First report of Ug99 Wheat Stem Rust caused by Puccinia graminis f. sp. tritici in South Asia.

Since the emergence of Ug99 wheat stem rust in Uganda in 1998 (Pretorius et al. 2000), the threat of movement into South Asia has been a concern due to long-distance dispersal capacity of airborne spores (Brown and Hovmøller 2002; Singh et al. 2008; Meyer et al. 2017). Increased preparedness by comprehensive rust surveillance efforts and development and deployment of resistant cultivars in advance of an incursion into South Asia has been one of the success stories of the Borlaug Global Rust Initiative (Sharma et al. 2013). In November 2023, an off-season rust survey was conducted in Marpha, Gandaki and Bagmati provinces in Nepal. Rust was only observed at two sites, Dangdunge of Dolakha district and Mude of Sindhupalchok district, where spring wheat was grown as fodder crop outside the main cropping season. Rust infected wheat leaves (10-15 leaves per site) were air dried and sealed in envelopes that were shipped under permit to the Global Rust Reference Center, Denmark. Bulk samples of stem rust, Puccinia graminis f.sp. tritici (Pgt), were recovered from both envelopes, and single pustule isolates were raised and multiplied on Morocco and McNair. Meanwhile, specimens of dry leaves were subjected to SSR genotyping according to standard procedures (Patpour et al. 2022). One distinct multi-locus Pgt genotype was observed, identical to and representing 99% of Ug99 isolates within Clade I collected in East Africa between 2012-2022. A Pgt single pustule isolate from each of the sampling sites were inoculated onto 20 internationally agreed stem rust differential lines using standard procedures, and 14 supplementary lines providing additional resolution of pathogen virulence (Patpour et al. 2022). The pathotyping was repeated in two independent experiments, which resulted in the infection type pattern of Pgt race TTKTT (Supplementary Table 1). Additional independent SSR genotype assays of recovered isolates confirmed the prevalent genotype of Clade I (Patpour et al. 2022; Szabo et al. 2022). This first detection of Ug99 race TTKTT in South Asia emphasizes the need for continued coordinated international surveillance efforts and utilization of diverse sources of resistance to control stem rust in wheat. New surveillance efforts in Nepal during February-March 2024 did not reveal additional cases of wheat stem rust. However, more detailed and sustained rust surveillance efforts, assessment of the vulnerability of current wheat crops to Ug99 and other races of stem-, stripe/yellow- and leaf rust, as well as intensified breeding for rust resistance throughout the region is strongly recommended to meet current and future plant health risks.

New races with wider virulence indicate rapid evolution of Puccinia striiformis f. sp. tritici in the Southern Cone of America.

Wheat yellow (stripe) rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most devastating diseases of wheat worldwide. Pst populations are composed of multiple genetic groups, each carrying one or more races characterized by different avirulence/virulence combinations. Since the severe epidemics in 2017, yellow rust has become the most economically important wheat foliar disease in Uruguay. A set of 124 Pst isolates collected from wheat fields in Uruguay between 2017 and 2021 were characterized phenotypically and 27 of those isolates were subsequently investigated in-depth by additional molecular genotyping and race phenotyping analyses. Three genetic groups were identified, i.e., PstS7, PstS10 and PstS13, the latter being the most prevalent. Two races previously reported in Europe, Warrior (PstS7) and Benchmark (PstS10), were detected in four and two isolates, respectively. A third race known as Triticale2015 (PstS13), first detected in Europe in 2015 and in Argentina in 2017, was detected at several locations. Additional virulence to Yr3, Yr17, Yr25, Yr27 or Yr32 was detected in three new race variants within PstS13. The identification of these new races, which have not been reported outside South America, provides strong evidence of the local evolution of virulence in Pst during the recent epidemic years.

Scald resistance in hybrid rye (Secale cereale): genomic prediction and GWAS.

Rye (Secale cereale L.) is an important cereal crop used for food, beverages, and feed, especially in North-Eastern Europe. While rye is generally more tolerant to biotic and abiotic stresses than other cereals, it still can be infected by several diseases, including scald caused by Rhynchosporium secalis. The aims of this study were to investigate the genetic architecture of scald resistance, to identify genetic markers associated with scald resistance, which could be used in breeding of hybrid rye and to develop a model for genomic prediction for scald resistance. Four datasets with records of scald resistance on a population of 251 hybrid winter rye lines grown in 2 years and at 3 locations were used for this study. Four genomic models were used to obtain variance components and heritabilities of scald resistance. All genomic models included additive genetic effects of the parental components of the hybrids and three of the models included additive-by-additive epistasis and/or dominance effects. All models showed moderate to high broad sense heritabilities in the range of 0.31 (SE 0.05) to 0.76 (0.02). The model without non-additive genetic effects and the model with dominance effects had moderate narrow sense heritabilities ranging from 0.24 (0.06) to 0.55 (0.08). None of the models detected significant non-additive genomic variances, likely due to a limited data size. A genome wide association study was conducted to identify markers associated with scald resistance in hybrid winter rye. In three datasets, the study identified a total of twelve markers as being significantly associated with scald resistance. Only one marker was associated with a major quantitative trait locus (QTL) influencing scald resistance. This marker explained 11-12% of the phenotypic variance in two locations. Evidence of genotype-by-environment interactions was found for scald resistance between one location and the other two locations, which suggested that scald resistance was influenced by different QTLs in different environments. Based on the results of the genomic prediction models and GWAS, scald resistance seems to be a quantitative trait controlled by many minor QTL and one major QTL, and to be influenced by genotype-by-environment interactions.

Sr65: a widely effective gene for stem rust resistance in wheat.

KEY MESSAGE: Sr65 in chromosome 1A of Indian wheat landrace Hango-2 is a potentially useful all-stage resistance gene that currently protects wheat from stem rust in Australia, India, Africa and Europe. Stem rust, caused by Puccinia graminis f. sp. tritici (Pgt), threatened global wheat production with the appearance of widely virulent races that included TTKSK and TTRTF. Indian landrace Hango-2 showed resistance to Pgt races in India and Australia. Screening of a Hango-2/Avocet 'S' (AvS) recombinant inbred line population identified two stem rust resistance genes, a novel gene (temporarily named as SrH2) from Hango-2 and Sr26 from AvS. A mapping population segregating for SrH2 alone was developed from two recombinant lines. SrH2 was mapped on the short arm of chromosome 1A, where it was flanked by KASP markers KASP_7944 (proximal) and KASP_12147 (distal). SrH2 was delimited to an interval of 1.8-2.3 Mb on chromosome arm 1AS. The failure to detect candidate genes through MutRenSeq and comparative genomic analysis with the pan-genome dataset indicated the necessity to generate a Hango-2 specific assembly for detecting the gene sequence linked with SrH2 resistance. MutRenSeq however enabled identification of SrH2-linked KASP marker sunCS_265. Markers KASP_12147 and sunCS_265 showed 92% and 85% polymorphism among an Australian cereal cultivar diversity panel and can be used for marker-assisted selection of SrH2 in breeding programs. The effectiveness of SrH2 against Pgt races from Europe, Africa, India, and Australia makes it a valuable resource for breeding stem rust-resistant wheat cultivars. Since no wheat-derived gene was previously located in chromosome arm 1AS, SrH2 represents a new locus and named as SR65.

Wheat stripe rust resistance locus YR63 is a hot spot for evolution of defence genes - a pangenome discovery.

BACKGROUND: Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), poses a threat to global wheat production. Deployment of widely effective resistance genes underpins management of this ongoing threat. This study focused on the mapping of stripe rust resistance gene YR63 from a Portuguese hexaploid wheat landrace AUS27955 of the Watkins Collection. RESULTS: YR63 exhibits resistance to a broad spectrum of Pst races from Australia, Africa, Asia, Europe, Middle East and South America. It was mapped to the short arm of chromosome 7B, between two single nucleotide polymorphic (SNP) markers sunCS_YR63 and sunCS_67, positioned at 0.8 and 3.7 Mb, respectively, in the Chinese Spring genome assembly v2.1. We characterised YR63 locus using an integrated approach engaging targeted genotyping-by-sequencing (tGBS), mutagenesis, resistance gene enrichment and sequencing (MutRenSeq), RNA sequencing (RNASeq) and comparative genomic analysis with tetraploid (Zavitan and Svevo) and hexaploid (Chinese Spring) wheat genome references and 10+ hexaploid wheat genomes. YR63 is positioned at a hot spot enriched with multiple nucleotide-binding and leucine rich repeat (NLR) and kinase domain encoding genes, known widely for defence against pests and diseases in plants and animals. Detection of YR63 within these gene clusters is not possible through short-read sequencing due to high homology between members. However, using the sequence of a NLR member we were successful in detecting a closely linked SNP marker for YR63 and validated on a panel of Australian bread wheat, durum and triticale cultivars. CONCLUSIONS: This study highlights YR63 as a valuable source for resistance against Pst in Australia and elsewhere. The closely linked SNP marker will facilitate rapid introgression of YR63 into elite cultivars through marker-assisted selection. The bottleneck of this study reinforces the necessity for a long-read sequencing such as PacBio or Oxford Nanopore based techniques for accurate detection of the underlying resistance gene when it is part of a large gene cluster.

Wheat Stem Rust Detection and Race Characterization in Tunisia.

Climate changes over the past 25 years have led to conducive conditions for invasive and transboundary fungal disease occurrence, including the re-emergence of wheat stem rust disease, caused by Puccinia graminis f.sp. tritici (Pgt) in East Africa, Europe, and the Mediterranean basin. Since 2018, sporadic infections have been observed in Tunisia. In this study, we investigated Pgt occurrence at major Tunisian wheat growing areas. Pgt monitoring, assessment, and sampling from planted trap nurseries at five different locations over two years (2021 and 2022) revealed the predominance of three races, namely TTRTF (Clade III-B), TKKTF (Clade IV-F), and TKTTF (Clade IV-B). Clade III-B was the most prevalent in 2021 as it was detected at all locations, while in 2022 Pgt was only reported at Beja and Jendouba, with the prevalence of Clade IV-B. The low levels of disease incidence during these two years and Pgt population diversity suggest that this fungus most likely originated from exotic incursions and that climate factors could have caused disease establishment in Tunisia. Further evaluation under the artificial disease pressure of Tunisian wheat varieties and weather-based modeling for early disease detection in the Mediterranean area could be helpful in monitoring and predicting wheat stem rust emergence and epidemics.

Global dispersal and diversity of rust fungi in the context of plant health.

Long-distance dispersal of plant pathogens at the continental scale may have strong implications on plant health, in particular when incursions result in spread of disease to new territories where the disease was previously absent or insignificant. These dispersions may be caused by airborne transmission of spores or accidental spread via human travel and trade. Recent surveillance efforts of cereal rust fungi have demonstrated that incursion of new strains with superior fitness into areas where the disease is already established may have similar implications on plant health. Since dispersal events are highly stochastic, irrespective of transmission mechanism, critical mitigation efforts include preparedness by coordinated pathogen surveillance activities, host crop diversification, and breeding for disease resistance with low vulnerability to sudden changes in the pathogen population.

Recombination in the wheat stem rust pathogen mediated by an indigenous barberry species in Spain.

The comeback of wheat stem rust in Europe, caused by Puccinia graminis f. sp. tritici, and the prevalence of the alternate (sexual) host in local areas have recently regained attention as a potential threat to European wheat production. The aim of this study was to investigate a potential epidemiological link between the aecia found on an indigenous barberry species and stem rust infections on nearby cereals and grasses. Aecial infections collected from Berberis vulgaris subsp. seroi were inoculated on a panel of susceptible genotypes of major cereal crop species. In total, 67 stem rust progeny isolates were recovered from wheat (51), barley (7), and rye (9), but none from oat, indicating the potential of barberry derived isolates to infect multiple cereals. Molecular genotyping of the progeny isolates and 20 cereal and grass stem rust samples collected at the same locations and year, revealed a clear genetic relatedness between the progeny isolated from barberry and the stem rust infections found on nearby cereal and grass hosts. Analysis of Molecular Variance indicated that variation between the stem rust populations accounted for only 1%. A Principal Components Analysis using the 62 detected multilocus genotypes also demonstrated a low degree of genetic variation among isolates belonging to the two stem rust populations. Lastly, pairwise comparisons based on fixation index (Fst), Nei's genetic distances and number of effective migrants (Nm) revealed low genetic differentiation and high genetic exchange between the two populations. Our results demonstrated a direct epidemiological link and functionality of an indigenous barberry species as the sexual host of P. graminis in Spain, a factor that should be considered when designing future strategies to prevent stem rust in Europe and beyond.

Stem rust on barberry species in Europe: Host specificities and genetic diversity.

The increased emergence of cereal stem rust in southern and western Europe, caused by the pathogen Puccinia graminis, and the prevalence of alternate (sexual) host, Berberis species, have regained attention as the sexual host may serve as source of novel pathogen variability that may pose a threat to cereal supply. The main objective of the present study was to investigate the functional role of Berberis species in the current epidemiological situation of cereal stem rust in Europe. Surveys in 11 European countries were carried out from 2018 to 2020, where aecial infections from five barberry species were collected. Phylogenetic analysis of 121 single aecial clusters of diverse origin using the elongation factor 1-α gene indicated the presence of different special forms (aka formae speciales) of P. graminis adapted to different cereal and grass species. Inoculation studies using aecial clusters from Spain, United Kingdom, and Switzerland resulted in 533 stem rust isolates sampled from wheat, barley, rye, and oat, which confirmed the presence of multiple special forms of P. graminis. Microsatellite marker analysis of a subset of 192 sexually-derived isolates recovered on wheat, barley and rye from the three populations confirmed the generation of novel genetic diversity revealed by the detection of 135 multilocus genotypes. Discriminant analysis of principal components resulted in four genetic clusters, which grouped at both local and country level. Here, we demonstrated that a variety of Berberis species may serve as functional alternate hosts for cereal stem rust fungi and highlights the increased risks that the sexual cycle may pose to cereal production in Europe, which calls for new initiatives within rust surveillance, epidemiological research and resistance breeding.

Barberry plays an active role as an alternate host of Puccinia graminis in Spain.

Stem rust, caused by Puccinia graminis, is a destructive group of diseases. The pathogen uses Berberis species as alternate hosts to complete its life cycle. B. vulgaris and the endemic species B. hispanica and B. garciae are present in Spain. The objective of this study was to investigate the functionality of the indigenous barberry as alternate hosts. Field surveys were conducted in 2018 and 2019 in Huesca, Teruel and Albacete provinces of Spain. Aecial samples on barberry were analysed via infection assays and DNA analysis. B. garciae was predominant in Huesca and Teruel provinces, often found in the field margins of cereal crops. Aecial infections on B. garciae were observed in May and uredinial infections on cereal crops in June. Scattered B. hispanica bushes were occasionally found near cereal crops in Albacete, where aecial infections on B. hispanica were observed in June when most cereal crops were mature. Infection assays using aeciospores resulted in stem rust infections on susceptible genotypes of wheat, barley, rye and oat, indicating the presence of the sexual cycle for P. graminis f. sp. tritici, f. sp. secalis and f. sp. avenae. Sequence analyses from aecial samples supported this finding as well as the presence of Puccinia brachypodii. This study provides the first evidence that indigenous Berberis species play an active role in the sexual cycle of P. graminis under natural conditions in Spain.

Haplotype variants of Sr46 in Aegilops tauschii, the diploid D genome progenitor of wheat.

KEY MESSAGE: Stem rust resistance genes, SrRL5271 and Sr672.1 as well as SrCPI110651, from Aegilops tauschii, the diploid D genome progenitor of wheat, are sequence variants of Sr46 differing by 1-2 nucleotides leading to non-synonymous amino acid substitutions. The Aegilops tauschii (wheat D-genome progenitor) accessions RL 5271 and CPI110672 were identified as resistant to multiple races (including the Ug99) of the wheat stem rust pathogen Puccinia graminis f. sp. tritici (Pgt). This study was conducted to identify the stem rust resistance (Sr) gene(s) in both accessions. Genetic analysis of the resistance in RL 5271 identified a single dominant allele (SrRL5271) controlling resistance, whereas resistance segregated at two loci (SR672.1 and SR672.2) for a cross of CPI110672. Bulked segregant analysis placed SrRL5271 and Sr672.1 in a region on chromosome arm 2DS that encodes Sr46. Molecular marker screening, mapping and genomic sequence analysis demonstrated SrRL5271 and Sr672.1 are alleles of Sr46. The amino acid sequence of SrRL5271 and Sr672.1 is identical but differs from Sr46 (hereafter referred to as Sr46_h1 by following the gene nomenclature in wheat) by a single amino acid (N763K) and is thus designated Sr46_h2. Screening of a panel of Ae. tauschii accessions identified an additional allelic variant that differed from Sr46_h2 by a different amino acid (A648V) and was designated Sr46_h3. By contrast, the protein encoded by the susceptible allele of Ae. tauschii accession AL8/78 differed from these resistance proteins by 54 amino acid substitutions (94% nucleotide sequence gene identity). Cloning and complementation tests of the three resistance haplotypes confirmed their resistance to Pgt race 98-1,2,3,5,6 and partial resistance to Pgt race TTRTF in bread wheat. The three Sr46 haplotypes, with no virulent races detected yet, represent a valuable source for improving stem resistance in wheat.

Wheat Stem Rust Back in Europe: Diversity, Prevalence and Impact on Host Resistance.

The objective of this study was to investigate the re-emergence of a previously important crop pathogen in Europe, Puccinia graminis f.sp. tritici, causing wheat stem rust. The pathogen has been insignificant in Europe for more than 60 years, but since 2016 it has caused epidemics on both durum wheat and bread wheat in local areas in southern Europe, and additional outbreaks in Central- and West Europe. The prevalence of three distinct genotypes/races in many areas, Clade III-B (TTRTF), Clade IV-B (TKTTF) and Clade IV-F (TKKTF), suggested clonal reproduction and evolution by mutation within these. None of these genetic groups and races, which likely originated from exotic incursions, were detected in Europe prior to 2016. A fourth genetic group, Clade VIII, detected in Germany (2013), was observed in several years in Central- and East Europe. Tests of representative European wheat varieties with prevalent races revealed high level of susceptibility. In contrast, high diversity with respect to virulence and Simple Sequence Repeat (SSR) markers were detected in local populations on cereals and grasses in proximity to Berberis species in Spain and Sweden, indicating that the alternate host may return as functional component of the epidemiology of wheat stem rust in Europe. A geographically distant population from Omsk and Novosibirsk in western Siberia (Russia) also revealed high genetic diversity, but clearly different from current European populations. The presence of Sr31-virulence in multiple and highly diverse races in local populations in Spain and Siberia stress that virulence may emerge independently when large geographical areas and time spans are considered and that Sr31-virulence is not unique to Ug99. All isolates of the Spanish populations, collected from wheat, rye and grass species, were succesfully recovered on wheat, which underline the plasticity of host barriers within P. graminis. The study demonstrated successful alignment of two genotyping approaches and race phenotyping methodologies employed by different laboratories, which also allowed us to line up with previous European and international studies of wheat stem rust. Our results suggest new initiatives within disease surveillance, epidemiological research and resistance breeding to meet current and future challenges by wheat stem rust in Europe and beyond.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

Discovery of Resistance Genes in Rye by Targeted Long-Read Sequencing and Association Genetics.

The majority of released rye cultivars are susceptible to leaf rust because of a low level of resistance in the predominant hybrid rye-breeding gene pools Petkus and Carsten. To discover new sources of leaf rust resistance, we phenotyped a diverse panel of inbred lines from the less prevalent Gülzow germplasm using six distinct isolates of Puccinia recondita f. sp. secalis and found that 55 out of 92 lines were resistant to all isolates. By performing a genome-wide association study using 261,406 informative SNP markers, we identified five resistance-associated QTLs on chromosome arms 1RS, 1RL, 2RL, 5RL and 7RS. To identify candidate Puccinia recondita (Pr) resistance genes in these QTLs, we sequenced the rye nucleotide-binding leucine-rich repeat (NLR) intracellular immune receptor complement using a Triticeae NLR bait-library and PacBio® long-read single-molecule high-fidelity (HiFi) sequencing. Trait-genotype correlations across 10 resistant and 10 susceptible lines identified four candidate NLR-encoding Pr genes. One of these physically co-localized with molecular markers delimiting Pr3 on chromosome arm 1RS and the top-most resistance-associated QTL in the panel.

Distribution of Puccinia striiformis f. sp. tritici Races and Virulence in Wheat Growing Regions of Kenya from 1970 to 2014.

Stripe rust, caused by the fungal pathogen Puccinia striiformis f. sp. tritici, is a major threat to wheat (Triticum spp.) production worldwide. The objective of this study was to determine the virulence of P. striiformis f. sp. tritici races prevalent in the main wheat growing regions of Kenya, which includes Mt. Kenya, Eastern Kenya, and the Rift Valley (Central, Southern, and Northern Rift). Fifty P. striiformis f. sp. tritici isolates collected from 1970 to 1992 and from 2009 to 2014 were virulence phenotyped with stripe rust differential sets, and 45 isolates were genotyped with sequence characterized amplified region (SCAR) markers to differentiate the isolates and identify aggressive strains PstS1 and PstS2. Virulence corresponding to stripe rust resistance genes Yr1, Yr2, Yr3, Yr6, Yr7, Yr8, Yr9, Yr17, Yr25, and Yr27 and the seedling resistance in genotype Avocet S were detected. Ten races were detected in the P. striiformis f. sp. tritici samples obtained from 1970 to 1992, and three additional races were detected from 2009 to 2014, with a single race being detected in both periods. The SCAR markers detected both Pst1 and Pst2 strains in the collection. Increasing P. striiformis f. sp. tritici virulence was found in the Kenyan P. striiformis f. sp. tritici population, and different P. striiformis f. sp. tritici race groups were found to dominate different wheat growing regions. Moreover, recent P. striiformis f. sp. tritici races in East Africa indicated possible migration of some race groups into Kenya from other regions. This study is important in elucidating P. striiformis f. sp. tritici evolution and virulence diversity and useful in breeding wheat cultivars with effective resistance to stripe rust.

Incursions of divergent genotypes, evolution of virulence and host jumps shape a continental clonal population of the stripe rust pathogen Puccinia striiformis.

Long-distance migration and host adaptation by transboundary plant pathogens often brings detrimental effects to important agroecosystems. Efficient surveillance as a basis for responding to the dynamics of such pathogens is often hampered by a lack of information on incursion origin, evolutionary pathways and the genetic basis of rapidly evolving virulence across larger timescales. Here, we studied these genetic features by using historical isolates of the obligate biotrophic pathogen Puccinia striiformis f. sp. tritici (Pst), which causes one of the most widespread and devastating diseases, stripe (yellow) rust, of wheat. Through a combination of genotypic, phenotypic and genomic analyses, we assigned eight Pst isolates representing putative exotic Pst incursions into Australia to four previously defined genetic groups, PstS0, PstS1, PstS10 and PstS13. We showed that isolates of an additional incursion of P. striiformis, known locally as P. striiformis f. sp. pseudo-hordei, had a new and unique multilocus SSR genotype (MLG). We provide results of overall genomic variation of representative Pst isolates from each genetic group by comparative genomic analyses. We showed that isolates within the PstS1 and PstS13 genetic groups are most distinct at the whole-genome variant level from isolates belonging to genetic group PstS0, whereas the isolate from the PstS10 genetic group is intermediate. We further explored variable gene content, including putative effectors, representing both shared but also unique genetic changes that have occurred following introduction, some of which may additionally account for local adaptation of these isolates to triticale. Our genotypic and genomic data revealed new genetic insights into the evolution of diverse phenotypes of rust pathogens following incursion into a geographically isolated continental region.

A recombined Sr26 and Sr61 disease resistance gene stack in wheat encodes unrelated NLR genes.

The re-emergence of stem rust on wheat in Europe and Africa is reinforcing the ongoing need for durable resistance gene deployment. Here, we isolate from wheat, Sr26 and Sr61, with both genes independently introduced as alien chromosome introgressions from tall wheat grass (Thinopyrum ponticum). Mutational genomics and targeted exome capture identify Sr26 and Sr61 as separate single genes that encode unrelated (34.8%) nucleotide binding site leucine rich repeat proteins. Sr26 and Sr61 are each validated by transgenic complementation using endogenous and/or heterologous promoter sequences. Sr61 orthologs are absent from current Thinopyrum elongatum and wheat pan genome sequences, contrasting with Sr26 where homologues are present. Using gene-specific markers, we validate the presence of both genes on a single recombinant alien segment developed in wheat. The co-location of these genes on a small non-recombinogenic segment simplifies their deployment as a gene stack and potentially enhances their resistance durability.

Discovery of a Novel Leaf Rust (Puccinia recondita) Resistance Gene in Rye (Secale cereale L.) Using Association Genomics.

Leaf rust constitutes one of the most important foliar diseases in rye (Secale cereale L.). To discover new sources of resistance, we phenotyped 180 lines belonging to a less well-characterized Gülzow germplasm at three field trial locations in Denmark and Northern Germany in 2018 and 2019. We observed lines with high leaf rust resistance efficacy at all locations in both years. A genome-wide association study using 261,406 informative single-nucleotide polymorphisms revealed two genomic regions associated with resistance on chromosome arms 1RS and 7RS, respectively. The most resistance-associated marker on chromosome arm 1RS physically co-localized with molecular markers delimiting Pr3. In the reference genomes Lo7 and Weining, the genomic region associated with resistance on chromosome arm 7RS contained a large number of nucleotide-binding leucine-rich repeat (NLR) genes. Residing in close proximity to the most resistance-associated marker, we identified a cluster of NLRs exhibiting close protein sequence similarity with the wheat leaf rust Lr1 gene situated on chromosome arm 5DL in wheat, which is syntenic to chromosome arm 7RS in rye. Due to the close proximity to the most resistance-associated marker, our findings suggest that the considered leaf rust R gene, provisionally denoted Pr6, could be a Lr1 ortholog in rye.

Distinct Life Histories Impact Dikaryotic Genome Evolution in the Rust Fungus Puccinia striiformis Causing Stripe Rust in Wheat.

Stripe rust of wheat, caused by the obligate biotrophic fungus Puccinia striiformis f.sp. tritici, is a major threat to wheat production worldwide with an estimated yearly loss of US $1 billion. The recent advances in long-read sequencing technologies and tailored-assembly algorithms enabled us to disentangle the two haploid genomes of Pst. This provides us with haplotype-specific information at a whole-genome level. Exploiting this novel information, we perform whole-genome comparative genomics of two P. striiformis f.sp. tritici isolates with contrasting life histories. We compare one isolate of the old European lineage (PstS0), which has been asexual for over 50 years, and a Warrior isolate (PstS7 lineage) from a novel incursion into Europe in 2011 from a sexual population in the Himalayan region. This comparison provides evidence that long-term asexual evolution leads to genome expansion, accumulation of transposable elements, and increased heterozygosity at the single nucleotide, structural, and allele levels. At the whole-genome level, candidate effectors are not compartmentalized and do not exhibit reduced levels of synteny. Yet we were able to identify two subsets of candidate effector populations. About 70% of candidate effectors are invariant between the two isolates, whereas 30% are hypervariable. The latter might be involved in host adaptation on wheat and explain the different phenotypes of the two isolates. Overall, this detailed comparative analysis of two haplotype-aware assemblies of P. striiformis f.sp. tritici is the first step in understanding the evolution of dikaryotic rust fungi at a whole-genome level.

Multi-Parental Populations Suitable for Identifying Sources of Resistance to Powdery Mildew in Winter Wheat.

Wheat (Triticum aestivum L.) is one of the world's staple food crops and one of the most devastating foliar diseases attacking wheat is powdery mildew (PM). In Denmark only a few specific fungicides are available for controlling PM and the use of resistant cultivars is often recommended. In this study, two Chinese wheat landraces and two synthetic hexaploid wheat lines were used as donors for creating four multi-parental populations with a total of 717 individual lines to identify new PM resistance genetic variants. These lines and the nine parental lines (including the elite cultivars used to create the populations) were genotyped using a 20 K Illumina SNP chip, which resulted in 8,902 segregating single nucleotide polymorphisms for assessment of the population structure and whole genome association study. The largest genetic difference among the lines was between the donors and the elite cultivars, the second largest genetic difference was between the different donors; a difference that was also reflected in differences between the four multi-parental populations. The 726 lines were phenotyped for PM resistance in 2017 and 2018. A high PM disease pressure was observed in both seasons, with severities ranging from 0 to >50%. Whole genome association studies for genetic variation in PM resistance in the populations revealed significant markers mapped to either chromosome 2A, B, or D in each of the four populations. However, linkage disequilibrium between these putative quantitative trait loci (QTL) were all above 0.80, probably representing a single QTL. A combined analysis of all the populations confirmed this result and the most associated marker explained 42% of the variation in PM resistance. This study gives both knowledge about the resistance as well as molecular tools and plant material that can be utilised in marker-assisted selection. Additionally, the four populations produced in this study are highly suitable for association studies of other traits than PM resistance.