Anticancer compound ABT-263 accelerates apoptosis in virus-infected cells and imbalances cytokine production and lowers survival rates of infected mice.

ABT-263 and its structural analogues ABT-199 and ABT-737 inhibit B-cell lymphoma 2 (Bcl-2), BCL2L1 long isoform (Bcl-xL) and BCL2L2 (Bcl-w) proteins and promote cancer cell death. Here, we show that at non-cytotoxic concentrations, these small molecules accelerate the deaths of non-cancerous cells infected with influenza A virus (IAV) or other viruses. In particular, we demonstrate that ABT-263 altered Bcl-xL interactions with Bcl-2 antagonist of cell death (Bad), Bcl-2-associated X protein (Bax), uveal autoantigen with coiled-coil domains and ankyrin repeats protein (UACA). ABT-263 thereby activated the caspase-9-mediated mitochondria-initiated apoptosis pathway, which, together with the IAV-initiated caspase-8-mediated apoptosis pathway, triggered the deaths of IAV-infected cells. Our results also indicate that Bcl-xL, Bcl-2 and Bcl-w interact with pattern recognition receptors (PRRs) that sense virus constituents to regulate cellular apoptosis. Importantly, premature killing of IAV-infected cells by ABT-263 attenuated the production of key pro-inflammatory and antiviral cytokines. The imbalance in cytokine production was also observed in ABT-263-treated IAV-infected mice, which resulted in an inability of the immune system to clear the virus and eventually lowered the survival rates of infected animals. Thus, the results suggest that the chemical inhibition of Bcl-xL, Bcl-2 and Bcl-w could potentially be hazardous for cancer patients with viral infections.

Hexameric molecular motors: P4 packaging ATPase unravels the mechanism.

Genome packaging into an empty capsid is an essential step in the assembly of many complex viruses. In double-stranded RNA (dsRNA) bacteriophages of the Cystoviridae family this step is performed by a hexameric helicase P4 which is one of the simplest packaging motors found in nature. Biochemical and structural studies of P4 proteins have led to a surprising finding that these proteins bear mechanistic and structural similarities to a variety of the pervasive RecA/F1-ATPase-like motors that are involved in diverse biological functions. This review describes the role of P4 proteins in assembly, transcription and replication of dsRNA bacteriophages as it has emerged over the past decade while focusing on the most recent structural studies. The P4 mechanism is compared with the models proposed for the related hexameric motors.

Regulatory C protein of the EcoRV modification-restriction system.

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.