Meta-analysis of risk factors for restenosis after stent implantation in patients with ischemic cerebrovascular disease.

OBJECTIVE: The aim of this study was to investigate the risk factors for restenosis after stent implantation in patients with ischemic cerebrovascular disease (ICVD), and to provide a reference for potential measures to prevent ICVD. MATERIALS AND METHODS: Relevant studies were identified by searching PubMed, ScienceDirect and Web of Science databases. Combined adjusted odds ratios and 95% confidence intervals were calculated. RESULTS: Seven case-control studies were identified in the end. Diabetes mellitus and residual stenosis were the two main risk factors for restenosis (OR = 0.59, 95% CI: 0.39-0.91, p = 0.01; OR = 36.73, 95% CI: 19.72-70.02, p < 0.001). Gender, smoking, hypertension, dyslipidemia, and stent type were not significantly associated with restenosis (OR = 0.85, 95% CI: 0.53-1.38, p = 0.52; OR = 1.30, 95% CI: 0.91-1.86, p = 0.15; OR = 0.86, 95% CI: 0.16-4.66, p = 0.86; OR = 1.30, 95% CI: 0.58-2.91, p = 0.53; OR = 1.34, 95% CI: 0.72-2.48, p = 0.35). CONCLUSIONS: The prevention of restenosis after stenting is particularly important for ICVD patients with diabetes or a high residual stenosis rate.

[Analysis of the association between diurnal temperature difference and relative humidity and myocardial infarction in Shantou residents].

Objective: To analyze the effect of meteorological conditions on mortality and population susceptibility of patients with acute myocardial infarction (AMI) in the Shantou area and to provide a scientific basis for the local public health system to prevent AMI. Methods: The AMI mortality data recorded in the resident cause of death surveillance database of Shantou from January 1, 2015, to December 31, 2020, were collected and the distribution lag nonlinear model was used to analyze the diurnal temperature range (DTR) and relative humidity (RH) on AMI mortality and the lag effect. Results: There were 13 932 deaths due to AMI in Shantou during the study period, with a male-to-female sex ratio of 1.3∶1. There was a significant association between high diurnal temperature difference exposure and low RH exposure and AMI deaths, with both single-day lag effects appearing and reaching a maximum at lag 2 day (RR=1.019, 95%CI: 1.000-1.039; RR=1.018, 95%CI: 1.003-1.034); the cumulative lag effect was all maximal at lag 0-14 day (RR=1.199, 95%CI: 1.025-1.401; RR=1.279, 95%CI: 1.117-1.465). The elderly (≥75 years) and female populations were susceptible to high DTR exposure and low RH exposure conditions. Conclusions: There was a significant association between DTR and RH and mortality of AMI in Shantou with a significant lag in their effects. Both female and elderly populations ≥75 years old were susceptible populations under high DTR and low RH exposure conditions.

Pathogenic analysis of suspected COVID-19 patients in a SARS-CoV-2 non-epidemic area of China.

OBJECTIVE: The aim of this study is to find the distributions of pathogens in 164 suspected COVID-19 patients from the outpatient clinic of Shenjing Hospital of China Medical University from 24th January, 2020, to 29th February of 2020. PATIENTS AND METHODS: 164 COVID-19 suspected patients were from the Shengjing Hospital of China Medical University. Oropharyngeal swab specimens were acquired by respiratory doctors under standardized conditions. Specific nucleic acids of SARS-CoV-2, influenza A and B, respiratory syncytial virus A and B, adenovirus, parainfluenza virus, along with pneumonic mycoplasma were detected by real-time fluorescence PCR. Symptomatic, epidemiologic, laboratory and radiological data of the patients were obtained from the electronic medical record system of our hospital. RESULTS: Among the 164 patients, 3 were positive for SARS-CoV-2, 15 were positive for other respiratory viruses and 16 were positive for pneumonic mycoplasma. Of the positive patients above, 1 patient was co-infected with SARS-CoV-2 and adenovirus, and 1 was co-infected with influenza B and pneumonic mycoplasma. The 3 SARS-CoV-2 infected patients were clinically diagnosed as COVID-19 because they meet the diagnostic criteria listed in "Chinese Clinical Guidance for COVID-19 Pneumonia diagnosis and treatment", including epidemic history, symptom and pathogenic detection, as well as abnormalities of the laboratory and radiological data. However, the clinical characteristics of COVID-19 patients were non-specific compared to those of the patients infected with other respiratory viruses. CONCLUSIONS: The endemic common respiratory pathogens are more prevalent than SARS-CoV-2 in the SARS-CoV-2 non-epidemic areas of this research. Detection of the pathogen is the unique means for definite COVID-19 diagnosis.

[Sero-prevalence of Babesia infection among voluntary blood donors in Jiangsu Province].

OBJECTIVE: To evaluate the sero-positivity of Babesia infection in voluntary blood donors in Jiangsu region, so as to provide the evidence for transfusion safety. METHODS: A total of 950 blood samples were collected from voluntary blood donors in Jiangsu Provincial Blood Center from February to May, 2017, and detected by double antigen sandwich ELISA targeting peptides derived from B. microti-secreted antigen 1 (BmSA1). The positive samples were confirmed by microscopy and nested-PCR to determine parasitemia. The prevalence of anti-BmSA1 was analyzed between/among different genders, ages and occupations of the blood donors. RESULTS: Of the 950 blood screened samples, 5 were positive for anti-BmSA1, and the sero-prevalence of Babesia infection was 0.53%. The 5 samples were all negative by microscopy and nested-PCR. There were no gender- (χ2 = 0.01, P =0.92) or age-specific differences (χ2 = 0.11, P = 0.95) in the sero-prevalence of Babesia infection; however, there was an occupation-specific difference detected in the sero-prevalence of Babesia infection (χ2 = 11.93, P < 0.05). CONCLUSIONS: Babesia infection is detected in voluntary blood donors in Jiangsu region, which should be paid much attention.

AKT-GSK3ß Signaling Pathway Regulates Mitochondrial Dysfunction-Associated OPA1 Cleavage Contributing to Osteoblast Apoptosis: Preventative Effects of Hydroxytyrosol.

Oxidative stress (OS) induces osteoblast apoptosis, which plays a crucial role in the initiation and progression of osteoporosis. Although OS is closely associated with mitochondrial dysfunction, detailed mitochondrial mechanisms underlying OS-induced osteoblast apoptosis have not been thoroughly elucidated to date. In the present study, we found that mitochondrial abnormalities largely contributed to OS-induced osteoblast apoptosis, as evidenced by enhanced production of mitochondrial reactive oxygen species; considerable reduction in mitochondrial respiratory chain complex activity, mitochondrial membrane potential, and adenosine triphosphate production; abnormality in mitochondrial morphology; and alteration of mitochondrial dynamics. These mitochondrial abnormalities were primarily mediated by an imbalance in mitochondrial fusion and fission through a protein kinase B- (AKT-) glycogen synthase kinase 3ß- (GSK3ß-) optic atrophy 1- (OPA1-) dependent mechanism. Hydroxytyrosol (3,4-dihydroxyphenylethanol (HT)), an important compound in virgin olive oil, significantly prevented OS-induced osteoblast apoptosis. Specifically, HT inhibited OS-induced mitochondrial dysfunction by decreasing OPA1 cleavage and by increasing AKT and GSK3ß phosphorylation. Together, our results indicate that the AKT-GSK3ß signaling pathway regulates mitochondrial dysfunction-associated OPA1 cleavage, which may contribute to OS-induced osteoblast apoptosis. Moreover, our results suggest that HT could be an effective nutrient for preventing osteoporosis development.

[Application of multiplex PCR assay to study early multiple herpesviruses infection during HSCT].

Objective: To investigate herpesvirus infection in early stage of hematopoietic stem cell transplantation (HSCT) by multiplex polymerase chain reaction (PCR), and to explore the association between multiple herpesviruses infection and clinical characteristics in HSCT patients and its impact on post-transplant complications and prognosis. Methods: A total of 734 peripheral blood samples were collected from 90 patients undergoing HSCT in the Department of Hematology, the First Affiliated Hospital of Soochow University between February 2017 and August 2017. The peripheral blood specimens were obtained before and within 90 days after transplantation at different time points. Lab-Aid824 Nucleic Acid Extraction Mini Reagent was used to extract DNA and multiplex PCR assay was used to simultaneously detect 8 kinds of human herpesviruses from genomic DNA. The incidence of various herpesvirus infections, its correlation with clinical features and effects on post-transplant complications and prognosis were analyzed. Results: The median follow-up time was 192 (range: 35-308) days. Among the 90 patients before transplantation, the incidence of herpes virus infection was 35.6% (32/90), including 12.2% (11/90) with one herpes virus infection and 23.3% (21/90) with multiple viruses infection. The incidence of herpes virus infection after transplantation was 77.8% (70/90), including 20.0% (18/90) with one herpes virus infection and 57.8% (52/90) with multiple herpes virus infection. Among the 52 patients with multiple herpes viruses infection, 30 (57.7%) patients were infected by 2 kinds of viruses, 18 (34.6%) patients by 3 kinds of viruses and 4 (7.7%) patients by 4 kinds of viruses. There was a correlation between HHV-6 and HHV-7 herpesvirus infection (OR=13.880, Q=0.026). EBV infection was related to HHV-7 infection (OR=0.093, Q=0.044). The age of patients was correlated with the incidence of HHV-1 infection before transplantation. There were 24 patients in our study experienced clinical symptoms associated with viral infection. The main manifestations were hemorrhagic cystitis (HC), interstitial pneumonia, enteritis, viral encephalitis and fever of unknown origin. EBV infection was related to HLA incompatibility and the inconsistent of the ABO blood group and grade Ⅱ-Ⅳ aGVHD after transplantation. HLA incompatibility and the unrelated donor and grade Ⅱ-Ⅳ aGVHD were related to multiple viruses infection. Conclusion: Multiple herpesviruses were common in patients undergoing HSCT, which were closely related to HLA mismatch, unrelated donor and grade Ⅱ-Ⅳ aGVHD.

[Establishment and assessment of a nomogram for predicting the differentiation syndrome of acute promyelocytic leukemia].

Objective: By analyzing the risk factors for occurrence of differentiation syndrome (DS) during induction therapy in newly-diagnosed acute promyelocytic leukemia (APL) patients, a prediction nomogram for DS was established and the accuracy of this nomogram was validated. Methods: The modeling group was made up of 130 classical APL patients during the period of 1st January 2011 to 31st December 2013. After single factor screening of clinical variables, the logistic regression model was used to identify the final model variables. A nomogram subsequently established by R software was validated by Bootstrap resampling as internal validation. Concordance index (C-index) was used for the accuracy evaluation of the nomogram, and calibration curves were painted to test the actual observation and the nomogram-prediction of occurrence rate of DS. Results: Occurrence rate of DS in 130 APL patients was 30.0%; In multivariate analysis, body mass index (BMI) ≥24 kg/m2 and without using steroids for prevention of DS were identified as independent risk factors. The C-index of the nomogram for predicting DS was 0.818 (95% CI 0.741-0.895). The calibration curves showed good concordance of occurrence rate of DS between nomogram-prediction and actual observation. Conclusion: The nomogram was successfully established as a more accurate and visible tool for predicting the occurrence rate of DS in APL patients.

Mapping the Interaction Anatomy of BmP02 on Kv1.3 Channel.

The potassium channel Kv 1.3 plays a vital part in the activation of T lymphocytes and is an attractive pharmacological target for autoimmune diseases. BmP02, a 28-residue peptide isolated from Chinese scorpion (Buthus martensi Karsch) venom, is a potent and selective Kv1.3 channel blocker. However, the mechanism through which BmP02 recognizes and inhibits the Kv1.3 channel is still unclear. In the present study, a complex molecular model of Kv1.3-BmP02 was developed by docking analysis and molecular dynamics simulations. From these simulations, it appears the large ß-turn (residues 10-16) of BmP02 might be the binding interface with Kv 1.3. These results were confirmed by scanning alanine mutagenesis of BmP02, which identified His9, Lys11 and Lys13, which lie within BmP02's ß-turn, as key residues for interacting with Kv1.3. Based on these results and molecular modeling, two negatively charged residues of Kv1.3, D421 and D422, located in turret region, were predicted to act as the binding site for BmP02. Mutation of these residues reduced sensitivity of Kv 1.3 to BmP02 inhibition, suggesting that electrostatic interactions play a crucial role in Kv1.3-BmP02 interaction. This study revealed the molecular basis of Kv 1.3 recognition by BmP02 venom, and provides a novel interaction model for Kv channel-specific blocker complex, which may help guide future drug-design for Kv1.3-related channelopathies.

Nimotuzumab with cisplatin or fluorouracil on human esophageal squamous cell carcinoma EC1 cells.

OBJECTIVE: To investigate the effects of nimotuzumab (h-R3) with cisplatin (DDP) or fluorouracil (5-FU) on human esophageal squamous cell carcinoma (ESCC) EC1 cells. MATERIALS AND METHODS: The assignment included blank control, h-R3 alone, DDP alone, 5-FU alone, h-R3 combined with DDP, and h-R3 combined with 5-FU. The cell proliferation in each group was measured by MMT method 48 h post dose. The effect on the cell cycle was determined by flow cytometry, and the effect on cell apoptosis was determined by flow cytometry and TUNEL test 48 h post dose. RESULTS: The inhibitory effect of h-R3 on the proliferation of EC1 cells was weak. The maximum inhibition rate was 10.10 ± 0.58% 48 h post dose, and the difference in the inhibition rate between the h-R3 with chemotherapeutic agents and the chemotherapeutic agent alone was not statistically significant (p > 0.05). Flow cytometry demonstrated no obvious change in the EC1 cells after h-R3 treatment (p > 0.05). Flow cytometry and TUNEL test demonstrated that the difference in the apoptosis rate between h-R3 combined with chemotherapeutic agents and blank control was not statistically significant (p > 0.05). CONCLUSIONS: h-R3 had no significant effect on human ESCC EC1 cells in vitro, with or without the combination of chemotherapeutic agents.

Immunosuppressive activity of adipose tissue-derived mesenchymal stem cells in a rat model of hind limb allotransplantation.

Many reports have shown that bone marrow-derived mesenchymal stem cells exhibit immunosuppressive effects in allogeneic transplantation. However, few reports have evaluated the immunosuppressive properties of adipose tissue-derived mesenchymal stem cells (ASCs) in vitro and in vivo. In this study, we investigated the immunosuppressive characteristics of ASCs, and investigated whether ASCs originating from donor rats prolong allotransplant survival in a rat hind limb allotransplantation model. T-cell proliferation stimulated by allogeneic stimuli or mitogen with or without ASCs originating from the donor was assessed in vitro. The effects of cellular contact or soluble factors on the inhibition of T-cell proliferation were also evaluated. In the in vivo study, cultured ASCs (1 × 10(5)) that originated from the donor were injected into recipient animals intravenously immediately after operation, followed by 1 dose per day for 3 consecutive days post-transplantation. When immune rejection occurred, the survival time of allotransplants was determined and rejected tissue was histologically and immunochemically assessed for determining regulatory T-cell infiltration. ASCs inhibited the T-cell proliferation stimulated by alloantigen or mitogen in a dose-dependent manner, and recipient T cells proliferated less in animals treated with ASCs than in controls. Although ASCs were separated from T cells, ASCs persisted to elicit a suppressive effect. ASC culture supernatants did not inhibit T-cell proliferation; however, supernatants obtained from the mixed lymphocyte reaction in the presence of ASCs suppressed T-cell proliferation. ASCs prolonged allotransplant survival time, reduced inflammatory cell infiltration, and induced regulatory T cells. In conclusion, ASCs can exhibit in vitro immunosuppressive properties and prolong allotransplant survival time in a rat hind limb composite tissue allotransplantation model, possibly through the induction of regulatory T cells.

PKA phosphorylation reshapes the pharmacological kinetics of BmK AS, a unique site-4 sodium channel-specific modulator.

Although modulation of the activity of voltage-gated sodium channels (VGSCs) by protein kinase A (PKA) phosphorylation has been investigated in multiple preparations, the pharmacological sensitivity of VGSCs to scorpion toxins after PKA phosphorylation has rarely been approached. In this study, the effects of BmK AS, a sodium channel-specific modulator from Chinese scorpion Buthus martensi Karsch, on the voltage-dependent activation and inactivation of Nav1.2 were examined before and after PKA activation. After PKA phosphorylation, the pattern of dose-dependent modulation of BmK AS, on both Nav1.2α and Nav1.2 (α + ß1) was reshaped. Meanwhile, the shifts in voltage-dependency of activation and inactivation induced by BmK AS were attenuated. The results suggested that PKA might play a role in different patterns how ß-like toxins such as BmK AS modulate gating properties and peak currents of VGSCs.

In vivo detection of Hirschsprung's disease by optical coherence tomography in rats.

Hirschsprung's disease (HSCR) is a developmental intestinal obstruction, which is often diagnosed with a repeated biopsy. Optical coherence tomography (OCT) is a noninvasive, real-time imaging modality. This study aims to investigate the feasibility of diagnosis of HSCR, the targeted biopsies of suspicious tissues and the location of operative treatment using OCT. An HSCR Sprague-Dawley (SD) rat model (benzalkonium chloride-treated (BAC-treated)) was used. Colon tissues with BAC-treated and without BAC-treated were imaged using OCT. To establish OCT criteria for identification of HSCR, OCT images were compared with corresponding histology images and muscle layer thickness was measured. Furthermore, attenuation coefficients of OCT signals were calculated to illustrate the differences between tissues with BAC-treated and without BAC-treated. Our results show that OCT images of colon tissues with HSCR are well correlated with histology images. In comparison with a muscle layer without HSCR, the thickness of muscle layer with HSCR is increased significantly. The muscle layer in colon tissues with HSCR for 6 weeks had a higher attenuation coefficient than those without HSCR. However, the attenuation coefficient of those with HSCR for 3 weeks had no obvious change. In conclusion, the study demonstrates for the first time that OCT has the potential for diagnosis, biopsy and location of HSCR in vivo.

First Report of Tomato yellow leaf curl virus in Acalypha australis in China.

Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China.

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Novel transcripts of human cytomegalovirus clinical strain found by cDNA library screening.

Human cytomegalovirus (HCMV) is a double-stranded DNA virus with the largest genome (~235 kb) of the known human herpes viruses. The coding potential and transcript structures of most HCMV predicted genes have not been identified. New or unknown genes could exist in clinical strains. The SMART (switching mechanism at 5' end of RNA template of reverse transcriptase) technique was used to construct a full-length cDNA library of an HCMV clinical strain in the late expression phase. Randomly selected clones were sequenced. The sequenced expressed sequence tags were used to identify the expression and transcript structures of some predicted and unpredicted genes of HCMV. The transcripts of the UL99, TRL5/IRL5, UL73 to UL75, UL4, and UL115 genes, which were previously detected, were obtained with full-length structures from this library. Some novel transcripts, including several transcripts of UL/b' genes and three antisense transcripts of UL83, UL87 and UL31 were found. The novel transcripts that were found, particularly the antisense transcripts of UL83, UL87 and UL31, showed that the transcription of HCMV genes is more complex than previously predicted. Our study highlights the usefulness of the full-length cDNA library for discovering new genes and transcripts of HCMV.

Structure characterization of human cytomegalovirus UL131A, UL130 and UL128 genes in clinical strains in China.

Human cytomegalovirus (HCMV) genetic determinants of endothelial cell tropism, leukocytes and dendritic cells have been identified in the genes UL131A, UL130, and UL128. We examined the structure of these three genes in HCMV. Eighteen low-passage clinical isolates and five non-passage strains from congenitally HCMV-infected infants in China were used to assess the structures of the UL131A, UL130, and UL128 genes and to find possible relationships between sequence polymorphism and different signs of HCMV disease. Comparisons were made between the UL131A, UL130, and UL128 genes of clinical strains and published sequences of Towne and Merlin strains. The UL131A coding region in the clinical strains was similar to that of Towne and Merlin strains, while UL130, and UL128 coding regions in the clinical strains were parallel with those of Towne and Merlin, respectively. Sequence comparison indicated that the UL130, and UL128 genes encode chemokine-like proteins in the clinical strain; the transmembrane regions of UL131A, and UL130 were conserved in all clinical and reference strains. The three genes of clinical strains from infants with different signs of HCMV disease had similar structure characterization. We conclude that the UL131A, UL130, and UL128 genes are highly conserved in these clinical strains. No correlation was found between the structure of the three genes and variations in HCMV disease. The finding of chemokine-like domains in UL130, and UL128 putative proteins suggests that the predicted products play a role in HCMV infectivity.

Down-regulation of 67LR reduces the migratory activity of human glioma cells in vitro.

OBJECTIVES: Glioma is the most common brain tumor in central nervous system. Traditional therapies are not effective to cure this disease. Experimental evidence indicates that the 67 kDa elastin-laminin receptor (67LR) subunit is a high-affinity non-integrin laminin-binding protein that is over-expressed on the tumor cell surface in a variety of human carcinomas, and directly correlates with a higher proliferation rate of malignant cells and tendency to metastasize. However, little is known of the expression and function of 67LR in glioma cells. METHODS: In this study, we estimated whether 67LR was constitutively over-expressed in high-grade astrocytomas by immunohistochemical staining and Western blotting, and investigated the role of a low level of 67LR expression in glioma cell line-U251 by constructing an interfering RNA expression plasmid. RESULTS: The results showed that the 67LR had an enhanced over-expression in high-grade astrocytomas against normal brain tissues samples, and that the migratory activity of glioma cells was reduced after the down-regulation of the 67LR gene by RNAi. DISCUSSION: It was hypothesized that a low level of 67LR expression could reduce migratory activity of glioma cells, which further proved that 67LR played an important role in glioma invasion by mediating tumor cell functions leading to sarcomata. This study provided a new alternative to gene therapy for glioma treatment.

Anticonvulsant effect of BmK IT2, a sodium channel-specific neurotoxin, in rat models of epilepsy.

BACKGROUND AND PURPOSE: The sodium channel is a primary target for treating central nervous system disorders such as epilepsy. In this study the anticonvulsant effect of BmK IT2, a sodium channel-specific neurotoxin, was evaluated in different animal models of epilepsy. EXPERIMENTAL APPROACH: Experiments were performed on freely moving rats made epileptic by administration of either pentylenetetrazole (PTZ) or pilocarpine. BmK IT2 (0.05-0.5 microg in 2 microl) was microinjected into the CA1 area and its effects on PTZ-induced widespread, seizure-like behaviour and cortex epileptiform EEG, as well as on pilocarpine-induced seizure-like behaviour and c-Fos expression were studied. KEY RESULTS: Intrahippocampal application of BmK IT2 dose-dependently inhibited PTZ-induced seizure-like behaviour, and reduced the numbers and duration of the high amplitude and frequency discharges (HAFDs) of the epileptiform EEG component induced by PTZ. Similarly, in the pilocarpine-induced status epilepticus (SE) model, BmK IT2 significantly prolonged the latency to onset of the SE, reduced the severity of SE and suppressed hippocampal c-Fos expression during SE. CONCLUSIONS AND IMPLICATIONS: BmK IT2 showed anticonvulsant activity as it inhibited the widespread seizures induced by PTZ and pilocarpine-induced SE in rats. This activity might be due to the modulation of sodium channels in the hippocampus. Hence, BmK IT2 could be used as a novel tool to explore the molecular and pathological mechanisms of epilepsy with regard to the involvement of sodium channels.

Energy responses of the LiF series TL pellets to high-energy photons in the energy range from 1.25 to 21 MV.

The energy responses for the KLT-300(LiF:Mg,Cu,Na,Si, Korea), GR-200(LiF:Mg,Cu,P, China) and MCP-N(LiF:Mg,Cu,P, Poland) thermoluminescence(TL) pellets were studied for a photon radiation with energies from 1.25 MeV(60Co) to 21 MV (Microtron) to verify the usefulness of the calibration for the radiotherapy beams. The International Atomic Energy Agency (IAEA) and the World Health Organization (WHO) have performed thermoluminescence dosimetry (TLD) audits to verify the calibration of the beams by TL powder, but TL pellets were used in this study because the element correction factor (ECF), defined as the factor to correct the variations that all TL dosemeters cannot be manufactured to have exactly the same TL efficiency, for each TL pellet could be accurately derived and be handled conveniently when compared with the powder. Also several works for the energy response of the TLDs were done for the low-energy photon beams up to 60Co, but they will be extended in this experiment to the high photon energies (up to 20 MV), which are widely used in the therapy level of a radiation. The PTW 30006 ionisation chamber was calibrated by the Korea primary standards to establish the air-kerma rates and the TL pellets were irradiated in a specially designed waterproof pellet holder in a water phantom (30 x 30 x 30 cm3) just like the IAEA postal audits programme. This result was compared with that of another type of phantom [10 (W) x 10 (L) x 10 (H) cm3 PMMA Perspex phantom for the 60Co and 6 MV photon, and 10 x 10 x 20 (H) cm3 for the 10 and 21 MV photon] for its convenient use and easy handling and installation in a hospital. The results show that the differences of the responses for the water phantom and PMMA Perspex phantom were negligible, which is contrary to the general conception that a big difference would be expected. For an application of these results to verify the therapy beams, an appropriate energy correction factor should be applied to the energies and phantom types in use.