RESUMO
We previously found allelic deletions on chromosomes 17 in primary gastric cancers (GC) using microsatellite markers for loss of heterozygosity (LOH). OVCA1 lies in one of these regions (17q21.33). The association between single nucleotide polymorphism (SNP) of OVCA1 gene and risk of gastric cancer is not yet clear. In this study, the peripheral blood of 505 gastric cancer patients and 544 healthy controls were genotyped for six SNPs (rs2273981, rs1131600, rs3752963, rs3803806, rs2236375, and rs1051322) of OVCA1, to evaluate the association of these SNPs with the risk of gastric cancer in the Han population in northeast China. The effect of rs2273981 located in the promoter region of OVCA1 on the transcription activity was determined using dual luciferase reporter assay. We found that the association between the AA + AG genotype of rs2273981 and the risk of gastric cancer was significant in smokers (AA + AG vs. GG, OR = 2.47, 95% CI = 1.04 - 5.87, P < 0.05). Stratified analysis of the clinicopathological parameters revealed that rs1131600 AG + GG genotype were significantly associated with increased gastric tumor volume (AG + GG vs. AA, OR = 1.81, 95% CI = 1.00 - 3.29, P < 0.05). The rs2236375 CT + TT genotype was also significantly associated with increased gastric tumor volume (CT + TT vs. CC, OR = 2.65, 95% CI = 1.38 - 5.10, P < 0.05). Additionally, by interacting with the transcription factor AP2A, the GG genotype the rs2273981 increased the transcription activity of OVCA1 compared with AA genotype, thus involved in gastric cancer development.
Assuntos
Biomarcadores Tumorais/genética , Antígenos de Histocompatibilidade Menor/genética , Polimorfismo de Nucleotídeo Único , Regiões Promotoras Genéticas , Neoplasias Gástricas/genética , Proteínas Supressoras de Tumor/genética , Subunidades do Complexo de Proteínas Adaptadoras/genética , Subunidades do Complexo de Proteínas Adaptadoras/metabolismo , Idoso , Povo Asiático/genética , Biomarcadores Tumorais/metabolismo , Estudos de Casos e Controles , China/epidemiologia , Feminino , Estudos de Associação Genética , Predisposição Genética para Doença , Células HEK293 , Humanos , Masculino , Pessoa de Meia-Idade , Antígenos de Histocompatibilidade Menor/metabolismo , Fenótipo , Medição de Risco , Fatores de Risco , Neoplasias Gástricas/etnologia , Neoplasias Gástricas/metabolismo , Neoplasias Gástricas/patologia , Carga Tumoral , Proteínas Supressoras de Tumor/metabolismoRESUMO
BACKGROUND: DAL-1 gene was reported to inhibit proliferation, migration, invasion, and epithelial to mesenchymal transition (EMT) of gastric cancer (GC) cells in our previous study. The association between the genomic variants in DAL-1 gene with risk of GC is still unclear. METHODS: In this study, 505 GC cases and 544 healthy controls (HCs) were collected to evaluate the association between six single nucleotide polymorphisms (SNPs) (rs7240736, rs73937194, rs3817466, rs8082898, rs73381527, rs9953490) of DAL-1 gene and GC risk in the Han population in Northeast China. RESULTS: The TA + AA genotypes of rs9953490 were significantly associated with an increased risk in N3 compared with N0 subgroup (adjusted OR = 4.56, 95% CI = 1.49-13.98, P = 0.008), and also showed evident association with an increased risk in TNM stage III compared with stage I-II (adjusted OR = 2.33, 95% CI = 1.16-4.67, P = 0.017). CONCLUSION: The rs9953490 of DAL-1 gene may play an important role in the occurrence and development of GC in the Han population in Northeast China.
Assuntos
Neoplasias Gástricas , Povo Asiático/genética , Estudos de Casos e Controles , China , Transição Epitelial-Mesenquimal , Estudos de Associação Genética , Predisposição Genética para Doença , Genótipo , Humanos , Proteínas dos Microfilamentos , Polimorfismo de Nucleotídeo Único , Neoplasias Gástricas/genéticaRESUMO
Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re-identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI-H716 by genetic mapping and sequencing strategy, employing high-resolution array-based comparative genomic hybridization, high-throughput sequencing, multiplex-fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI-H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi-step evolutionary model could fit the module of DM genesis better in NCI-H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.
Assuntos
Neoplasias Colorretais/genética , Evolução Molecular , Amplificação de Genes , Sequência de Bases , Linhagem Celular Tumoral , Aberrações Cromossômicas , Pontos de Quebra do Cromossomo , Passeio de Cromossomo , Cromossomos Humanos Par 10 , Cromossomos Humanos Par 8 , Neoplasias Colorretais/patologia , Hibridização Genômica Comparativa , Análise Citogenética/métodos , Humanos , Hibridização in Situ FluorescenteRESUMO
BACKGROUND: Polycystic kidney disease (PKD) is an inherited disease that is life-threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. METHODS: This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. RESULTS: Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. CONCLUSION: The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family.
Assuntos
Mutação , Doenças Renais Policísticas/genética , Canais de Cátion TRPP/genética , Adulto , Consanguinidade , Feminino , Frequência do Gene , Humanos , Masculino , Pessoa de Meia-Idade , Linhagem , Doenças Renais Policísticas/patologia , Domínios Proteicos , Canais de Cátion TRPP/químicaRESUMO
Rett syndrome (RTT) is a neurodevelopmental disorder mainly affecting the females. It is closely associated with mutations of methylated CpG binding protein 2 ((MeCP2))] gene on the X chromosome. The incidence of RTT in females is 1/15 000 - 1/10 000. Its clinical features include mental retardation, loss of language function, rigid movement of hands, and abnormal gait. Currently there is no cure for the disease but only symptomatic treatment. The compilation of this guideline has referred to the third edition of Diagnostic Standard of RTT as revised in 2010, and integrated the latest findings of clinical research at home and abroad, in addition with conditions and clinical practice in China, with an aim to provide guidance for the clinical diagnosis, treatment and genetic counseling of patients with RTT.
Assuntos
Guias de Prática Clínica como Assunto , Síndrome de Rett/diagnóstico , Síndrome de Rett/terapia , China , Feminino , Humanos , Proteína 2 de Ligação a Metil-CpG/genética , MutaçãoRESUMO
BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.
Assuntos
Duplicação Gênica , Heterozigoto , Proteínas de Homeodomínio/genética , Mutação , Sindactilia/genética , Fatores de Transcrição/genética , Criança , China , Éxons , Feminino , Humanos , Masculino , LinhagemRESUMO
Polycystic kidney disease (PKD) is a lifethreatening inherited disease with a morbidity of 1:5001,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin1, lipoxygenase, αtoxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the Nterminal domain of polycystin1 may present high pathogenicity in ADPKD.
Assuntos
Estudos de Associação Genética , Predisposição Genética para Doença , Mutação , Doenças Renais Policísticas/diagnóstico , Doenças Renais Policísticas/genética , Adulto , Feminino , Duplicação Gênica , Genótipo , Humanos , Pessoa de Meia-Idade , Linhagem , Canais de Cátion TRPP/genética , Sequenciamento do ExomaRESUMO
Gene amplification, which involves the two major topographical structures double minutes (DMs) and homegeneously stained region (HSR), is a common mechanism of treatment resistance in cancer and is initiated by DNA double-strand breaks. NHEJ, one of DSB repair pathways, is involved in gene amplification as we demonstrated previously. However, the involvement of homologous recombination, another DSB repair pathway, in gene amplification remains to be explored. To better understand the association between HR and gene amplification, we detected HR activity in DM- and HSR-containing MTX-resistant HT-29 colon cancer cells. In DM-containing MTX-resistant cells, we found increased homologous recombination activity compared with that in MTX-sensitive cells. Therefore, we suppressed HR activity by silencing BRCA1, the key player in the HR pathway. The attenuation of HR activity decreased the numbers of DMs and DM-form amplified gene copies and increased the exclusion of micronuclei and nuclear buds that contained DM-form amplification; these changes were accompanied by cell cycle acceleration and increased MTX sensitivity. In contrast, BRCA1 silencing did not influence the number of amplified genes and MTX sensitivity in HSR-containing MTX-resistant cells. In conclusion, our results suggest that the HR pathway plays different roles in extrachromosomal and intrachromosomal gene amplification and may be a new target to improve chemotherapeutic outcome by decreasing extrachromosomal amplification in cancer.
Assuntos
Cromossomos/genética , Neoplasias do Colo/tratamento farmacológico , Neoplasias do Colo/genética , Resistencia a Medicamentos Antineoplásicos/genética , Amplificação de Genes/genética , Recombinação Homóloga/genética , Metotrexato/farmacologia , Ciclo Celular/genética , Linhagem Celular Tumoral , Núcleo Celular/genética , Aberrações Cromossômicas , Quebras de DNA de Cadeia Dupla , Células HT29 , HumanosRESUMO
TOB1, a member of the BTG/TOB protein family, inhibits tumor cell proliferation. We previously observed down-regulation and phosphorylation of TOB1 in gastric cancer (GC). Here, we examined the subcellular distribution and clinical significance of TOB1 expression and phosphorylation in GC. Immunohistochemical analysis of 341 primary GC and corresponding normal gastric tissue samples demonstrated that nuclear TOB1 expression was lower in GC than normal tissue (80.4% vs. 92.4%), and decreased nuclear TOB1 expression correlated with high TNM stage. By contrast, phosphorylation of nuclear TOB1 was higher in GC than normal gastric tissue (66.0% vs. 36.4%), and was associated with poorly differentiated and high TNM stage tumors. Patients with intestinal type GC and increased nuclear TOB1 phosphorylation had poor overall survival. Multivariate survival analysis indicated the nuclear concentration of phosphorylated TOB1 was an independent prognostic factor for intestinal type GC. Overexpression of TOB1 containing mutations in its nuclear export signal inhibited GC cell proliferation, migration, and invasion compared to cells expressing TOB1 with the nuclear localization signal. Thus, decreased TOB1 expression and increased phosphorylation of nuclear TOB1 is associated with aggressive tumor behavior and poor prognosis in intestinal type GC. Additionally, TOB1 nuclear retention is critical for its anti-proliferative activity.
RESUMO
Purpose: Investigate the role of regulator of chromosome condensation 2 (RCC2) on lung adenocarcinoma (LUAD) metastasis.Experimental Design: Clinical specimens were used to assess the impact of RCC2 on LUAD metastasis. Mouse models, cytobiology, and molecular biology assays were performed to elucidate the function and underlying mechanisms of RCC2 in LUAD.Results: RCC2 expression was frequently increased in LUADs (88/122, 72.13%). It was confirmed by analysis of a larger cohort of TCGA RNA-seq data containing 488 LUADs and 58 normal lung tissues (P < 0.001). Importantly, increased level of RCC2 was significantly associated with T status of tumor (P = 0.002), lymph node metastasis (P = 0.004), and advanced clinical stage (P = 0.001). Patients with LUAD with higher expression of RCC2 had shorter overall survival. Cox regression analysis demonstrated that RCC2 was an independent poorer prognostic factor for patients with LUAD. Moreover, forced expression of RCC2 promoted intrapulmonary metastasis in vivo and significantly enhanced LUAD cell migration, invasion, and proliferation in vitro Further study found that RCC2 induced epithelial-mesenchymal transition (EMT) and also stimulated the expression of MMP-2 and MMP-9. In addition, RCC2 was able to activate JNK, while inhibition of JNK suppressed the effect of RCC2 on LUAD cell migration, invasion, EMT, and the expression of MMP-2 and MMP-9.Conclusions: RCC2 plays a pivotal role in LUAD metastasis by inducing EMT via activation of MAPK-JNK signaling. Clin Cancer Res; 23(18); 5598-610. ©2017 AACR.
Assuntos
Adenocarcinoma/genética , Adenocarcinoma/patologia , Proteínas Cromossômicas não Histona/genética , Transição Epitelial-Mesenquimal/genética , Regulação Neoplásica da Expressão Gênica , Fatores de Troca do Nucleotídeo Guanina/genética , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/patologia , Adenocarcinoma/mortalidade , Adenocarcinoma de Pulmão , Animais , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células , Modelos Animais de Doenças , Matriz Extracelular/metabolismo , Feminino , Xenoenxertos , Humanos , Estimativa de Kaplan-Meier , Neoplasias Pulmonares/mortalidade , Sistema de Sinalização das MAP Quinases , Masculino , Metástase Neoplásica , Prognóstico , Interferência de RNA , RNA Interferente Pequeno/genéticaRESUMO
The BRCA2 gene plays an important role in cancer carcinogenesis, and polymorphisms in this gene have been associated with cancer risk. The BRCA2 rs144848 polymorphism has been associated with several cancers, but results have been inconsistent. In the present study, a meta-analysis was performed to assess the association between the rs144848 polymorphism and cancer risk. Literature was searched from the databases of PubMed, Embase and Google Scholar before April 2016. The fixed or random effects model was used to calculate pooled odd ratios on the basis of heterogeneity. Meta-regression, sensitivity analysis, subgroup analysis and publication bias assessment were also performed using STATA 11.0 software according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2009. A total of 40 relevant studies from 30 publications including 34,911 cases and 48,329 controls were included in the final meta-analysis. Among them, 22 studies focused on breast cancer, seven on ovarian cancer, five on non-Hodgkin lymphoma, and the remaining six studies examined various other cancers. The meta-analysis results showed that there were significant associations between the rs144848 polymorphism and cancer risk in all genetic models. Stratified by cancer type, the rs144848 polymorphism was associated with non-Hodgkin lymphoma. Stratified by study design, the allele model was associated with breast cancer risk in population-based studies. The meta-analysis suggests that the BRCA2 rs144848 polymorphism may play a role in cancer risk. Further well-designed studies are warranted to confirm these results.
Assuntos
Proteína BRCA2/genética , Predisposição Genética para Doença , Neoplasias/genética , Polimorfismo Genético , Estudos de Casos e Controles , Humanos , Neoplasias/patologia , Prognóstico , Fatores de RiscoRESUMO
Previous studies have shown that the oncogene SEI1 is highly expressed in ovarian carcinomas, and promoting genomic instability. However, the molecular mechanism of SEI1 in promoting genomic instability remains unclear. We observed SEI1 overexpression in 30 of 46 cases of ovarian cancer compared to non-tumor tissues and the overexpression of SEI1 was positively associated with the tumor FIGO stage. Our functional studies revealed that overexpression of SEI1 could induce genomic instability and increased DNA strand breaks. In contrast, SEI1 co-localized with γH2AX and phosphorylated ATM and DNAPKcs in the nucleus. Furthermore, we found that overexpression of SEI1 induced translocation of the SEI1 protein from the cytoplasm to the nucleus; ATM and DNAPKcs were associated with the cytoplasm-to-nucleus translocation of SEI1. To further prove the correlation between the DNA damage response (DDR) and SEI1, we knocked down SEI1 expression in SEI1-transfected ovarian cancer cell lines. The expression of DDR proteins was significantly downregulated, and the number of micronuclei was significantly decreased. Together, these results define a new mechanism of SEI1 in the regulation of genomic stability and in the malignant progression of ovarian cancer.
Assuntos
Biomarcadores Tumorais/metabolismo , Dano ao DNA , Reparo do DNA , Instabilidade Genômica , Proteínas Nucleares/metabolismo , Neoplasias Ovarianas/metabolismo , Transativadores/metabolismo , Transporte Ativo do Núcleo Celular , Proteínas Mutadas de Ataxia Telangiectasia/metabolismo , Biomarcadores Tumorais/genética , Proteínas de Ligação ao Cálcio/metabolismo , Linhagem Celular Tumoral , Feminino , Regulação Neoplásica da Expressão Gênica , Histonas/metabolismo , Humanos , Pessoa de Meia-Idade , Estadiamento de Neoplasias , Proteínas Nucleares/genética , Neoplasias Ovarianas/genética , Neoplasias Ovarianas/patologia , Fosforilação , Interferência de RNA , Transdução de Sinais , Transativadores/genética , Fatores de Transcrição , Transfecção , Regulação para CimaRESUMO
BACKGROUND: Double minute chromosomes (DMs) are the cytogenetic hallmark of extra-chromosomal genomic amplification. They can well represent the advanced stage of malignancy. However, the mechanisms of DM generation are still not fully understood. Here, the sister chromatid exchange (SCE) was used to determine whether the occurrence of DMs was related to the high genomic instability in human carcinoma cells. We analyzed SCE frequencies in two groups of cell lines: the first group contained DM-positive cell lines such as UACC-1598, SK-PN-DW, and NCI-N87 carcinomas, while the second group comprised DM-negative cell lines including HO-8910, U251, and MGC-803. RESULTS: The data showed that SCE was significantly increased in the DM-positive cells as compared to the DM-negative cells. In addition, there was a positive correlation between the incidence of DMs and the SCE frequency in the UACC-1598, SK-PN-DW, and NCI-N87 carcinoma cells. CONCLUSIONS: Because SCE can reflect general genome instability, it is suggested that the DMs are likely to be closely associated with genomic instability in carcinoma cells. Meanwhile, SCE may be involved in the malignant progression of DM-positive cancers.
RESUMO
AIM: We used a panel of 17 non-small-cell lung cancer cell lines to investigate whether the presence of polymorphisms in the RRM1, ERCC1, ABCB1 and MTHFR genes and alterations in their mRNA expression can affect the in vitro chemosensitivity to cisplatin and gemcitabine. MATERIALS & METHODS: Polymorphisms in these genes were evaluated by direct sequencing. mRNA expression levels were assessed by realtime PCR. In vitro chemosensitivity to cisplatin and gemcitabine was expressed as IC50 values, using the MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay. RESULTS: There was a significant, positive correlation between RRM1 mRNA expression and IC50 values for gemcitabine (r = 0.6533, p = 0.0045), and there was a significant, negative correlation between ABCB1 mRNA expression and IC50 values for cisplatin (r = -0.5459, p = 0.0287). When examining the association between the polymorphisms and IC50, we found that only the MTHFR 1298A>C polymorphism showed a tendency to be more chemosensitive to gemcitabine (p = 0.0440). CONCLUSION: These in vitro results suggest that mRNA expression levels of the RRM1 and ABCB1 genes may be useful indicators of chemosensitivity to gemcitabine and cisplatin, respectively. The MTHFR 1298A>C polymorphism was associated with gemcitabine chemosensitivity, which require further functional analysis with co-expressed genes and should be explored in prospective clinical studies to determine its potential clinical application as a predictive biomarker. Original submitted 11 February 2014; Revision submitted 3 November 2014.
Assuntos
Carcinoma Pulmonar de Células não Pequenas/genética , Proteínas de Ligação a DNA/biossíntese , Resistencia a Medicamentos Antineoplásicos/genética , Endonucleases/biossíntese , Metilenotetra-Hidrofolato Redutase (NADPH2)/biossíntese , Proteínas Supressoras de Tumor/biossíntese , Subfamília B de Transportador de Cassetes de Ligação de ATP/biossíntese , Subfamília B de Transportador de Cassetes de Ligação de ATP/genética , Protocolos de Quimioterapia Combinada Antineoplásica/administração & dosagem , Carcinoma Pulmonar de Células não Pequenas/patologia , Linhagem Celular Tumoral , Cisplatino/administração & dosagem , Proteínas de Ligação a DNA/genética , Desoxicitidina/administração & dosagem , Desoxicitidina/análogos & derivados , Endonucleases/genética , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Estudos de Associação Genética , Humanos , Metilenotetra-Hidrofolato Redutase (NADPH2)/genética , Polimorfismo de Nucleotídeo Único , RNA Mensageiro/biossíntese , Ribonucleosídeo Difosfato Redutase , Proteínas Supressoras de Tumor/genética , GencitabinaRESUMO
Gene transcription analysis is important in cancer research, and reverse transcriptionquantitative polymerase chain reaction (RTqPCR) has been demonstrated to be an effective method to evaluate gene transcription in cancer. RTqPCR requires an internal reference gene with a consistent level of mRNA transcription across various experimental conditions. However, it has been suggested that different treatments, including anticancer therapy, may influence the transcriptional stability of internal reference genes. Paclitaxel (PTX) and 10hydroxycamptothecin (HCPT) are widely used to treat various types of cancer, and a suitable internal reference gene is required in order to analyze the transcription profiles of the cells following treatment. In the current study, the transcriptional stability of 30 candidate reference genes was investigated in cancer cells following treatment with PTX and HCPT. The two ovarian cancer cell lines, UACC1598 and SKOV3, were treated with PTX and HCPT for 24 and 48 h, and the transcriptional levels of the candidate reference genes were subsequently evaluated by RTqPCR analysis. The transcriptional stability of the selected genes was then analyzed using qbase+ and NormFinder software. A total of 9 genes were demonstrated to exhibit high transcriptional stability and one of these genes, ribosomal protein L13a (RPL13A), was identified to exhibit high transcriptional stability in every group. The current study identified various reference genes suitable under different circumstances, while RPL13A was indicated to be the most suitable reference gene for analyzing the transcription profile of ovarian cancer cells following treatment with PTX and HCPT.
Assuntos
Antineoplásicos Fitogênicos/farmacologia , Camptotecina/análogos & derivados , Neoplasias Ovarianas/genética , Paclitaxel/farmacologia , RNA Mensageiro , Proteínas Ribossômicas/genética , Antineoplásicos Fitogênicos/uso terapêutico , Camptotecina/farmacologia , Camptotecina/uso terapêutico , Linhagem Celular Tumoral , Biologia Computacional , Feminino , Perfilação da Expressão Gênica , Humanos , Neoplasias Ovarianas/tratamento farmacológico , Paclitaxel/uso terapêutico , Estabilidade de RNA , Transcrição GênicaRESUMO
Double minute chromosomes (DMs) are a hallmark of gene amplification. The relationship between the formation of DMs and the amplification of DM-carried genes remains to be clarified. The human colorectal cancer cell line NCI-H716 and human malignant primitive neuroectodermal tumor cell line SK-PN-DW are known to contain many DMs. To examine the amplification of DM-carried genes in tumor cells, we performed Affymetrix SNP Array 6.0 analyses and verified the regions of amplification in NCI-H716 and SK-PN-DW tumor cells. We identified the amplification regions and the DM-carried genes that were amplified and overexpressed in tumor cells. Using RNA interference, we downregulated seven DM-carried genes, (NDUFB9, MTSS1, NSMCE2, TRIB1, FAM84B, MYC and FGFR2) individually and then investigated the formation of DMs, the amplification of the DM-carried genes, DNA damage and the physiological function of these genes. We found that suppressing the expression of DM-carried genes led to a decrease in the number of DMs and reduced the amplification of the DM-carried genes through the micronuclei expulsion of DMs from the tumor cells. We further detected an increase in the number of γH2AX foci in the knockdown cells, which provides a strong link between DNA damage and the loss of DMs. In addition, the loss of DMs and the reduced amplification and expression of the DM-carried genes resulted in a decrease in cell proliferation and invasion ability.
Assuntos
Biomarcadores Tumorais/genética , Cromossomos Humanos/genética , Neoplasias Colorretais/patologia , Amplificação de Genes , Micronúcleos com Defeito Cromossômico , Tumores Neuroectodérmicos Primitivos/patologia , Polimorfismo de Nucleotídeo Único/genética , Biomarcadores Tumorais/metabolismo , Western Blotting , Ciclo Celular , Movimento Celular , Núcleo Celular/genética , Proliferação de Células , Neoplasias Colorretais/genética , Neoplasias Colorretais/metabolismo , Dano ao DNA/genética , Imunofluorescência , Perfilação da Expressão Gênica , Histonas/genética , Histonas/metabolismo , Humanos , Tumores Neuroectodérmicos Primitivos/genética , Tumores Neuroectodérmicos Primitivos/metabolismo , Análise de Sequência com Séries de Oligonucleotídeos , RNA Mensageiro/genética , Reação em Cadeia da Polimerase em Tempo Real , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Células Tumorais CultivadasRESUMO
BACKGROUND: Congenital cataract is a Mendelian disorder that frequently causes blindness in infants. To date, various cataract-associated loci have been mapped; more than 30 genes have been identified by linkage analysis. However, the pathogenic loci in some affected families are still unknown, and new research strategies are needed. In this study, we used linkage-exome combinational analysis to further investigate the pedigree of a four-generation Chinese family with autosomal dominant coralliform cataract. METHODS: We combined whole exome sequencing and linkage analysis to identify the causative mutation. The exome capture and next-generation sequencing were used to sequence the protein-coding regions in the genome of the proband to identify rare mutations, which were further screened for candidate mutations in linkage regions. Candidate mutations were independently verified for co-segregation in the whole pedigree using Sanger sequencing. RESULTS: We identified a C to A transversion at nucleotide position c.70 in exon 2 of CRYGD, a cataract-associated gene. This mutation resulted in a threonine substitution for proline at amino acid residue 24. CONCLUSIONS: We identified a missense P24T mutation in CRYGD that was responsible for coralliform cataract in our studied family. Our findings suggest that the combination of exome sequencing and linkage analysis is a powerful tool for identifying Mendelian disease mutations that might be missed by the classic linkage analysis strategy.
Assuntos
Povo Asiático/genética , Catarata/genética , gama-Cristalinas/genética , Catarata/congênito , Catarata/patologia , China , Éxons , Ligação Genética , Haplótipos , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Mutação de Sentido Incorreto , Linhagem , Polimorfismo de Nucleotídeo ÚnicoRESUMO
Double minute chromosomes are cytogenetic manifestations of gene amplification frequently seen in cancer cells. Genes amplified on double minute chromosomes include oncogenes and multi-drug resistant genes. These genes encode proteins which contribute to cancer formation, cancer progression, and development of resistance to drugs used in cancer treatment. Elimination of double minute chromosomes, and therefore genes amplified on them, is an effective way to decrease the malignancy of cancer cells. We investigated the effectiveness of a cancer drug, gemcitabine, on the loss of double minute chromosomes from the ovarian cancer cell line UACC-1598. Gemcitabine is able to decrease the number of double minute chromosomes in cells at a 7500X lower concentration than the commonly used cancer drug hydroxyurea. Amplified genes present on the double minute chromosomes are decreased at the DNA level upon gemcitabine treatment. Gemcitabine, even at a low nanomolar concentration, is able to cause DNA damage. The selective incorporation of double minutes chromatin and γ-H2AX signals into micronuclei provides a strong link between DNA damage and the loss of double minute chromosomes from gemcitabine treated cells. Cells treated with gemcitabine also showed decreased cell growth, colony formation, and invasion. Together, our results suggest that gemcitabine is effective in decreasing double minute chromosomes and this affects the biology of ovarian cancer cells.
Assuntos
Desoxicitidina/análogos & derivados , Amplificação de Genes/efeitos dos fármacos , Micronúcleos com Defeito Cromossômico/efeitos dos fármacos , Antineoplásicos/farmacologia , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Dano ao DNA/efeitos dos fármacos , DNA de Neoplasias/genética , DNA de Neoplasias/metabolismo , Desoxicitidina/farmacologia , Feminino , Histonas/metabolismo , Humanos , Hidroxiureia/farmacologia , Hibridização in Situ Fluorescente , Proteína de Sequência 1 de Leucemia de Células Mieloides/genética , Proteína Proto-Oncogênica N-Myc , Proteínas Nucleares/genética , Proteínas Oncogênicas/genética , Neoplasias Ovarianas/tratamento farmacológico , Neoplasias Ovarianas/genética , Neoplasias Ovarianas/patologia , Fatores de Iniciação de Peptídeos/genética , Proteínas de Ligação a RNA/genética , Reação em Cadeia da Polimerase em Tempo Real , Gencitabina , Fator de Iniciação de Tradução Eucariótico 5ARESUMO
Double minutes (DMs) are hallmarks of gene amplification. However, their molecular structure and the mechanisms of formation are largely unknown. To elucidate the structure and underlying molecular mechanism of DMs, we obtained and cloned DMs using microdissection; and degenerated oligonucleotide primed polymerase chain reaction (DOP-PCR) from the ovarian cancer cell line UACC-1598. Two large amplicons, the 284 kb AmpMYCN, originating from locus 2p24.3 and the 391 kb AmpEIF5A2, from locus 3q26.2, were found co-amplified on the same DMs. The two amplicons are joined through a complex 7 kb junction DNA sequence. Analysis of the junction has revealed three de novo created small palindromes surrounding the six breakpoints. Consistent with these observations, we further found that 70% of the 57 reported DM junction sequences have de novo creation of small palindromic sequences surrounding the breakpoints. Together, our findings indicate that de novo-generated small palindromic sequences are characteristic of amplicon boundary junctions on DMs. It is possible that the de novo-generated small palindromic sequences, which may be generated through non-homologous end joining in concert with a novel DNA repair machinery, play a common role in amplicon rejoining and gene amplification.
Assuntos
Amplificação de Genes , Sequência de Bases , Southern Blotting , Linhagem Celular Tumoral , Primers do DNA , Feminino , Humanos , Neoplasias Ovarianas/genética , Reação em Cadeia da Polimerase/métodos , Homologia de Sequência do Ácido NucleicoRESUMO
Human non-small cell lung cancer (NSCLC) is one of the most common malignancies in the modern world. Its recurrence is mainly due to its ability to invade and metastasize. However, the precise mechanism for tumor development and metastasis is still not fully understood. To shed light on the development of lung cancer, the human giant cell lung carcinoma cell lines 95D with high metastatic potential and 95C with low metastatic potential were selected in this study. The 2 cell lines originated from the same parental cell and share a similar genetic background. In the current study, we identified 3 differentially expressed proteins in 95C and 95D cell lines, namely, PAI-RBP1, C1orf142, and COTL1, by using 2-dimensional electrophoresis proteomics analysis. We found that PAI-RBP1 and C1orf142 expression levels were higher in 95D than in 95C cells, whereas COTL1 expression level was lower in 95D when compared to 95C cells. We also confirmed these results by reverse transcription-polymerase chain reaction and immunoblotting analyses. The messenger RNA and protein levels of PAI-RBP1 and C1orf142 were much higher in 95D than in 95C cells, and COTL1 expression level was lower in 95D than in 95C cells. The PAI-RBP1 expression was assessed by immunohistochemistry in 70 NSCLC and 7 normal lung tissue samples from patients. PAI-RBP1 expression level was higher in tumor tissues (positive staining in 87.1% of cases [61/70]) than in normal tissues (positive staining in 14.3% of cases [1/7]). In conclusion, by studying protein expression in NSCLC cell lines with high and low metastasis as well as in human lung cancer tissues, we have identified 3 proteins, namely, PAI-RBP1, C1orf142, and COTL1, which were differentially expressed in NSCLC cell lines with different metastatic potential. In addition, we also found that PAI-RBP1 might contribute to NSCLC development.