Distinct regions within SAP25 recruit O-linked glycosylation, DNA demethylation, and ubiquitin ligase and hydrolase activities to the Sin3/HDAC complex.

Epigenetic control of gene expression is crucial for maintaining gene regulation. Sin3 is an evolutionarily conserved repressor protein complex mainly associated with histone deacetylase (HDAC) activity. A large number of proteins are part of Sin3/HDAC complexes, and the function of most of these members remains poorly understood. SAP25, a previously identified Sin3A associated protein of 25 kDa, has been proposed to participate in regulating gene expression programs involved in the immune response but the exact mechanism of this regulation is unclear. SAP25 is not expressed in HEK293 cells, which hence serve as a natural knockout system to decipher the molecular functions uniquely carried out by this Sin3/HDAC subunit. Using molecular, proteomic, protein engineering, and interaction network approaches, we show that SAP25 interacts with distinct enzymatic and regulatory protein complexes in addition to Sin3/HDAC. While the O-GlcNAc transferase (OGT) and the TET1 /TET2/TET3 methylcytosine dioxygenases have been previously linked to Sin3/HDAC, in HEK293 cells, these interactions were only observed in the affinity purification in which an exogenously expressed SAP25 was the bait. Additional proteins uniquely recovered from the Halo-SAP25 pull-downs included the SCF E3 ubiquitin ligase complex SKP1/FBXO3/CUL1 and the ubiquitin carboxyl-terminal hydrolase 11 (USP11), which have not been previously associated with Sin3/HDAC. Finally, we use mutational analysis to demonstrate that distinct regions of SAP25 participate in its interaction with USP11, OGT/TETs, and SCF(FBXO3).) These results suggest that SAP25 may function as an adaptor protein to coordinate the assembly of different enzymatic complexes to control Sin3/HDAC-mediated gene expression.

Interaction of C-terminal p53 isoforms depends strongly upon DNA sequence and topology.

The p53 protein is a key tumor suppressor and the most commonly mutated and down-regulated protein in human tumors. It functions mainly through interaction with DNA, and p53 acts as a transcription factor that recognizes the so-called p53 target sites on the promoters of various genes. P53 has been shown to exist as many isoforms, including three C-terminal isoforms that are produced by alternative splicing. Because the C-terminal domain is responsible for sequence-nonspecific binding and regulation of p53 binding, we have analyzed DNA recognition by these C-terminal isoforms. Using atomic force microscopy, we show for the first time that all C-terminal isoforms recognize superhelical DNA. It is particularly noteworthy that a sequence-specific p53 consensus binding site is bound by p53α and ß isoforms with similar affinities, whilst p53α shows higher binding to a quadruplex sequence than both p53ß and p53γ, and p53γ loses preferential binding to both the consensus binding sequence and the quadruplex-forming sequence. These results show the important role of the variable p53 C-terminal amino acid sequences for DNA recognition.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Letter to the Editor: Significant mutation enrichment in inverted repeat sites of new SARS-CoV-2 strains.

In a recently published paper, we have found that SARS-CoV-2 hot-spot mutations are significantly associated with inverted repeat loci and CG dinucleotides. However, fast-spreading strains with new mutations (so-called mink farm mutations, England mutations and Japan mutations) have been recently described. We used the new datasets to check the positioning of mutation sites in genomes of the new SARS-CoV-2 strains. Using an open-access Palindrome analyzer tool, we found mutations in these new strains to be significantly enriched in inverted repeat loci.

SARS-CoV-2 hot-spot mutations are significantly enriched within inverted repeats and CpG island loci.

SARS-CoV-2 is an intensively investigated virus from the order Nidovirales (Coronaviridae family) that causes COVID-19 disease in humans. Through enormous scientific effort, thousands of viral strains have been sequenced to date, thereby creating a strong background for deep bioinformatics studies of the SARS-CoV-2 genome. In this study, we inspected high-frequency mutations of SARS-CoV-2 and carried out systematic analyses of their overlay with inverted repeat (IR) loci and CpG islands. The main conclusion of our study is that SARS-CoV-2 hot-spot mutations are significantly enriched within both IRs and CpG island loci. This points to their role in genomic instability and may predict further mutational drive of the SARS-CoV-2 genome. Moreover, CpG islands are strongly enriched upstream from viral ORFs and thus could play important roles in transcription and the viral life cycle. We hypothesize that hypermethylation of these loci will decrease the transcription of viral ORFs and could therefore limit the progression of the disease.

Divergent distributions of inverted repeats and G-quadruplex forming sequences in Saccharomyces cerevisiae.

The importance of DNA structure in the regulation of basic cellular processes is an emerging field of research. Among local non-B DNA structures, inverted repeat (IR) sequences that form cruciforms and G-rich sequences that form G-quadruplexes (G4) are found in all prokaryotic and eukaryotic organisms and are targets for regulatory proteins. We analyzed IRs and G4 sequences in the genome of the most important biotechnology microorganism, S. cerevisiae. IR and G4-prone sequences are enriched in specific genomic locations and differ markedly between mitochondrial and nuclear DNA. While G4s are overrepresented in telomeres and regions surrounding tRNAs, IRs are most enriched in centromeres, rDNA, replication origins and surrounding tRNAs. Mitochondrial DNA is enriched in both IR and G4-prone sequences relative to the nuclear genome. This extensive analysis of local DNA structures adds to the emerging picture of their importance in genome maintenance, DNA replication and transcription of subsets of genes.

The Presence and Localization of G-Quadruplex Forming Sequences in the Domain of Bacteria.

The role of local DNA structures in the regulation of basic cellular processes is an emerging field of research. Amongst local non-B DNA structures, the significance of G-quadruplexes was demonstrated in the last decade, and their presence and functional relevance has been demonstrated in many genomes, including humans. In this study, we analyzed the presence and locations of G-quadruplex-forming sequences by G4Hunter in all complete bacterial genomes available in the NCBI database. G-quadruplex-forming sequences were identified in all species, however the frequency differed significantly across evolutionary groups. The highest frequency of G-quadruplex forming sequences was detected in the subgroup Deinococcus-Thermus, and the lowest frequency in Thermotogae. G-quadruplex forming sequences are non-randomly distributed and are favored in various evolutionary groups. G-quadruplex-forming sequences are enriched in ncRNA segments followed by mRNAs. Analyses of surrounding sequences showed G-quadruplex-forming sequences around tRNA and regulatory sequences. These data point to the unique and non-random localization of G-quadruplex-forming sequences in bacterial genomes.

Family of BODIPY Photocages Cleaved by Single Photons of Visible/Near-Infrared Light.

Photocages are light-sensitive chemical protecting groups that provide external control over when, where, and how much of a biological substrate is activated in cells using targeted light irradiation. Regrettably, most popular photocages (e.g., o-nitrobenzyl groups) absorb cell-damaging ultraviolet wavelengths. A challenge with achieving longer wavelength bond-breaking photochemistry is that long-wavelength-absorbing chromophores have shorter excited-state lifetimes and diminished excited-state energies. However, here we report the synthesis of a family of BODIPY-derived photocages with tunable absorptions across the visible/near-infrared that release chemical cargo under irradiation. Derivatives with appended styryl groups feature absorptions above 700 nm, yielding photocages cleaved with the highest known wavelengths of light via a direct single-photon-release mechanism. Photorelease with red light is demonstrated in living HeLa cells, Drosophila S2 cells, and bovine GM07373 cells upon ∼5 min irradiation. No cytotoxicity is observed at 20 µM photocage concentration using the trypan blue exclusion assay. Improved B-alkylated derivatives feature improved quantum efficiencies of photorelease ∼20-fold larger, on par with the popular o-nitrobenzyl photocages (ÎµΦ = 50-100 M-1 cm-1), but absorbing red/near-IR light in the biological window instead of UV light.

BODIPY-derived photoremovable protecting groups unmasked with green light.

Photoremovable protecting groups derived from meso-substituted BODIPY dyes release acetic acid with green wavelengths >500 nm. Photorelease is demonstrated in cultured S2 cells. The photocaging structures were identified by our previously proposed strategy of computationally searching for carbocations with low-energy diradical states as a possible indicator of a nearby productive conical intersection. The superior optical properties of these photocages make them promising alternatives to the popular o-nitrobenzyl photocage systems.

Self-immolative phthalate esters sensitive to hydrogen peroxide and light.

Self-immolative aryl phthalate esters were conjugated with cleavable masking groups sensitive to light and hydrogen peroxide. The phthalate linker releases the fluorescent dye 7-hydroxycoumarin upon exposure to light or H2O2, respectively, leading to an increase in fluorescence. The light-sensitive aryl phthalate ester is demonstrated as a pro-fluorophore in cultured S2 cells.

Self-immolative aryl phthalate esters.

We report that aryl phthalate esters are robust self-immolative linkers. This linker is easy to conjugate and releases output phenols upon cleaving a fluoride-sensitive mask to yield a benign phthalic acid byproduct, making these linkers potentially useful as fluoride sensors and promising for use in biological and materials applications.