A Bio-inspired Model for Bee Simulations.

As eusocial creatures, bees display unique macro collective behavior and local body dynamics that hold potential applications in various fields, such as computer animation, robotics, and social behavior. Unlike birds and fish, bees fly in a low-aligned zigzag pattern. Additionally, bees rely on visual cues for foraging and predator avoidance, exhibiting distinctive local body oscillations, such as body lifting, thrusting, and swaying. These inherent features pose significant challenges for realistic bee simulations in practical animation applications. In this paper, we present a bio-inspired model for bee simulations capable of replicating both macro collective behavior and local body dynamics of bees. Our approach utilizes a visually-driven system to simulate a bee's local body dynamics, incorporating obstacle perception and body rolling control for effective collision avoidance. Moreover, we develop an oscillation rule that captures the dynamics of the bee's local bodies, drawing on insights from biological research. Our model extends beyond simulating individual bees' dynamics; it can also represent bee swarms by integrating a fluid-based field with the bees' innate noise and zigzag motions. To fine-tune our model, we utilize pre-collected honeybee flight data. Through extensive simulations and comparative experiments, we demonstrate that our model can efficiently generate realistic low-aligned and inherently noisy bee swarms.

Synthesis of tetraphenylethylene-based small molecular sensor for the selective "turn-on" detection of pyrophosphoric acid in the aqueous solution.

Pyrophosphoric acid (PPi) is a crucial indicator for monitoring adenosine triphosphate hydrolysis processes, and abnormal PPi levels in the human body seriously threaten human health. Thus the efficient detection of the concentration of PPi in the aqueous solution is important and urgent. This paper described the successful synthesis of a tetraphenylethylene (TPE) derivative, named as TPE-4B, which contained four chelate pyridinium groups exhibiting aggregation-induced emission characteristics. TPE-4B was explicitly developed for the selective and sensitive fluorescence detection of PPi in aqueous solutions, showing a fluorescence "turn-on" response, and the detection limit was 65 nM. The four chelate pyridinium moieties of TPE-4B exhibited robust electrostatic interactions and binding capacity towards PPi, leading to the formation of aggregations, which was confirmed by zeta potential, dynamic light scattering, and scanning electron microscopy. Compared with free TPE-4B in the aqueous solution, the zeta potential of aggregations decreased from 20.7 to 4.2 mV, the average diameter increased from 155 to 403 nm, and the morphology transformed from porous nanostructures into a block-like format. Leveraging these properties, TPE-4B is a promising candidate for a "turn-on" fluorescence sensor designed to detect PPi in the aqueous solution.

Endophytic fungi improved wheat resistance to Rhopalosiphum padi by decreasing its feeding efficiency and population fitness.

The improvement of crop resistance to insect using endophytic fungi is an environmentally friendly and sustainable strategy for agricultural pest control. Clarifying the efficacy and mechanism of endophytic fungi in improving crop resistance to pest offers the opportunity for biological control. In this study, changes in the transcriptome and defense compounds of wheat inoculated with endophytic fungal strains (i.e., YC and BB) were evaluated, and the efficacy of endophytic fungi in improving wheat resistance to Rhopalosiphum padi was studied. The results showed that the numbers of upregulated differentially-expressed genes (DEGs) in wheat plants inoculated with endophytic fungal strains YC and BB were higher than those of the downregulated DEGs, irrespective of R. padi infestation. Defense-related metabolic pathways, such as plant hormone signal transduction and secondary metabolite biosynthesis pathways were significantly enriched. Endophytic fungal strains YC and BB significantly increased jasmonic acid, DIMBOA (2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-one), total flavone, and tannin contents in wheat plants (P < 0.05) but decreased salicylic acid content. Variations in the contents of defense compounds were significantly correlated with decreased feeding, development, and reproduction of R. padi fed on wheat plants inoculated with strains YC and BB (|r| = 0.68-0.91, P < 0.05). The results suggested that endophytic fungi significantly decreased the feeding efficiency and population fitness [YC: (-11.13%) - (-22.07%); BB: (-10.98%) - (-22.20%)] of R. padi by altering the phytohormone pathway and secondary metabolite biosynthesis in wheat plants. This study helps in understanding of the efficacy of endophytic fungi in improving wheat resistance to insect and will be conducive to integrated pest management.

Advances in Radiomics Research for Endometrial Cancer: A Comprehensive Review.

Endometrial cancer (EC) is a common gynecologic malignancy, with a rising trend in related mortality rates. The assessment based on imaging examinations contributes to the preoperative staging and surgical management of EC. However, conventional imaging diagnosis has limitations such as low accuracy and subjectivity. Radiomics, utilizing advanced feature analysis from medical images, extracts more information, ultimately establishing associations between imaging features and disease phenotypes. In recent years, radiomic studies on EC have emerged, employing radiomic features combined with clinical characteristics to model and predict histopathological features, protein expression, and clinical prognosis. This article elaborates on the application of radiomics in EC research and discusses its implications.

Exploratory comparison of flower visiting behavior and pollination ability of mason bees, bumble bees, and honey bees.

This study explored the flower visiting behaviors and pollination abilities of mason bees (Osmia excavata Alfken (Hymenoptera: Megachilidae)), bumble bees (Bombus terrestris (Linnaeus, 1758) (Hymenoptera: Apidae)), and Italian honey bees (Apis mellifera ligustica Spinola (Hymenoptera: Apidae)) in apple orchards in early spring in Jinan (located in the central region of Shandong) and Yantai (located in the Peninsula of Shandong). We compared the pollen collection patterns, flower visiting behavior, flying speed, and effects on apple pollination of the 3 types of bees. The frequencies of flower visits were significantly higher for mason bees (12.89/min in Jinan and 10.63/min in Yantai) than bumble bees and Italian honey bees in the 2 regions. The single flower residence times were significantly higher for Italian honey bees (8.22 s in Jinan and 9.43 s in Yantai), but Italian honey bees were most affected by the climate. The 3 bees differed significantly in terms of the amount of apple pollen collected and their effects on the fruit setting rate in apples (mason bees > bumble bees > Italian honey bees). The results showed that the mason bee was the most suitable pollinating species for spring apple orchards; Bumble bees were more suitable as alternative pollinators during cloudy and low temperatures; Italian honey bees were able to take advantage of their large number of worker bees in sunny and warm weather. Compared to individual bee species, a combination of 2 or 3 species of bees might be more advantageous in dealing with complex and variable weather conditions.

Role of Dynamic Contrast-Enhanced Magnetic Resonance Imaging Parameters and Extracellular Volume Fraction as Predictors of Lung Cancer Subtypes and Lymph Node Status in Non-Small-Cell Lung Cancer Patients.

Objective: The aim of this study is to determine whether dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI)-based quantitative parameters and the extracellular volume fraction (ECV) can differentiate small-cell lung cancer (SCLC) from non-small-cell lung cancer (NSCLC), squamous-cell carcinoma (SCC) from adenocarcinoma (Adeno-Ca), and NSCLC with lymph node metastasis from NSCLC without lymph node metastasis. Materials and methods: We prospectively enrolled patients with lung cancer (41 Adeno-Ca, 29 SCC, and 23 SCLC) who underwent DCE-MRI and enhanced T1 mapping prior to histopathological confirmation. Quantitative parameters based on DCE-MRI and ECV based on T1 mapping were compared between SCLC and NSCLC patients, between SCC and Adeno-Ca patients, and between NSCLC patients with and without lymph node metastasis. The area under the receiver-operating characteristic curve (AUC) was used to evaluate the diagnostic performance of each parameter. Spearman rank correlation was used to clarify the associations between ECV and DCE-MRI-derived parameters. Results: Ktrans, Kep, Ve, and ECV all performed well in differentiating SCLC from NSCLC (AUC > 0.729). Ktrans showed the best performance in differentiating SCC from Adeno-Ca (AUC = 0.836). ECV could differentiate NSCLCs with and without lymph node metastases (AUC = 0.764). ECV showed a significant positive correlation with both Ktrans and Ve. Conclusions: Ktrans is the most promising imaging parameter to differentiate SCLC from NSCLC, and Adeno-Ca from SCC. ECV was helpful in detecting lymph node metastasis in NSCLC. These imaging parameters may help guide the selection of lung cancer treatment.

Cold storage alters the fat-trehalose trade-off, decreases the flight ability, and maintains the high survival rate and flight speed of Osmia excavata (Hymenoptera: Megachilidae).

Osmia solitary bees are important pollinators of various crops worldwide. Refrigeration has been widely used to synchronize the emergence time of Osmia species from cocoons with the blooming time of different crops, but the fitness of Osmia after refrigeration remains unknown. Here, the effects of long-term refrigeration at 0 °C on the vitality, flight ability, and metabolism of Osmia excavata, which is known as the "king of pollination" in China, were studied. The survival rate (>90% before 120 d), weight loss rate (<15% after 170 d), and mean flight speed of O. excavata were not greatly affected after long-term refrigeration. The content of fats, which have antifreeze and energy storage properties, was not significantly altered in O. excavata before 130 d of refrigeration, which might explain why the survival rates and flight speed of O. excavata remained high after long-term refrigeration. However, the flight duration and distance decreased significantly (P < 0.05), and both were positively correlated with the reduced trehalose levels in O. excavata (r = [+0.69] - [+0.71]; P < 0.05). Overall, these findings indicate that the pollination potential of O. excavata for various crops with different flowering periods is high after long-term refrigeration; however, long-term refrigeration may decrease pollination efficiency. Our findings highlight new research directions that could improve the ecological service function of refrigerated O. excavata.

Progress of immunotherapies in gestational trophoblastic neoplasms.

BACKGROUND: Different from other malignant gynecologic tumors, gestational trophoblastic neoplasms (GTNs) exhibit an exceptionally high cure rate primarily through chemotherapeutic interventions. However, there exists a small subset of refractory GTNs that do not respond to conventional chemotherapies. In such cases, the emergence of immunotherapies has demonstrated significant benefits in managing various challenging GTNs. PURPOSE: This article aims to provide a comprehensive and systematic review of the immune microenvironment and immunotherapeutic approaches for GTNs. The purpose is to identify potential biomarkers that could enhance disease management and summarize the available immunotherapies for ease of reference. METHODS: We reviewed the relevant literatures toward immunotherapies of GTNs from PubMed. CONCLUSION: Current immunotherapeutic strategies for GTNs mainly revolve around immune checkpoint inhibitors (ICIs) targeting programmed death receptor 1 (PD-1) and programmed cell death ligand 1 (PD-L1). Prominent examples include avelumab, pembrolizumab, and camrelizumab. However, existing researches into the underlying mechanisms are still limited.

Dissection and Grading of Ovarian Development in Wild-Type Female Insects.

Migratory insect pests pose serious challenges to food production and security all over the world. The migratory pests can be monitored and captured using searchlight traps. One of the most important techniques for migratory pest forecasting is to identify the migratory species. However, in most cases, it is difficult to get the information just by appearance. Therefore, using knowledge acquired by systematic analysis of the female reproductive system can help to understand the combined anatomic morphology of the ovarian mating sac and ovary developmental grading of wild-type migratory insects captured with searchlight traps. To demonstrate the applicability of this method, ovarian development status and egg grain development stages were directly assessed in Helicoverpa armigera, Mythimna separata, Spodoptera litura, and Spodoptera exigua for the ovarian anatomy, and the ovarian mating sacs were studied in Agrotis ipsilon, Spaelotis valida, Helicoverpa armigera, Athetis lepigone, Mythimna separata, Spodoptera litura, Mamestra brassicae, and Spodoptera exigua, to explore their relationships. This work shows the specific dissection method to predict wild-type migratory insects, comparing the unique reproductive system of different migratory insects. Then, both tissues, namely, the ovary and mating sacs, were further investigated. This method helps to predict the dynamics and the structural development of reproductive systems in wild-type female migratory insects.

NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy.

Diabetic cardiomyopathy (DCM) is a serious complication of diabetes caused by oxidative stress, inflammation, insulin resistance, myocardial fibrosis, and lipotoxicity; its nature is insidious, complex and difficult to treat. NLRP3 inflammasome triggers the maturation and release of pro-inflammatory cytokines, participates in pathophysiological processes such as insulin resistance and myocardial fibrosis, in addition to being closely related to the development and progression of diabetic cardiomyopathy. The development of inhibitors targeting specific aspects of inflammation suggests that NLRP3 inflammasome can be used to treat diabetic cardiomyopathy. This paper aims to summarize NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy, and to provide new suggestions for the treatment of this disease.

La cardiomiopatía diabética es una complicación grave de la diabetes causada por estrés oxidativo, inflamación, resistencia a la insulina, fibrosis miocárdica y lipotoxicidad. Se trata de un padecimiento insidioso, complejo y difícil de tratar. El inflamasoma NLRP3 desencadena la maduración y liberación de citoquinas proinflamatorias, participa en procesos fisiopatológicos como la resistencia a la insulina y la fibrosis miocárdica, además de estar estrechamente relacionado con la aparición y progresión de la cardiomiopatía diabética. El desarrollo de inhibidores dirigidos a aspectos específicos de la inflamación sugiere que el inflamasoma NLRP3 puede utilizarse para tratar la cardiomiopatía diabética. Este artículo pretende resumir el mecanismo y las dianas terapéuticas del inflamasoma NLRP3 en la cardiomiopatía diabética, así como aportar nuevas sugerencias para el tratamiento de esta enfermedad.

Mecanismos y dianas terapéuticas del inflamasoma NLRP3 en la miocardiopatía diabética / NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy

Resumen La cardiomiopatía diabética es una complicación grave de la diabetes causada por estrés oxidativo, inflamación, resistencia a la insulina, fibrosis miocárdica y lipotoxicidad. Se trata de un padecimiento insidioso, complejo y difícil de tratar. El inflamasoma NLRP3 desencadena la maduración y liberación de citoquinas proinflamatorias, participa en procesos fisiopatológicos como la resistencia a la insulina y la fibrosis miocárdica, además de estar estrechamente relacionado con la aparición y progresión de la cardiomiopatía diabética. El desarrollo de inhibidores dirigidos a aspectos específicos de la inflamación sugiere que el inflamasoma NLRP3 puede utilizarse para tratar la cardiomiopatía diabética. Este artículo pretende resumir el mecanismo y las dianas terapéuticas del inflamasoma NLRP3 en la cardiomiopatía diabética, así como aportar nuevas sugerencias para el tratamiento de esta enfermedad.

Abstract Diabetic cardiomyopathy (DCM) is a serious complication of diabetes caused by oxidative stress, inflammation, insulin resistance, myocardial fibrosis, and lipotoxicity; its nature is insidious, complex and difficult to treat. NLRP3 inflammasome triggers the maturation and release of pro-inflammatory cytokines, participates in pathophysiological processes such as insulin resistance and myocardial fibrosis, in addition to being closely related to the development and progression of diabetic cardiomyopathy. The development of inhibitors targeting specific aspects of inflammation suggests that NLRP3 inflammasome can be used to treat diabetic cardiomyopathy. This paper aims to summarize NLRP3 inflammasome mechanism and therapeutic targets in diabetic cardiomyopathy, and to provide new suggestions for the treatment of this disease.

Comparative study of characteristic compounds of three species of truffle.

The Panxi area in Sichuan Province is the main area for the production of truffles in China, and several species of truffle are known to exist in this region. Nevertheless, it is unclear what the differences in chemical composition between the truffles are. Using an ultra-high-performance liquid chromatography quadrupole/orbitrap high-resolution mass spectrometry coupled with Compound Discoverer 3.0, we identified chemical components in three mainly known truffles from the Panxi region. Further analysis of chemical composition differences was conducted using principal component analysis, and orthogonal partial least squares discriminant analysis. Note that, 78.9% of the variance was uncovered by the principal component analysis model. As a result of the orthogonal partial least squares discriminant analysis model, the three species of truffles (Tuber pesudohimalayense, Tuber indicum, and Tuber sinense) from Panxi were better discriminated, with R2 X, R2 Y, and Q2 being 0.821, 0.993, and 0.947, respectively. In this study, 87 components were identified. T. pesudohimalayense contained significantly higher levels of nine different compounds than the other two species. Hence, it was possible to identify similarities and differences between three species of truffles from Panxi in terms of chemical composition. This can be used as a basis for quality control.

Selective PPARγ modulator diosmin improves insulin sensitivity and promotes browning of white fat.

Peroxisome proliferator-activated receptor γ (PPARγ) is a master regulator of adipocyte differentiation, glucolipid metabolism, and inflammation. Thiazolidinediones are PPARγ full agonists with potent insulin-sensitizing effects, whereas their oral usage is restricted because of unwanted side effects, including obesity and cardiovascular risks. Here, via virtual screening, microscale thermophoresis analysis, and molecular confirmation, we demonstrate that diosmin, a natural compound of wide and long-term clinical use, is a selective PPARγ modulator that binds to PPARγ and blocks PPARγ phosphorylation with weak transcriptional activity. Local diosmin administration in subcutaneous fat (inguinal white adipose tissue [iWAT]) improved insulin sensitivity and attenuated obesity via enhancing browning of white fat and energy expenditure. Besides, diosmin ameliorated inflammation in WAT and liver and reduced hepatic steatosis. Of note, we determined that iWAT local administration of diosmin did not exhibit obvious side effects. Taken together, the present study demonstrated that iWAT local delivery of diosmin protected mice from diet-induced insulin resistance, obesity, and fatty liver by blocking PPARγ phosphorylation, without apparent side effects, making it a potential therapeutic agent for the treatment of metabolic diseases.

Redox Biology in Adipose Tissue Physiology and Obesity.

Reactive oxygen species (ROS), a by-product of mitochondrial oxidative phosphorylation and cellular metabolism, is vital for cellular survival, proliferation, damage, and senescence. In recent years, studies have shown that ROS levels and redox status in adipose tissue are strongly associated with obesity and metabolic diseases. Although it was previously considered that excessive production of ROS and impairment of antioxidant capability leads to oxidative stress and potentially contributes to increased adiposity, it has become increasingly evident that an adequate amount of ROS is vital for adipocyte differentiation and thermogenesis. In this review, by providing a systematic overview of the recent understanding of the key factors of redox systems, endogenous mechanisms for redox homeostasis, advanced techniques for dynamic redox monitoring, as well as exogenous stimuli for redox production in adipose tissues and obesity, the importance of redox biology in metabolic health is emphasized.

Two previously undescribed phthalides from Talaromyces amestolkiae, a symbiotic fungus of Syngnathus acus.

Amestolkins A (1) and B (2), two previously undescribed phthalides sharing the same planar structure of (1, 5-dihydroxyhexyl)-7-hydroxyisobenzofuran-1(3H)-one were isolated from Talaromyces amestolkiae. Their absolute configurations were elucidated by comprehensive analyses of spectroscopic evidences in high-resolution electrospray mass spectra (HRESIMS) and nuclear magnetic resonance (NMR) combined with electronic circular dichroism (ECD) and NMR calculations. 1 and 2 showed anti-neuroinflammatory activity by inhibiting the gene expressions of proinflammatory factors including C-C motif chemokine ligand 2 (CCL-2), tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6), as well as attenuating the excretion of inducible nitric oxide synthase (iNOS) in BV-2 microglial cells at the concentration of 30 µM.

Trichodimerol inhibits inflammation through suppression of the nuclear transcription factor-kappaB/NOD-like receptor thermal protein domain associated protein 3 signaling pathway.

Excessive inflammation causes chronic diseases and tissue damage. Although there has been drug treatment, its side effects are relatively large. Searching for effective anti-inflammatory drugs from natural products has become the focus of attention. First isolated from Trichoderma longibraciatum, trichodimerol is a natural product with TNF inhibition. In this study, lipopolysaccharide (LPS)-induced RAW264.7 macrophages were used as a model to investigate the anti-inflammatory activity of trichodimerol. The results of nitric oxide (NO) detection, enzyme-linked immunosorbent assay (ELISA), and reactive oxygen species (ROS) showed that trichodimerol could reduce the production of NO, ROS, and the proinflammatory cytokines interleukin (IL)-6 and tumor necrosis factor (TNF)-α. Western blotting results showed that trichodimerol could inhibit the production of inflammatory mediators such as cyclooxygenase (COX)-2 and inducible nitric oxide synthase (iNOS) and the protein expression of nuclear transcription factor-kappaB (NF-κB), p-IKK, p-IκB, Toll-like receptor 4 (TLR4), NOD-like receptor thermal protein domain associated protein 3 (NLRP3), cysteinyl aspartate specific proteinase (Caspase)-1, and ASC, which indicated that trichodimerol may inhibit inflammation through the NF-κB and NLRP3 pathways. At the same time, molecular docking showed that trichodimerol can directly combine with the TLR4-MD2 complex. Hence, trichodimerol inhibits inflammation by obstructing the interaction between LPS and the TLR4-MD2 heterodimer and suppressing the downstream NF-κB and NLRP3 pathways.

Iron-N-heterocyclic carbene complexes as efficient electrocatalysts for water oxidation under acidic conditions.

The development of stable, Earth-abundant, and high-activity molecular water oxidation catalysts under acidic and neutral conditions remains a great challenge. Here, the use of N-heterocyclic carbene (NHC)-based iron(III) complex 1 {[phenyl(tris(3-methylimidazol-1-ylidene))borate]2Fe(III)}+ as a catalyst for water oxidation under acidic and neutral conditions was investigated. Two iron(II) carbene complexes, 2 {[2,6-bis(3-methylimidazolium-1-yl)pyridine]2Fe}2+ and 3 {[2,6-bis(3-methylimidazolium-1-yl)pyridine-4-carboxylic acid]2Fe}2+, were also used for comparison. A series of experiments demonstrate that complex 1 has excellent performance in terms of both catalytic activity and stability. In addition, the faradaic efficiency and turnover frequency (TOF) reach 95.0% and 2.8 s-1, respectively. An overpotential of ca. 490 mV is obtained at pH 1.5. Density functional theory (DFT) calculations indicate that dehydrogenation is the potential-determining step (PDS) in water oxidation. Complex 1 has a lower free energy barrier in this process than 2 and 3. High-valent Fe species are further proven in 1 by spectroelectrochemical measurements, which are crucial in promoting water oxidation. This study is expected to contribute to the development of homogeneous water oxidation catalysis under acidic and neutral conditions.

Two Microsatellite Types Within NAD6 Gene Help to Distinguish Populations and Infer the Migratory Route of the Invasive Fall Armyworm, Spodoptera frugiperda, (Lepidoptera, Noctuidae) in China.

Spodoptera frugiperda is a major agricultural pest that has invaded China since January 2019. Given that most of the individuals present in China carried the diagnostic rice-strain mtDNA (COI-RS), there was no efficient method to distinguish populations of S. frugiperda. In this study, we identified and characterized two variant microsatellite alleles in the mitochondrial NAD6 gene of S. frugiperda retrieved from the National Center for Biotechnology Center GenBank. We then sequenced partial NAD6 genes containing the microsatellite region and the diagnostic COI barcoding gene (used to distinguish the corn-strain and the rice-strain) of 429 invasive S. frugiperda individuals that were collected from the main infested regions in China during 2019-2020. Our data indicates that two kinds of interrupted repeat sequences, (ATA)4T(ATA)3 and (ATA)5T(ATA)3, exist in the microsatellite region which we defined as the deletion type (NAD6-D), and the insertion type (NAD6-I) based on the repeat units' differentiation, respectively. The presence of these two microsatellite types in the mtDNA genome of S. frugiperda was further confirmed with the sequencing results in 429 samples. Moreover, NAD6-I and NAD6-D types were both present in individuals with COI-RS, while only NAD6-D type was detected in the COI-CS individuals. Interestingly, the two microsatellite types suggested a possible geographic distribution: the western migratory route (Yunan and Chongqing) was comprised exclusively of NAD6-I type, while both NAD6-I and NAD6-D types were identified in the predicted eastern migration trajectories (Hainan, Guangxi, Shandong, etc.). These results suggested that NAD6-D and NAD6-I types may be useful in distinguishing between populations, analyzing the evolutionary mechanism of mtDNA microsatellite polymorphism, inferring the migratory route of S. frugiperda in China, and developing precise and integrated control strategies for S. frugiperda.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Hydroanthraquinones from Nigrospora sphaerica and Their Anti-inflammatory Activity Uncovered by Transcriptome Analysis.

Transcriptome analysis is shown to be an effective strategy to understand the potential function of natural products. Here, it is reported that 11 previously undescribed hydroanthraquinones [nigroquinones A-K (1-11)], along with eight known congeners, were isolated from Nigrospora sphaerica. Their structures were elucidated by interpreting spectroscopic and spectrometric data including high-resolution mass spectra and nuclear magnetic resonance. The absolute configurations of 1-11 were confirmed by electronic circular dichroism calculations. Transcriptome analysis revealed that 3 (isolated in the largest amount) might be anti-inflammatory. Assays based on LPS-induced RAW264.7 macrophages and zebrafish embryos confirmed that some of the isolated hydroanthraquinones attenuated the secretion of pro-inflammatory mediators in vitro and in vivo. Further Western blotting and immunofluorescence experiments indicated that 4 (which showed the most obvious nitric oxide inhibition) could suppress the expression of nuclear factor-kappa-B (NF-κB), phosphorylation of the inhibitor of NF-κB kinase and inhibit the transportation of NF-κB to the nucleus. Hence, the suppression of the NF-κB signaling pathway may be responsible for the anti-inflammatory effect. These results show that bioactivity evaluation on the basis of transcriptome analysis may be effective in the functional exploration of natural products.