Incidence and Molecular Identification of Begomoviruses Infecting Tomato and Pepper in Myanmar.

In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

First report of Colombian datura virus in Brugmansia suaveolens in Korea.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.