh-infected sugarbeet plants, followed by a 48-h inoculation access period on healthy basil plants. These plants developed curly top symptoms approximately 21 days after inoculation, indicating that BSCTV was transmitted to basil by the beet leafhopper. Together, these results establish that the cause of the disease symptoms in basil in the Imperial Valley of California was BSCTV. This is the first report of curly top disease in basil, which is the second member of the mint family (Lamiaceae) known to be infected by a curtovirus. The stunted growth induced in basil by BSCTV has the potential to cause yield and economic loss, particularly in open field or screenhouse production when beet leafhopper populations are high. References: (1) L-F. Chen et al. Plant Dis. 94:99, 2010. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (3) D. C. Stenger. Mol. Plant-Micro. Interact. 7:154, 1994.

10.
Plant Dis ; 98(2): 286, 2014 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30708759

RESUMO

Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5'ATGTCTAAGGTCAAGCTCACC3' and NR5'TTATGCAACACCTGAAATTTTGGC3'), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.

11.
Plant Dis ; 97(5): 692, 2013 May.
Artigo em Inglês | MEDLINE | ID: mdl-30722209

RESUMO

During surveys of tomato (Solanum lycopersicum) fields in Niono, Mali, conducted in March 2011, unusual disease symptoms, including stunted growth, epinasty, and chlorosis of leaves and necrosis of leaf veins and stems were observed in multiple fields. The incidence of these symptoms was low (~1 to 5%), but they were distinct from those associated with known diseases in the region. A representative leaf sample with these symptoms was applied to filter paper (FTA cards, Whatman), and DNA and RNA extracts were prepared according to manufacturer instructions. RT-PCR tests for Tomato spotted wilt virus, Tobacco streak virus, Tomato necrotic spot virus, Tobacco/tomato mosaic viruses, Cucumber mosaic virus, Alfalfa mosaic virus, torradoviruses, and potyviruses, and PCR tests for begomoviruses, phytoplasmas, and 'Candidatus Liberibacter' infection were also negative. However, virus-like symptoms developed in all 16 tomato seedlings (cv. Early Pak 7) 7 to 10 days after mechanical (sap) inoculation with inoculum prepared from the FTA sample. No symptoms developed in mock-inoculated control plants (n = 3). Symptoms induced included stunted growth and severe epinasty of leaves, followed by necrosis of leaf veins, petioles, and stems. These symptoms were similar to those observed in plants in Mali. When RNA extracts prepared from leaves of these symptomatic plants were mechanically inoculated onto 24 tomato seedlings, similar symptoms developed in all plants, suggesting the causal agent might be a viroid. RT-PCR tests with RNA from symptomatic tomato leaves and universal (3) and various specific Pospiviroid primer pairs were negative. However, equivalent RT-PCR tests conducted with the pCLV4/pCLVR4 primer pair specific for Columnea latent viroid (CLVd) (2) generated a DNA fragment of the expected size (~370 bp). The sequence of this DNA fragment (GenBank Accession No. JQ362419) was 99% identical with those of CLVd isolates from the Netherlands (AY373446 and AY372396). In host range studies, the CLVd isolate from Mali induced symptoms in all 48 mechanically-inoculated tomato plants, whereas no symptoms developed (up to 90 days after inoculation) in inoculated Chenopodium quinoa, C. amaranticolor, Nicotiana benthamiana, N. tabacum (cvs. Havana, Glurk and Turkish), N. glutinosa, Datura stramonium, common bean (cvs. Topcrop and Pinto bean), pumpkin (cv. Small Sugar), pepper (Capsicum annuum, cv. Yolo Wonder) and cucumber (cvs. Emparator and Poinsett 76) plants (results of three independent experiments with six plants per experiment). Symptomless infections were detected in pepper (24 of 30), N. benthamiana (25 of 25), and N. tabacum cv. Turkish (11 of 24) plants by RT-PCR with the pCLV4/pCLVR4 primer pair. To our knowledge, this is the first report of CLVd infecting tomato in Mali. RT-PCR tests of seeds collected from CLVd-infected tomato, pepper, and N. benthamiana plants also detected CLVd (1). Thus, it is possible that CLVd was introduced into Mali in association with seed. References: (1) O. Batuman and R. L. Gilbertson. Phytopathology 102:S4.9, 2012. (2) R. L. Spieker. Arch. Virol. 141:1823, 1996. (3) J. T. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

12.
Neuropathol Appl Neurobiol ; 38(3): 222-7, 2012 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-22571271

RESUMO

The recent convergence of pathology, cancer research and basic neurobiology disciplines is providing unprecedented insights to the origins of brain tumours. This new knowledge holds great promise for patients, transforming the way we view and develop new treatments for these devastating diseases.


Assuntos
Neoplasias Encefálicas/patologia , Neoplasias Encefálicas/terapia , Animais , Encefalopatias/etiologia , Encefalopatias/terapia , Neoplasias Encefálicas/etiologia , Sistema Nervoso Central/citologia , Humanos , Pesquisa/tendências
13.
Arch Virol ; 156(4): 547-55, 2011 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-21193937

RESUMO

A full-length curtovirus genome was PCR-amplified and cloned from peppers in Mexico with symptoms of curly top disease. The cloned DNA of this isolate, MX-P24, replicated in Nicotiana tabacum protoplasts and was infectious in N. benthamiana plants. Sequence analysis revealed that the MX-P24 isolate had a typical curtovirus genome organization and was most similar to beet mild curly top virus (BMCTV). However, sequence identities were at the threshold value for establishment of a new curtovirus species. To further investigate the biological properties of MX-P24, an agroinoculation system was generated. Agroinoculated shepherd's purse plants developed typical curly top symptoms, and virus from these plants was transmissible by the beet leafhopper (Circulifer tenellus). The host range of MX-P24 was similar to that of BMCTV, with curly top symptoms induced in common bean, pepper, pumpkin, shepherd's purse and tomato plants and mild or no symptoms induced in sugar beet plants. Together, these results indicate that MX-P24 is a highly divergent strain of BMCTV associated with an outbreak of curly top disease in peppers in Mexico.


Assuntos
Beta vulgaris/virologia , Capsicum/virologia , Geminiviridae/classificação , Geminiviridae/genética , Variação Genética , Doenças das Plantas/virologia , Análise por Conglomerados , Geminiviridae/patogenicidade , Ordem dos Genes , Especificidade de Hospedeiro , México , Dados de Sequência Molecular , Filogenia , Análise de Sequência de DNA , Homologia de Sequência , Nicotiana/virologia , Cultura de Vírus
14.
Arch Virol ; 155(6): 857-69, 2010 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-20376682

RESUMO

Tomatoes in Guatemala have been affected by a new disease, locally known as "mancha de chocolate" (chocolate spot). The disease is characterized by distinct necrotic spots on leaves, stems and petioles that eventually expand and cause a dieback of apical tissues. Samples from symptomatic plants tested negative for infection by tomato spotted wilt virus, tobacco streak virus, tobacco etch virus and other known tomato-infecting viruses. A virus-like agent was sap-transmitted from diseased tissue to Nicotiana benthamiana and, when graft-transmitted to tomato, this agent induced chocolate spot symptoms. This virus-like agent also was sap-transmitted to Datura stramonium and Nicotiana glutinosa, but not to a range of non-solanaceous indicator plants. Icosahedral virions approximately 28-30 nm in diameter were purified from symptomatic N. benthamiana plants. When rub-inoculated onto leaves of N. benthamiana plants, these virions induced symptoms indistinguishable from those in N. benthamiana plants infected with the sap-transmissible virus associated with chocolate spot disease. Tomatoes inoculated with sap or grafted with shoots from N. benthamiana plants infected with purified virions developed typical chocolate spot symptoms, consistent with this virus being the causal agent of the disease. Analysis of nucleic acids associated with purified virions of the chocolate-spot-associated virus, revealed a genome composed of two single-stranded RNAs of approximately 7.5 and approximately 5.1 kb. Sequence analysis of these RNAs revealed a genome organization similar to recently described torradoviruses, a new group of picorna-like viruses causing necrosis-associated diseases of tomatoes in Europe [tomato torrado virus (ToTV)] and Mexico [tomato apex necrosis virus (ToANV) and tomato marchitez virus (ToMarV)]. Thus, the approximately 7.5 kb and approximately 5.1 kb RNAs of the chocolate-spot-associated virus corresponded to the torradovirus RNA1 and RNA2, respectively; however, sequence comparisons revealed 64-83% identities with RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV. Together, these results indicate that the chocolate-spot-associated virus is a member of a distinct torradovirus species and, thus, another member of the recently established genus Torradovirus in the family Secoviridae. The name tomato chocolate spot virus is proposed.


Assuntos
Picornaviridae/classificação , Picornaviridae/patogenicidade , Doenças das Plantas/virologia , Solanum lycopersicum/virologia , Guatemala , Microscopia Eletrônica , Dados de Sequência Molecular , Picornaviridae/genética , Picornaviridae/isolamento & purificação , Folhas de Planta/virologia , Análise de Sequência de DNA , Especificidade da Espécie , Nicotiana/virologia , Vírion/classificação , Vírion/genética , Vírion/isolamento & purificação , Vírion/patogenicidade
15.
Plant Dis ; 94(4): 482, 2010 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-30754504

RESUMO

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts. References: (1) M. K. Nakhla et al. Acta Hortic. 695:277, 2005. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) R. Salati et al. Phytopathology 92:487, 2002. (4) S. D. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

16.
Plant Dis ; 93(5): 546, 2009 May.
Artigo em Inglês | MEDLINE | ID: mdl-30764155

RESUMO

During the 2008 early-summer growing season, virus-like necrosis symptoms, most similar to those induced by Tobacco streak virus (TSV), were observed in leaves, stems, and petioles of processing tomato plants in the Central Valley of California. Symptoms were observed in numerous fields in Merced, San Joaquin, and Yolo counties, though the incidence of the disease in most fields was not high (not more than 5% but over 20% in some areas). Antibody-based tests of representative samples of the disease for infection with Tomato spotted wilt virus, TSV, and Tomato apex necrosis virus, which cause similar symptoms, were negative. A putative virus-like agent was sap- and graft-transmitted to tomato plants and induced necrotic spots in leaves and stem and petiole necrosis symptoms that were similar to those observed in the field. Eventually, these plants recovered from these symptoms. In sap-transmission experiments, the virus-like agent induced systemic symptoms in Chenopodium quinoa and C. amaranticolor (stunted growth and leaf curl and necrosis), Nicotiana benthamiana (necrotic leaf and stem lesions), N. tabacum cvs. Havana and Turkish (stunted growth and necrotic etching and ringspots followed by recovery for cv. Havana but not for cv. Turkish), and Datura stramonium (mild mottle and ringspots in newly emerged leaves followed by recovery); no symptoms were observed in inoculated common bean (cv. Topcrop), pumpkin (cv. Small Sugar), pepper, and N. glutinosa plants. Virus minipurification was performed with leaves from noninfected and infected D. stramonium plants, and polyacrylamide gel electrophoresis analyses revealed a protein band of ~29 kDa in infected but not noninfected plants. This protein was purified and subjected to liquid chromatography-mass/mass spectrometry analysis. Four peptides, obtained from the trypsin-digested protein, each had the highest match (score of 118) with the capsid protein (CP) of Parietaria mottle virus (PMoV), an ilarvirus that induces leaf and stem necrosis in tomatoes in Europe (1). Using sequences of PMoV and other ilarviruses, a single primer was designed from the 3' nontranslated region and paired with primers designed from conserved regions of ilarvirus RNAs 1, 2, and 3. In reverse transcription-PCR analyses, these primer pairs directed the amplification of the expected-sized fragments for ilarvirus RNAs 1, 2, and 3 from RNA extracts prepared from leaves with the unusual necrosis symptoms. Sequence analyses confirmed these were ilarvirus fragments. Partial RNA 1, 2, and 3 sequences were 81, 84, and 82% identical, respectively, with those of PMoV and 80, 77, and 69% identical, respectively, with those of TSV. The amino acid sequence of the CP gene (GenBank Accession No. FJ236810) was 86 and 61% identical to those of PMoV and TSV, respectively. Together, these results indicate the necrosis disease of tomato is caused by a new ilarvirus species, tentatively named Tomato necrotic spot virus, although further studies are needed to confirm this. The mode of transmission of this new ilarvirus to tomatoes in the field is unknown, but it may involve thrips feeding on infected pollen, a known method of transmission for TSV (2). References: (1) L. Galipienso et al. Plant Pathol. 54:29, 2005. (2) R. Sdoodee and D. S. Teakle. Plant Pathol. 36:377, 1987.

17.
Plant Dis ; 93(6): 645-648, 2009 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30764403

RESUMO

The dominant resistance gene, Bct, in common bean (Phaseolus vulgaris) confers qualitative resistance to Beet curly top virus, a leafhopper-transmitted geminivirus in the genus Curtovirus. To determine whether this gene confers resistance to other geminiviruses, bean plants of a recombinant inbred population were sap-inoculated with Bean dwarf mosaic virus (BDMV), a whitefly-transmitted bipartite begomovirus in the genus Begomovirus. Results indicated that Bct (or tightly linked gene) is associated with quantitative resistance to BDMV; thus, the Bct locus is associated with resistance to a bean-infecting begomovirus and curtovirus. The difference in the nature of the resistance to these geminiviruses may indicate a role for minor genes in begomovirus resistance or differences in the virus-host interaction. The Bct locus, whether it acts alone or represents a cluster of tightly linked genes, will be useful in breeding for broad-spectrum begomovirus resistance in common bean.

18.
Phytopathology ; 98(9): 1029-37, 2008 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-18943741

RESUMO

A strong recovery response occurs in cantaloupe (Cucumis melo) and watermelon (Citrullus lanatus) infected with the bipartite begomovirus Cucurbit leaf crumple virus (CuLCrV). This response is characterized by initially severe symptoms, which gradually become attenuated (almost symptomless). An inverse relationship was detected between viral DNA levels and recovery, indicating that recovered tissues had reduced viral titers. Recovered tissues also were resistant to reinfection with CuLCrV; i.e., recovered leaves reinoculated with the virus did not develop symptoms or have an increased level of viral DNA. In contrast, infection of CuLCrV-recovered leaves with the RNA virus, Cucumber mosaic virus (CMV), disrupted recovery, resulting in the development of severe disease symptoms (more severe than those induced by CMV or CuLCrV alone) and increased CuLCrV DNA levels. Small RNAs with homology to CuLCrV DNA were detected in recovered and nonrecovered tissues; as well as in phloem exudates from infected, but not uninfected plants. Levels of these small RNAs were positively correlated with viral titer; thus, recovered tissues had lower levels than symptomatic tissues. In addition, viral DNA from a host that undergoes strong recovery (watermelon) was more highly methylated compared with that from a host that undergoes limited recovery (zucchini). Furthermore, inoculation of CuLCrV-infected zucchini with a construct expressing an inverted repeat of the CuLCrV common region enhanced recovery and reduced viral symptoms and viral DNA levels in newly emerged leaves. Taken together, these results suggest that recovery from CuLCrV infection is an adaptive antiviral defense mechanism, most likely mediated by gene silencing.


Assuntos
Begomovirus/genética , Begomovirus/patogenicidade , Cucumis/virologia , Doenças das Plantas/virologia , RNA Viral/genética , Antivirais/uso terapêutico , Begomovirus/efeitos dos fármacos , Primers do DNA , DNA Viral/genética , Inativação Gênica , Genes Virais , Phaseolus/virologia , Folhas de Planta/virologia , Mapeamento por Restrição , Estados Unidos
19.
Arch Virol ; 153(4): 693-706, 2008.
Artigo em Inglês | MEDLINE | ID: mdl-18278427

RESUMO

Tomato yellow leaf curl (TYLC) and tomato leaf curl (ToLC) diseases are serious constraints to tomato production in Mali and other countries in West Africa. In 2003 and 2004, samples of tomato showing virus-like symptoms were collected during a survey of tomato virus diseases in Mali. Three predominant symptom phenotypes were observed: (1) TYLC/ToLC (stunted upright growth and upcurled leaves with interveinal yellowing and vein purpling), (2) yellow leaf crumple and (3) broccoli or bonsai (severe stunting and distorted growth). Squash blot (SB) hybridization with a general begomovirus probe and/or SB/PCR analyses revealed begomovirus infection in plants with each of these symptom phenotypes and no evidence of phytoplasma infection. Sequence analysis of PCR-amplified begomovirus fragments revealed two putative new begomovirus species associated with the TYLC/ToLC and yellow leaf crumple symptom phenotypes, respectively. Full-length clones of these begomoviruses were obtained using PCR and overlapping primers. When introduced into N. benthamiana and tomato plants, these clones induced upward leaf curling and crumpling (the TYLC/ToLC-associated begomovirus) or downward leaf curl/yellow mottle (yellow leaf crumple-associated begomovirus) symptoms. Thus, these begomoviruses were named tomato leaf curl Mali virus (ToLCMLV) and tomato yellow leaf crumple virus (ToYLCrV). The genome organization of both viruses was similar to those of other monopartite begomoviruses. ToLCMLV and ToYLCrV were most closely related to each other and to tobacco leaf curl Zimbabwe virus (TbLCZV-[ZW]) and tomato curly stunt virus from South Africa (ToCSV-ZA). Thus, these likely represent tomato-infecting begomoviruses that evolved from indigenous begomoviruses on the African continent. Mixed infections of ToLCMLV and ToYLCrV in N. benthamiana and tomato plants resulted in more severe symptoms than in plants infected with either virus alone, suggesting a synergistic interaction. Agroinoculation experiments indicated that both viruses induced symptomatic infections in tomato and tobacco, whereas neither virus induced disease symptoms in pepper, common bean, small sugar pumpkin, African eggplant, or Arabidopsis. Virus-specific PCR primers were developed for detection of ToLCMLV and ToYLCrV and will be used to further investigate the distribution and host range of these viruses.


Assuntos
Begomovirus/genética , Begomovirus/patogenicidade , Evolução Molecular , Doenças das Plantas/microbiologia , Folhas de Planta/microbiologia , Solanum lycopersicum/microbiologia , África Ocidental , Begomovirus/classificação , Begomovirus/isolamento & purificação , Clonagem Molecular , DNA Viral/análise , DNA Viral/isolamento & purificação , Mali , Dados de Sequência Molecular , Filogenia , Análise de Sequência de DNA , Especificidade da Espécie , Nicotiana
20.
Plant Dis ; 92(8): 1248, 2008 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-30769473

RESUMO

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA