Cytosolic DNA sensors activation of human astrocytes inhibits herpes simplex virus through IRF1 induction.

Introduction: While astrocytes participate in the CNS innate immunity against herpes simplex virus type 1 (HSV-1) infection, they are the major target for the virus. Therefore, it is of importance to understand the interplay between the astrocyte-mediated immunity and HSV-1 infection. Methods: Both primary human astrocytes and the astrocyte line (U373) were used in this study. RT-qPCR and Western blot assay were used to measure IFNs, the antiviral IFN-stimulated genes (ISGs), IFN regulatory factors (IRFs) and HSV-1 DNA. IRF1 knockout or knockdown was performed with CRISPR/Cas9 and siRNA transfection techniques. Results: Poly(dA:dT) could inhibit HSV-1 replication and induce IFN-ß/IFN-λs production in human astrocytes. Poly(dA:dT) treatment of astrocytes also induced the expression of the antiviral ISGs (Viperin, ISG56 and MxA). Among IRFs members examined, poly(dA:dT) selectively unregulated IRF1 and IRF9, particularly IRF1 in human astrocytes. The inductive effects of poly(dA:dT) on IFNs and ISGs were diminished in the IRF1 knockout cells. In addition, IRF1 knockout attenuated poly(dA:dT)-mediated HSV-1 inhibition in the cells. Conclusion: The DNA sensors activation induces astrocyte intracellular innate immunity against HSV-1. Therefore, targeting the DNA sensors has potential for immune activation-based HSV-1 therapy.

Activation of Toll-like receptor 3 inhibits HIV infection of human iPSC-derived microglia.

As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.

Human iPSC-derived brain organoids: A 3D mini-brain model for studying HIV infection.

The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Cytosolic DNA sensor activation inhibits HIV infection of macrophages.

Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.

Comparison of BNT162b2-, mRNA-1273- and Ad26.COV2.S-Elicited IgG and Neutralizing Titers against SARS-CoV-2 and Its Variants.

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.

Methamphetamine facilitates HIV infection of primary human monocytes through inhibiting cellular viral restriction factors.

BACKGROUND: Methamphetamine (METH), a potent addictive psychostimulant, is highly prevalent in HIV-infected individuals. Clinically, METH use is implicated in alteration of immune system and increase of HIV spread/replication. Therefore, it is of importance to examine whether METH has direct effect on HIV infection of monocytes, the major target and reservoir cells for the virus. RESULTS: METH-treated monocytes were more susceptible to HIV infection as evidenced by increased levels of viral proteins (p24 and Pr55Gag) and expression of viral GAG gene. In addition, using HIV Bal with luciferase reporter gene (HIV Bal-eLuc), we showed that METH-treated cells expressed higher luciferase activities than untreated monocytes. Mechanistically, METH inhibited the expression of IFN-λ1, IRF7, STAT1, and the antiviral IFN-stimulated genes (ISGs: OAS2, GBP5, ISG56, Viperin and ISG15). In addition, METH down-regulated the expression of the HIV restriction microRNAs (miR-28, miR-29a, miR-125b, miR-146a, miR-155, miR-223, and miR-382). CONCLUSIONS: METH compromises the intracellular anti-HIV immunity and facilitates HIV replication in primary human monocytes.

TLR7 Activation of Macrophages by Imiquimod Inhibits HIV Infection through Modulation of Viral Entry Cellular Factors.

The Toll-like receptor (TLR) 7 is a viral sensor for detecting single-stranded ribonucleic acid (ssRNA), the activation of which can induce intracellular innate immunity against viral infections. Imiquimod, a synthetic ligand for TLR7, has been successfully used for the topical treatment of genital/perianal warts in immunocompetent individuals. We studied the effect of imiquimod on the human immunodeficiency virus (HIV) infection of primary human macrophages and demonstrated that the treatment of cells with imiquimod effectively inhibited infection with multiple strains (Bal, YU2, and Jago) of HIV. This anti-HIV activity of imiquimod was the most potent when macrophages were treated prior to infection. Infection of macrophages with pseudotyped HIV NL4-3-ΔEnv-eGFP-Bal showed that imiquimod could block the viral entry. Further mechanistic studies revealed that while imiquimod had little effect on the interferons (IFNs) expression, its treatment of macrophages resulted in the increased production of the CC chemokines (human macrophage inflammatory protein-1 alpha (MIP-1α), MIP-1ß, and upon activation regulated normal T cells expressed and secreted (RANTES)), the natural ligands of HIV entry co-receptor CCR5, and decreased the expression of CD4 and CCR5. The addition of the antibodies against the CC chemokines to macrophage cultures could block imiquimod-mediated HIV inhibition. These findings provide experimental evidence to support the notion that TLR7 participates in the intracellular immunity against HIV in macrophages, suggesting the further clinical evaluation of imiquimod for its additional benefit of treating genital/perianal warts in people infected with HIV.

Novel Scalable and Simplified System to Generate Microglia-Containing Cerebral Organoids From Human Induced Pluripotent Stem Cells.

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.

Exosomes Transport Anti-Human Immunodeficiency Virus Factors from Human Cervical Epithelial Cells to Macrophages.

The female reproductive tract (FRT) is a major site of HIV sexual transmission. As the outermost layer of cells in the FRT, the human cervical epithelial cells (HCEs) have direct contact with HIV or infected cells. Our early work showed that supernatant (SN) from TLR3-activated HCEs contain the antiviral factors that could potently inhibit HIV replication in macrophages. However, it remains to be determined how HCEs transport the anti-HIV factors to macrophages. This follow-up study examined the role of exosomes in HCE-mediated anti-HIV activity. We found that TLR3 activation of HCEs resulted in the release of exosomes that contained multiple IFN-stimulated genes (ISGs: ISG56, OAS1, MxA, and Mx2) and the HIV restriction microRNAs (miR-28, miR-29 family members, miR-125b, miR-150, miR-382, miR-223, miR-20a, and miR-198). The depletion of exosomes from SN of TLR3-activated HCEs diminished HCE-mediated anti-HIV activity in macrophages, indicating that HCE-derived exosomes are responsible for transporting the antiviral molecules to macrophages. These in vitro findings suggest a novel antiviral mechanism by which HCEs participate in the FRT innate immunity against HIV infection. Further in vivo studies are necessary in order to develop an exosome-based delivery system for prevention and treatment of HIV infection through sexual transmission.

CD4+ T cell depletion does not affect the level of viremia in chronically SHIVSF162P3N-infected Chinese cynomolgus monkeys.

Chronically SHIVSF162P3N-infected cynomolgus monkeys were used to determine the effects of the antibody-mediated acute CD4+ T cell depletion on viral load as well as on the immunological factors associated with disease progression. Compared with the control animals, CD4+ T cell-depleted animals with SHIV infection showed (i) little alteration in plasma viral load over the period of 22 weeks after the depletion; (ii) increased CD4+ T cell proliferation and turnover of macrophages at the early phase of the depletion, but subsequent decline to the basal levels; and (iii) little impact on the expression of the inflammatory cytokines and CC chemokines associated with disease progression. These findings indicate that the antibody-mediated acute CD4+ T cell depletion had minimal impact on plasma viral load and disease progression in chronically SHIVSF162P3N-infected cynomolgus monkeys. Future investigations are necessary to identify the key factor(s) related to the immune activation and macrophage infection during the CD4 deletion in chronic viral infection.

HIV infection suppresses TLR3 activation-mediated antiviral immunity in microglia and macrophages.

Monocytic-lineage cells in the central nervous system (CNS), including microglia and brain resident macrophages, are the key players in the CNS innate immunity against viral infections, including human immunodeficiency virus (HIV). However, these cells also serve as the major targets and reservoirs for HIV in the CNS. To address the question of how HIV can establish persistent infection in the target cells in the CNS, we examined whether HIV has the ability to counteract Toll-like receptor 3 (TLR3) activation-mediated antiviral immunity in microglia and macrophages. We observed that HIV latently infected microglial cells (HC69·5) expressed reduced levels of TLR3 and TLR3 activation-mediated interferons (IFN-α/ß and IFN-λ) as compared with the uninfected control cells (C20). In addition, HIV infection of primary human macrophages suppressed the expression of TLR3 and the IFNs. HIV infection also inhibited the expression of the antiviral IFN-stimulated genes (ISGs) and the HIV-restriction miRNAs. Mechanistically, HIV infection inhibited the phosphorylation of IFN regulatory factors (IRF3 and IRF7) and signal transducer and activator of transcription proteins (STAT1 and STAT3) in both HIV latently infected microglia and acutely infected macrophages. These findings provide previously unrecognized and sound mechanisms for HIV infection and persistence in the primary target and reservoir cells in the brain.

Poly(dA:dT) Suppresses HSV-2 Infection of Human Cervical Epithelial Cells Through RIG-I Activation.

Epithelial cells of the female reproductive tract (FRT) participate in the initial innate immunity against viral infections. Poly(dA:dT) is a synthetic analog of B form double-stranded (ds) DNA which can activate the interferon (IFN) signaling pathway-mediated antiviral immunity through DNA-dependent RNA Polymerase III. Here we investigated whether poly(dA:dT) could inhibit herpes simplex virus type 2 (HSV-2) infection of human cervical epithelial cells (End1/E6E7). We demonstrated that poly(dA:dT) treatment of End1/E6E7 cells could significantly inhibit HSV-2 infection. Mechanistically, poly(dA:dT) treatment of the cells induced the expression of the intracellular IFNs and the multiple antiviral IFN-stimulated genes (ISGs), including IFN-stimulated gene 15 (ISG15), IFN-stimulated gene 56 (ISG56), 2'-5'-oligoadenylate synthetase 1 (OAS1), 2'-5'-oligoadenylate synthetase 2 (OAS2), myxovirus resistance protein A (MxA), myxovirus resistance protein B (MxB), virus inhibitory protein, endoplasmic reticulum-associated, IFN-inducible (Viperin), and guanylate binding protein 5 (GBP5). Further investigation showed that the activation of RIG-I was largely responsible for poly(dA:dT)-mediated HSV-2 inhibition and IFN/ISGs induction in the cervical epithelial cells, as RIG-I knockout abolished the poly(dA:dT) actions. These observations demonstrate the importance for design and development of AT-rich dsDNA-based intervention strategies to control HSV-2 mucosal transmission in FRT.

Heroin Abuse and/or HIV Infection Dysregulate Plasma Exosomal miRNAs.

Exosomes play an important role in cell-to-cell communication as they can transfer functional molecules such as microRNAs (miRNAs) from one cell to another, exerting biological and immunological functions. Here, we investigated the impact of HIV infection and/or heroin use on the expression of the miRNAs in plasma exosomes. We found that HIV infection or heroin use upregulated the majority (98%) of a panel of plasma exosomal miRNAs associated with immune regulation and inflammation. We also observed the enhanced effect of HIV infection and heroin use on some of these upregulated miRNAs. Our further investigation showed that the levels of four of neuro-inflammation-related miRNAs (146a, 126, 21, and let-7a) were higher in HIV-infected heroin users as compared with the control subjects. These findings indicate that the dysregulations of the plasma exosomal miRNAs support further studies to determine the role of the miRNAs in HIV and/or heroin use-mediated immune modulation and neuro-inflammation. Graphical abstract.

Morphine Withdrawal Enhances HIV Infection of Macrophages.

Opioid withdrawal recurs at high rates in opioid use disorder and compromises the immune system. In general, there are two types of opioid withdrawal: abrupt withdrawal (AW) and precipitated withdrawal (PW). In this study, we examined the effect of morphine AW or morphine PW on HIV infection of human blood monocyte-derived macrophages. We observed that both morphine AW and PW enhanced the susceptibility of macrophages to HIV infection. In addition, both AW and PW activated HIV replication in the latently infected myeloid cells (U1 and OM10.1). Investigation of mechanisms responsible for these observations showed that both AW and PW could inhibit the expression of multiple intracellular HIV inhibitory factors, including APOBE3G/F, SAMHD1, MX2, and HIV restriction microRNAs (miR-28, miR-125b, and miR-150) in macrophages. These findings provide additional evidence to support the notion that opioid use compromises the intracellular anti-HIV immunity and facilitates HIV infection and persistence in macrophages.

IL-22 suppresses HSV-2 replication in human cervical epithelial cells.

Interleukin (IL)-22, a member of the IL-10 family, plays a role in antiviral immune responses to a number of viral infections. However, it is unclear whether IL-22 is involved in the mucosal immunity against herpes simplex virus 2 (HSV-2) infection in the female reproductive tract (FRT). In this study, we studied whether IL-22 could inhibit HSV-2 infection of human cervical epithelial cells (End1/E6E7 cells). We showed that End1/E6E7 cells express the functional IL-22 receptor complex (IL-22R1 and IL-10R2). When treated with IL-22, End1/E6E7 cells expressed the higher levels of IFN-stimulated genes (ISGs: ISG15, ISG56, OAS-1, OAS-2, and Mx2) than untreated cells. In addition, IL-22-treated cells produced higher levels of the tight junction proteins (ZO-1 and Occludin) than untreated cells. Mechanistically, IL-22 could activate the JAK/STAT signaling pathway by inducing the phosphorylation of STAT1 and STAT3. These observations indicate the potential of IL-22 as an anti-HSV-2 agent in the FRT mucosal innate immunity against HSV-2 infection.

HIV-1 and Compromised Adult Neurogenesis: Emerging Evidence for a New Paradigm of HAND Persistence

The face of the HIV-1/AIDS pandemic has changed significantly thanks to the development of antiretroviral therapy (ART) regimens. Unfortunately, several HIV-associated comorbidities continuously occur in the clinical population, most notably HIV-associated neurocognitive disorders (HAND). While many molecular and cellular mechanisms have been characterized by describing HAND pathology (specifically neuroinflammatory insults and oxidative stress) in the ART era, compromised adult neurogenesis is emerging as a potential new mechanism. Neurogenesis is a dynamic process that generates new neurons and glial cells from neural stem cells (NSCs) and neural progenitor cells (NPCs) in specific areas of the brain. There are increasing observations that HIV-1 can productively and non-productively infect NSCs and NPCs. HIV-1 proteins and/or secondary immune/inflammatory responses impair the initial differentiation process of NSCs to NPCs, restrict neuronal lineage differentiation, and aberrantly promote astrocytic lineage differentiation. Recent studies with HIV-1 transgenic animal models demonstrate varying degrees of adult neurogenic deficits, which correlate with milder to moderate forms of neurocognitive impairments. The neurogenic dysfunction underlying HAND highlights the importance of developing potential therapeutics to restore adult neurogenic homeostasis in HIV-1 patients.

Human Cervical Epithelial Cells Release Antiviral Factors and Inhibit HIV Replication in Macrophages.

The female reproductive tract is a major site of HIV sexual transmission. We here examined whether human cervical epithelial cells (HCEs) can be immunologically activated and produce antiviral factors against HIV. We demonstrated that HCEs (End1/E6E7 cells) possess the functional toll-like receptor (TLR)3 signaling system, which could be activated by Poly I:C and induce multiple cellular HIV restriction factors. The treatment of primary human macrophages with supernatant (SN) from TLR3-activated End1/E6E7 cell cultures resulted in HIV inhibition. This SN-mediated HIV inhibition was mainly through the induction of interferons (IFN)-ß and IFN-λs, as the antibodies to IFN-ß or IFN-λs receptor could effectively block the SN-mediated anti-HIV effect. Further studies showed that the incubation of macrophages with SN from the activated cervical epithelial cell cultures induced the expression of a number of IFN-stimulated genes (ISGs), including IFN-stimulated gene (ISG15), ISG56, 2', 5'-oligoadenylate synthetase 1 (OAS 1), OAS 2, Myxovirus Resistance A (MxA), MxB, and Guanylate-binding protein 5 (GBP5). In addition, TLR3-activated cells produced the CC chemokines [regulated on activation, normal T cell expressed and secreted (RANTES), Human macrophage inflammatory protein 1 alpha (MIP-1α), MIP-1ß] the ligands of HIV entry co-receptor CCR5. These observations support further studies on HCEs as potentially crucial and alternative targets for immunological intervention to control and prevent HIV sexual transmission.

Bowman‒Birk Inhibitor Suppresses Herpes Simplex Virus Type 2 Infection of Human Cervical Epithelial Cells.

The Bowman‒Birk inhibitor (BBI), a protease inhibitor derived from soybeans, has been extensively studied in anti-tumor and anti-inflammation research. We recently reported that BBI has an anti-HIV-1 property in primary human macrophages. Because HSV-2 infection plays a role in facilitating HIV-1 sexual transmission, we thus examined whether BBI has the ability to inhibit HSV-2 infection. We demonstrated that BBI could potently inhibit HSV-2 replication in human cervical epithelial cells (End1/E6E7). This BBI-mediated HSV-2 inhibition was partially through blocking HSV-2-mediated activation of NF-κB and p38 MAPK pathways. In addition, BBI could activate the JAK/STAT pathway and enhance the expression of several antiviral interferon-stimulated genes (ISGs). Furthermore, BBI treatment of End1/E6E7 cells upregulated the expression of tight junction proteins and reduced HSV-2-mediated cellular ubiquitinated proteins' degradation through suppressing the ubiquitin‒proteasome system. These observations indicate that BBI may have therapeutic potential for the prevention and treatment of HSV-2 infections.