Optimizing and synchronizing Aedes aegypti colony for Sterile Insect Technique application: Egg hatching, larval development, and adult emergence rate.

Mosquito Sterile Insect Technique (SIT) programs can be developed in smaller agencies through synchronization of the colony development to take advantage of the natural male early emergence. This paper examined key aspects of Ae. aegypti colony synchronization work, including egg hatching, larval development, and adult emergence to produce sufficient numbers of adult male mosquitoes within a specific timeframe for irradiation and release. Our data indicated that a relatively low percentage of males are required for colony propagation. Additional results highlighted that fresher Ae. aegypti eggs could yield as high as a 93 % hatching success than older eggs when placed under vacuum pressure in yeast infused water for 1.5 h. Eggs that were one-month old hatched (93 %) better than older eggs (0-32 %). A higher egg density in the hatching flask was correlated to a lower hatch rate, and higher larval density was related to unsynchronized pupae and delayed adult emergence. By keeping Ae. aegypti larvae at reasonable density, over 95 % of adults emerged on the first two days of emergence - indicating a high synchronicity. A standardized colony maintenance protocol therefore renders a synchronized larval development and adult male emergence which are critical in SIT programs.

Clinical implications of airway obstruction with normal or low FEV1 in childhood and adolescence.

BACKGROUND: Airway obstruction is defined by spirometry as a low forced expiratory volume in 1 s (FEV1) to forced vital capacity (FVC) ratio. This impaired ratio may originate from a low FEV1 (classic) or a normal FEV1 in combination with a large FVC (dysanaptic). The clinical implications of dysanaptic obstruction during childhood and adolescence in the general population remain unclear. AIMS: To investigate the association between airway obstruction with a low or normal FEV1 in childhood and adolescence, and asthma, wheezing and bronchial hyperresponsiveness (BHR). METHODS: In the BAMSE (Barn/Child, Allergy, Milieu, Stockholm, Epidemiology; Sweden) and PIAMA (Prevention and Incidence of Asthma and Mite Allergy; the Netherlands) birth cohorts, obstruction (FEV1:FVC ratio less than the lower limit of normal, LLN) at ages 8, 12 (PIAMA only) or 16 years was classified as classic (FEV1

Accuracy and User Acceptability of 24-hour Ambulatory Blood Pressure Monitoring by a Prototype Cuffless Multi-Sensor Device Compared to a Conventional Oscillometric Device.

OBJECTIVE: 24-hour ambulatory blood pressure monitoring (24ABPM) is state of the art in out-of-office blood pressure (BP) monitoring. Due to discomfort and technical limitations related to cuff-based 24ABPM devices, methods for non-invasive and continuous estimation of BP without the need for a cuff have gained interest. The main aims of the present study were to compare accuracy of a pulse arrival time (PAT) based BP-model and user acceptability of a prototype cuffless multi-sensor device (cuffless device), developed by Aidee Health AS, with a conventional cuff-based oscillometric device (ReferenceBP) during 24ABPM. METHODS: Ninety-five normotensive and hypertensive adults underwent simultaneous 24ABPM with the cuffless device on the chest and a conventional cuff-based oscillometric device on the non-dominant arm. PAT was calculated using the electrocardiogram (ECG) and photoplethysmography (PPG) sensors incorporated in the chest-worn device. The cuffless device recorded continuously, while ReferenceBP measurements were taken every 20 minutes during daytime and every 30 minutes during nighttime. Two-minute PAT-based BP predictions corresponding to the ReferenceBP measurements were compared with ReferenceBP measurements using paired t-tests, bias, and limits of agreement. RESULTS: Mean (SD) of ReferenceBP compared to PAT-based daytime and nighttime systolic BP (SBP) were 129.7 (13.8) mmHg versus 133.6 (20.9) mmHg and 113.1 (16.5) mmHg versus 131.9 (23.4) mmHg. Ninety-five % limits of agreements were [-26.7, 34.6 mmHg] and [-20.9, 58.4 mmHg] for daytime and nighttime SBP respectively. The cuffless device was reported to be significantly more comfortable and less disturbing than the ReferenceBP device during 24ABPM. CONCLUSIONS: In the present study, we demonstrated that a general PAT-based BP model had unsatisfactory agreement with ambulatory BP during 24ABPM, especially during nighttime. If sufficient accuracy can be achieved, cuffless BP devices have promising potential for clinical assessment of BP due to the opportunities provided by continuous BP measurements during real-life conditions and high user acceptability.

What is the context?Hypertension is a major risk factor for cardiovascular and cerebrovascular end-organ damage, morbidity, and mortality world-wide.Accurate measurement of blood pressure is essential for the diagnosis and management of hypertension.What is new?Cuffless blood pressure devices that allow measurement of blood pressure without a pressure cuff is a promising and novel method of blood pressure estimation.The objective of this study is to assess whether pulse arrival time alone can be used to estimate blood pressure accurately during 24-hour ambulatory blood pressure monitoring, using a prototype cuffless device placed on the chest.Our analysis shows that a general model based on pulse arrival time overestimated ambulatory blood pressure, especially during nighttime.User acceptability was higher with the cuffless device compared to a conventional cuff-based oscillometric device during 24-hour ambulatory blood pressure monitoring.What is the impact?This study provides further evidence that accurate blood pressure estimations cannot be achieved by using pulse arrival time alone as a surrogate for blood pressure measurements.

Platelet-derived extracellular vesicles formulated with hyaluronic acid gels for application at the bone-implant interface: An animal study.

Background/Objective: Platelet derived extracellular vesicles (pEV) are promising therapeutical tools for bone healing applications. In fact, several in vitro studies have already demonstrated the efficacy of Extracellular Vesicles (EV) in promoting bone regeneration and repair in various orthopedic models. Therefore, to evaluate the translational potential in this field, an in vivo study was performed. Methods: Here, we used hyaluronic acid (HA) gels formulated with pEVs, as a way to directly apply pEVs and retain them at the bone defect. In this study, pEVs were isolated from Platelet Lysate (PL) through size exclusion chromatography and used to formulate 2% HA gels. Then, the gels were locally applied on the tibia cortical bone defect of New Zeland White rabbits before the surgical implantation of coin-shaped titanium implants. After eight weeks, the bone healing process was analyzed through biomechanical, micro-CT, histological and biochemical analysis. Results: Although no biomechanical differences were observed between pEV formulated gels and non-formulated gels, biochemical markers of the wound fluid at the interface presented a decrease in Lactate dehydrogenase (LDH) activity and alkaline phosphatase (ALP) activity for pEV HA treated implants. Moreover, histological analyses showed that none of the treatments induced an irritative effect and, a decrease in the fibrotic response surrounding the implant for pEV HA treated implants was described. Conclusion: In conclusion, pEVs improve titanium implants biocompatibility at the bone-implant interface, decreasing the necrotic effects of the surgery and diminishing the fibrotic layer associated to the implant encapsulation that can lead to implant failure.

First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa.

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

Plasticity of Individual Lung Function States from Childhood to Adulthood.

Rationale: Recent evidence highlights the importance of optimal lung development during childhood for health throughout life. Objectives: To explore the plasticity of individual lung function states during childhood. Methods: Prebronchodilator FEV1 z-scores determined at age 8, 16, and 24 years in the Swedish population-based birth cohort BAMSE (Swedish abbreviation for Child [Barn], Allergy, Milieu, Stockholm, Epidemiological study) (N = 3,069) were used. An unbiased, data-driven dependent mixture model was applied to explore lung function states and individual state chains. Lung function catch-up was defined as participants moving from low or very low states to normal or high or very high states, and growth failure as moving from normal or high or very high states to low or very low states. At 24 years, we compared respiratory symptoms, small airway function (multiple-breath washout), and circulating inflammatory protein levels, by using proteomics, across states. Models were replicated in the independent Dutch population-based PIAMA (Prevention and Incidence of Asthma and Mite Allergy) cohort. Measurements and Main Results: Five lung function states were identified in BAMSE. Lung function catch-up and growth failure were observed in 74 (14.5%) BAMSE participants with low or very low states and 36 (2.4%) participants with normal or high or very high states, respectively. The occurrence of catch-up and growth failure was replicated in PIAMA. Early-life risk factors were cumulatively associated with the very low state, as well as with catch-up (inverse association) and growth failure. The very low state as well as growth failure were associated with respiratory symptoms, airflow limitation, and small airway dysfunction at adulthood. Proteomics identified IL-6 and CXCL10 (C-X-C motif chemokine 10) as potential biomarkers of impaired lung function development. Conclusions: Individual lung function states during childhood are plastic, including catch-up and growth failure.

First report of the plum marbling disease associated agent, plum viroid I, in apricots (Prunus armeniaca) in South Africa.

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

Predicting the course of asthma from childhood until early adulthood.

PURPOSE OF REVIEW: To communicate recent insights about the natural history of childhood asthma, with a focus on prediction of persistence and remission of childhood asthma, up to early adulthood. RECENT FINDINGS: Lung function around the age of 8-9 years is the strongest predictor: obstructive lung function predicts asthma persistence up to early adulthood, whereas normal lung function predicts remission. The ability to predict asthma remission improves when lung function is combined with blood eosinophil levels and degree of bronchial hyperresponsiveness. Interventions, such as inhaled corticosteroids and immunotherapy do not appear to alter the course of asthma. Epigenetic studies have revealed potential novel biomarkers of asthma remission, such as micro-RNA patterns in blood. Specifically, lower serum levels of mi-R221-5p, which is associated with lower IL-6 release and eosinophilic inflammation, predict remission. Higher levels of blood DNA-methylation of a CpG site in Peroxisomal Biogenesis Factor 11 Beta were associated with asthma remission. SUMMARY: Lung function, allergic comorbidity and polysensitization in childhood predict the course of asthma. Recent epigenetic studies have provided a better understanding of underlying pathological processes in asthma remission, which may be used to improve prediction or develop novel treatments aimed at altering the course of asthma.

Differences in Correlation between Subjective and Measured Olfactory and Gustatory Dysfunctions after Initial Ear, Nose and Throat Evaluation.

Introduction Subjective chemosensory function can differ from measured function. Previous studies on olfactory assessment have found a positive correlation between subjective and measured scores. However, information on gustatory correlation between measured and subjective functions is sparse in patients who have undergone an initial ear, nose and throat (ENT) evaluation. Objectives To evaluate the correlation between subjective and measured olfactory and gustatory dysfunctions in a population complaining of taste and/or smell dysfunction after an initial ENT evaluation without chemosensory testing. Furthermore, we aimed to assess the need for chemosensory testing depending on the type of subjective chemosensory dysfunction. Methods A case series in which subjective chemosensory function was assessed through a questionnaire and measured chemosensory function was assessed by validated clinical tests. Results In total, 602 patients with complaints of olfactory and/or gustatory dysfunction were included. We found that 50% of the patients with normal gustatory function and an olfactory impairment classified their olfactory impairment as a subjective taste disorder. Furthermore, 98% of the patients who rated their olfactory function as absent did have a measurable olfactory impairment, but only 64% were anosmic. Conclusion Subjective gustatory dysfunction was poorly correlated with measured gustatory dysfunction, and was often found to reflect olfactory dysfunction. Contrarily, subjective olfactory dysfunction was positively correlated with measurable olfactory dysfunction. Although subjective anosmia was a strong indicator of measured anosmia or hyposmia, the existence of remaining olfactory function was frequently found in these patients. Validated chemosensory testing should be performed in patients with perceived olfactory or gustatory deficits, as this could help ensure increased diagnostic precision and a relevant treatment.

Impact of simultaneous placement of implant and block bone graft substitute: an in vivo peri-implant defect model.

BACKGROUND: Insufficient bone volume around an implant is a common obstacle when dental implant treatment is considered. Limited vertical or horizontal bone dimensions may lead to exposed implant threads following placement or a gap between the bone and implant. This is often addressed by bone augmentation procedures prior to or at the time of implant placement. This study evaluated bone healing when a synthetic TiO2 block scaffold was placed in circumferential peri-implant defects with buccal fenestrations. METHODS: The mandibular premolars were extracted and the alveolar bone left to heal for 4 weeks prior to implant placement in six minipigs. Two cylindrical defects were created in each hemi-mandible and were subsequent to implant placement allocated to treatment with either TiO2 scaffold or sham in a split mouth design. After 12 weeks of healing time, the samples were harvested. Microcomputed tomography (MicroCT) was used to investigate defect fill and integrity of the block scaffold. Distances from implant to bone in vertical and horizontal directions, percentage of bone to implant contact and defect fill were analysed by histology. RESULTS: MicroCT analysis demonstrated no differences between the groups for defect fill. Three of twelve scaffolds were partly fractured. At the buccal sites, histomorphometric analysis demonstrated higher bone fraction, higher percentage bone to implant contact and shorter distance from implant top to bone 0.5 mm lateral to implant surface in sham group as compared to the TiO2 group. CONCLUSIONS: This study demonstrated less bone formation with the use of TiO2 scaffold block in combination with implant placement in cylindrical defects with buccal bone fenestrations, as compared to sham sites.

Ecological basis and genetic architecture of crypsis polymorphism in the desert clicker grasshopper (Ligurotettix coquilletti).

Color polymorphic species can offer exceptional insight into the ecology and genetics of adaptation. Although the genetic architecture of animal coloration is diverse, many color polymorphisms are associated with large structural variants and maintained by biotic interactions. Grasshoppers are notably polymorphic in both color and karyotype, which makes them excellent models for understanding the ecological drivers and genetic underpinnings of color variation. Banded and uniform morphs of the desert clicker grasshopper (Ligurotettix coquilletti) are found across the western deserts of North America. To address the hypothesis that predation maintains local color polymorphism and shapes regional crypsis variation, we surveyed morph frequencies and tested for covariation with two predation environments. Morphs coexisted at intermediate frequencies at most sites, consistent with local balancing selection. Morph frequencies covaried with the appearance of desert substrate-an environment used only by females-suggesting that ground-foraging predators are major agents of selection on crypsis. We next addressed the hypothesized link between morph variation and genome structure. To do so, we designed an approach for detecting inversions and indels using only RADseq data. The banded morph was perfectly correlated with a large putative indel. Remarkably, indel dominance differed among populations, a rare example of dominance evolution in nature.

Pre-cementation procedures' effect on dental zirconias with different yttria content.

OBJECTVE: Several pre-cementation procedures have been advocated to enhance adhesion between zirconia and resin-based cement. There is, however, limited documentation on how these pre-treatments affect the strength of zirconia crowns as most tests are performed on discs or bars. The aim was to assess the effect of pre-cementation procedures on fracture mode, fracture strength and cement retention on zirconia. METHODS: Two dental zirconia materials with different yttria content were assessed (<4 and>5 mol%). Both discs (n = 45) and crown-shaped specimens (n = 30) of the two materials were pretreated with either air-abrasion or hot-etching with KHF2 and compared with untreated controls with regards to surface roughness, crystallography, wettability, cement adhesion and fracture strength. RESULTS AND SIGNIFICANCE: Air-abrasion improves adhesion and strength of zirconia with moderate yttria content (<4 mol%). Acid etching with heated KHF2 showed the best effect on strength and cement retention on zirconia with higher yttria content (>5 mol%). Application of KHF2 was, however, complicated on crown-shaped specimens. Pre-treatment and cementation protocols should be optimized for different dental zirconias to improve both strength and retention.

The influence of the resin-based cement layer on ceramic-dentin bond strength.

The purpose of the study was to measure the cement thickness obtained when ceramic rods were luted to dentin and to analyze the relation between cement thickness and the previously published tensile bond strength of similar test specimens. In addition, the ISO standard 4049:2019 method was used to determine the film thickness of the used cements. Zirconia (n = 100) and lithium disilicate (n = 50) rods were cemented to bovine dentin using one of five different resin-based cements. The ceramic-dentin test specimens were cut into two slices and the cement thickness was measured using a scanning electron microscope and compared to the bond strength values of similar specimens already published. The mean cement thickness recorded for ceramic rods cemented to dentin was in the range 20-40 µm, which was larger than the cement film thickness found by the ISO method. The cement film thickness determined according to ISO standard methods did not concur with the results obtained when cementing ceramic rods to dentin. For cementing ceramic restorations, a cement thickness in the range 25-35 µm seems to be favorable for the bond strength.

Asthma, bronchial hyperresponsiveness, allergy and lung function development until early adulthood: A systematic literature review.

BACKGROUND: It is unclear in which periods of life lung function deficits develop, and whether these are affected by risk factors such as asthma, bronchial hyper-responsiveness (BHR) and allergic comorbidity. The goal of this systematic review was to identify temporal associations of asthma, BHR and allergic comorbidity with large and small lung function development from birth until peak function in early adulthood. METHODS: We searched MEDLINE, EMBASE, Web of Science and CINAHL for papers published before 01.01.2020 on risk factors and lung function measurements of large and small airways. Studies were required to report lung function at any time point or interval from birth until peak lung function (age 21-26) and include at least one candidate risk factor. RESULTS: Of the 45 papers identified, 44 investigated cohorts and one was a clinical trial with follow-up. Asthma, wheezing, BHR and allergic sensitization early in life and to multiple allergens were associated with a lower lung function growth of large and small airways during early childhood compared with the control populations. Lung function development after childhood in subjects with asthma or persistent wheeze, although continuing to grow at a lower level, largely tracked parallel to non-affected individuals until peak function was attained. CLINICAL IMPLICATIONS AND FUTURE RESEARCH: Deficits in lung function growth develop in early childhood, and children with asthma, BHR and early-life IgE (poly)sensitization are at risk. This period is possibly a critical window of opportunity to identify at-risk subjects and provide treatment aimed at preventing long-term sequelae of lung function.

Blood eosinophils associate with reduced lung function growth in adolescent asthmatics.

BACKGROUND AND OBJECTIVE: Some children with asthma have low lung growth, putting them at increased risk for COPD later in life. However, it is currently not clear who will experience this adverse growth pattern. We therefore investigated the predictive role of blood eosinophils as a type 2 inflammation marker in lung growth, focusing on the presence and severity of asthma. METHODS: We investigated blood eosinophils and lung function growth (percentage of predicted values) using linear mixed models in children and adolescents from two longitudinal cohorts. One cohort was hospital-based and consisted of asthmatic children at their first outpatient clinic visit after referral by the general practitioner (n = 133, mean age 9.8), while the second was a general population-based birth cohort (PIAMA, asthma n = 52 and non-asthma n = 433, mean age 8.1). The hospital-based cohort had not been treated with inhaled corticosteroids (ICS) before referral. RESULTS: Subjects in the hospital-based asthma cohort had more severe asthma compared with the asthmatic subjects in the population-based cohort, defined by lower lung function levels and a higher prevalence of bronchial hyper-responsiveness. In the asthma cohort, higher blood eosinophil numbers were associated with less growth in FEV1 (estimated change in lung function per 1 unit increase in ln blood eosinophils (B): -0.66%/year (95% confidence interval (CI): -1.11 to -0.20, p < .01)) and FVC (B: -0.40%/year (95% CI: -0.75 to -0.05), p = .025)) during follow-up in adolescence (min 7, max 17 years). These associations were not observed in the general population-based birth cohort, regardless of asthma status during follow-up (age 8-16). CONCLUSIONS AND CLINICAL RELEVANCE: Blood eosinophil counts in children with asthma not treated with ICS at referral were predictive of lower growth in FEV1 and FVC during follow-up in adolescence. Our findings indicate that this association is dependent on the degree of asthma severity. Future studies should address whether anti-eosinophilic treatments preserve lung function growth in children with asthma.

First report of 'Candidatus Liberibacter africanus' associated with African Greening of Citrus in Angola.

Huanglongbing (HLB, Asian Citrus Greening), the most devastating disease of citrus has not been detected in southern Africa (Gottwald, 2010). HLB is associated with 'Candidatus Liberibacter asiaticus' (CLas), a phloem-limited bacterium vectored by Diaphorina citri Kuwayama (Hemiptera: Liviidae), the Asian Citrus Psyllid (ACP). African Citrus Greening, associated with 'Candidatus Liberibacter africanus' (CLaf) and its vector the African Citrus Triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae), are endemic to Africa, although not previously reported from Angola. African Greening is less severe than HLB, largely due to heat sensitivity of CLaf and its vector. Introduction of HLB into southern Africa would be devastating to citrus production in commercial and informal sectors. Concern was raised that CLas or ACP might hae inadvertently been introduced into Angola. In July 2019, a survey was conducted in two citrus nurseries in Luanda and Caxito and in different orchards on 7 farms surrounding Calulo and Quibala. Yellow sticky traps for insects were placed at the various localities and collected after c. 3 weeks. Breeding signs of T. erytreae (pit galls) were observed on citrus in some locations, but no insect vectors were detected on traps. Trees were inspected for signs and symptoms of citrus pests and diseases, particularly those that resemble HLB (foliar blotchy mottle, shoot chlorosis, vein yellowing and corking, lopsided fruit with aborted seeds and colour inversion) and its vectors (pit galls on leaves or waxy exudates). Leaves and shoots with suspect symptoms were sampled for laboratory analysis (43 samples). DNA was extracted from petiole and midrib tissue of leaves using a modified CTAB extraction protocol of Doyle and Doyle (1990). Real-time PCR was done using universal Liberibacter primers of Roberts et al. (2015), CLaf specific primers of Li et al. (2006) and CLas specific primers of Bao et al. (2019). All real-time PCR protocols indicated the presence of CLaf in 6 samples (Tab. S1). CLas or other citrus Liberibacter species were not detected. The presence of CLaf in sample 37 was confirmed by constructing a library (NEXTFLEX® DNA Sequencing Kit, PerkinElmer) with extracted DNA and performing high-throughput sequencing on an Ion Torrent™ S5™ platform (Central Analytical Facility, Stellenbosch University). To improve the quality of the reads, all 233,617,700 obtained reads were trimmed from the 3' end to a maximum length of 240 nt using Trimmomatic (Bolger et al. 2014). The high quality reads were mapped to the Citrus sinensis reference genome (NC_023046.1) using Bowtie 2.3.4 (Langmead and Salzberg 2012) to subtract all the reads that had high identity to the host plant (number of mismatches allowed in the seed was set to 1). The 14,691,369 unmapped reads (6.2% of original data) were mapped to the CLaf reference genome NZ_CP004021.1 using CLC Genomics Workbench 10.1.1 (Qiagen) (Length fraction = 0.8; Similarity fraction = 0.9). A CLaf consensus genome was generated that spanned 99.7% of the reference genome and the 163001 mapped reads had a 22.9 mean read coverage. The consensus sequence was 99.7% identical to NZ_CP004021.1 and was submitted to Genbank as accession: CP054879. The positive CLaf detections were from trees with typical HLB or African Citrus Greening symptoms, viz. lopsided fruit with green stylar ends, aborted seed and stained columella at base of fruit button; yellow shoots with leaves showing symptoms of blotchy mottle and vein yellowing and corking (Fig. S1) in a commercial citrus farm outside Calulo and included 2 'Ponkan' mandarin (C. reticulata), 2 Valencia and 1 'Navelina' tree (C. sinensis), and a citrus nursery in Luanda (1 lime tree; C. aurantifolia) (Tab. S1). This first report of CLaf in Angola highlights the need to prevent spread by removing infected trees and managing the insect vector, as well as the need for further surveys to determine the occurrence of African Greening and its vectors in other provinces and to confirm the absence of exotic citrus pests and diseases. References Bao, M. et al. 2020. Plant Dis. 104:527 Bolger, A. M. et al. 2014. Bioinformatics. 30:2114-2120. Doyle, J.J. and Doyle, J.L. 1990. Focus 12:13 Gottwald, T.R. 2010. Annu. Rev. Phytopathol. 48:119 Langmead, B. and Salzberg, S. 2012. Nature Methods. 9:357-359. Li, W. et al. 2006. Jnl. Microbiol. Methods 66:104 Roberts, R. et al. 2015. Int. J. Syst. Evol. Micr. 65:723.

Discrepancy in alloy composition of imported and non-imported porcelain-fused-to-metal (PFM) crowns produced by Norwegian dental laboratories.

Purpose: Even though the use of full ceramic crowns have become a well-established practice in dental clinics compare to the last decade, the use of imported casted porcelain-fused-to-metal (PFMs) crowns is still prevalent. The use of imported PFMs is often economically driven; however, when dentists order PFMs, they do not have capabilities to examine its true alloy content. Therefore, we raise the questions whether cheaper imported PFMs have more discrepancies in alloy content compared to domestically produced PFMs? Materials and Methods: This study included 62 porcelain-fused-to-metal crowns: 41 produced in Norway and 21 imported. Their alloy-composition was determined non-destructively by EDX and SEM. Results and Conclusions: Imported PFMs demonstrated larger deviations compared with non-imported PFMs. Significant deviation was found in key metallic elements in the different alloys (W, In, Pd, Ag). The detected deviations in key element such as Wolfram and Indium could influence the PFMs service time. These finding may be of international concern.

Restoring drifted electron microscope volumes using synaptic vesicles at sub-pixel accuracy.

Imaging ultrastructures in cells using Focused Ion Beam Scanning Electron Microscope (FIB-SEM) yields section-by-section images at nano-resolution. Unfortunately, we observe that FIB-SEM often introduces sub-pixel drifts between sections, in the order of 2.5 nm. The accumulation of these drifts significantly skews distance measures and geometric structures, which standard image registration techniques fail to correct. We demonstrate that registration techniques based on mutual information and sum-of-squared-distances significantly underestimate the drift since they are agnostic to image content. For neuronal data at nano-resolution, we discovered that vesicles serve as a statistically simple geometric structure, making them well-suited for estimating the drift with sub-pixel accuracy. Here, we develop a statistical model of vesicle shapes for drift correction, demonstrate its superiority, and provide a self-contained freely available application for estimating and correcting drifted datasets with vesicles.

Bioinformatic Tools and Genome Analysis of Citrus tristeza virus.

High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis.

Comparison of postoperative intraoral scan versus cone beam computerised tomography to measure accuracy of guided implant placement-A prospective clinical study.

OBJECTIVE: To evaluate the accuracy of implant placement with a digitally planned guided implant procedure. Two methods for identifying the actual postoperative positioning of the implants were compared: CBCT and IO scanning. MATERIAL AND METHODS: Twenty-eight implants with a sandblasted and acid-etched surface were placed in thirteen patients using tooth-supported surgical guides following a digital planning procedure. The implants were submerged for 12-15 weeks. New CBCT images were taken for identification of the implant position. After second stage surgery, scan bodies were mounted on the implants and scanned with an IO digital scanner. The recordings from the CBCT images and the IO scans were compared with respect to the identified positions of the implants. RESULTS: The study did not resolve any significant differences of the identified positioning of the implants as measured by CBCT or IO, except for the apical deviations at the coronal and apical points. The angular difference between CBCT and IO scanning at the coronal point was -0.011 (±0.6) degrees, whereas the 3D deviation was 0.03(±0.17) mm. The distal deviation between CBCT and IO scanning was 0.01(± 0.16) mm, and the vestibular deviation 0.033(± 0.16) mm and the apical deviation difference was 0.09(± 0.16) mm. The 3D deviation at the apical point was 0.04(± 0.22) mm. The distal deviation between CBCT and IO scanning was 0.06(± 0.19) mm, and the vestibular deviation 0.032(± 0.23) mm and the apical deviation difference was 0.09(± 0. 16) mm. CONCLUSION: The study demonstrated that accuracy measurements using IO scanning yields comparable results to those obtained by CBCT.