MicroRNA-148a Targets DNMT1 and PPARGC1A to Regulate the Viability, Proliferation, and Milk Fat Synthesis of Ovine Mammary Epithelial Cells.

In this study, the expression profiles of miR-148a were constructed in eight different ovine tissues, including mammary gland tissue, during six different developmental periods. The effect of miR-148a on the viability, proliferation, and milk fat synthesis of ovine mammary epithelial cells (OMECs) was investigated, and the target relationship of miR-148a with two predicted target genes was verified. The expression of miR-148a exhibited obvious tissue-specific and temporal-specific patterns. miR-148a was expressed in all eight ovine tissues investigated, with the highest expression level in mammary gland tissue (p < 0.05). Additionally, miR-148a was expressed in ovine mammary gland tissue during each of the six developmental periods studied, with its highest level at peak lactation (p < 0.05). The overexpression of miR-148a increased the viability of OMECs, the number and percentage of Edu-labeled positive OMECs, and the expression levels of two cell-proliferation marker genes. miR-148a also increased the percentage of OMECs in the S phase. In contrast, transfection with an miR-148a inhibitor produced the opposite effect compared to the miR-148a mimic. These results indicate that miR-148a promotes the viability and proliferation of OMECs in Small-tailed Han sheep. The miR-148a mimic increased the triglyceride content by 37.78% (p < 0.01) and the expression levels of three milk fat synthesis marker genes in OMECs. However, the miR-148a inhibitor reduced the triglyceride level by 87.11% (p < 0.01). These results suggest that miR-148a promotes milk fat synthesis in OMECs. The dual-luciferase reporter assay showed that miR-148a reduced the luciferase activities of DNA methyltransferase 1 (DNMT1) and peroxisome proliferator-activated receptor gamma coactivator 1-A (PPARGC1A) in wild-type vectors, suggesting that they are target genes of miR-148a. The expression of miR-148a was highly negatively correlated with PPARGC1A (r = -0.789, p < 0.001) in ovine mammary gland tissue, while it had a moderate negative correlation with DNMT1 (r = -0.515, p = 0.029). This is the first study to reveal the molecular mechanisms of miR-148a underlying the viability, proliferation, and milk fat synthesis of OMECs in sheep.

Diagnostic and prognostic value of double-negative T cells in colorectal cancer.

Objective: To evaluate the T-lymphocyte subset distribution and the diagnostic and prognosis value of double-negative T (DNT) cells in colorectal cancer (CRC). Methods: This retrospective study compared the T-lymphocyte subsets and DNT of 114 patients with CRC with those of 107 healthy controls (HC). The diagnostic potential of DNT and T-lymphocyte subsets was assessed using the receiver operating characteristic (ROC) curve, and prognostic values were evaluated using the Kaplan-Meier curve and the Cox regression model. Results: The percentages of CD8+ T cells and DNT cells, and value of carcinoembryonic antigen (CEA), were remarkably higher in patients with CRC than in those with HC, but the ratio of CD4+/CD8+ was decreased. Using ROC curve analysis, DNT cell percentage, CEA, and CD4+/CD8+ ratio all had good diagnostic efficacy, with areas under the curve (AUCs) of 0.865, 0.786 and 0.624, respectively. The combination of DNT cell percentage and CEA had an AUC of 0.905, which was significantly higher than that of any single biomarker (p < 0.05). In univariate analysis, the Tumor Node Metastasis (TNM) clinical stage, CD4+/CD8+ ratio, and DNT cell percentage were significantly associated with overall survival (OS) (p < 0.05). In multivariate analysis, TNM clinical staging (HR = 2.37, 95 % CI: 1.15-4.90), a decreased CD4+/CD8+ ratio (HR = 0.33, 95 % CI: 0.15-0.74), and an increased DNT cell percentage (HR = 2.29, 95 % CI: 1.11-4.73) were independent prognostic factors for CRC. Conclusion: The percentage of DNT cells may be useful as an evaluation index for CRC diagnosis and prognosis, which was even better when combined with serum CEA.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

PI3K/AKT/mTOR signaling pathway: an important driver and therapeutic target in triple-negative breast cancer.

Triple-negative breast cancer (TNBC) is a highly heterogeneous tumor lacking estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression. It has higher aggressiveness and metastasis than other subtypes, with limited effective therapeutic strategies, leading to a poor prognosis. The phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mechanistic target of rapamycin (mTOR) signaling pathway is prevalently over-activated in human cancers and contributes to breast cancer (BC) growth, survival, proliferation, and angiogenesis, which could be an interesting therapeutic target. This review summarizes the PI3K/AKT/mTOR signaling pathway activation mechanism in TNBC and discusses the relationship between its activation and various TNBC subtypes. We also report the latest clinical studies on kinase inhibitors related to this pathway for treating TNBC. Our review discusses the issues that need to be addressed in the clinical application of these inhibitors.

SAS: Split antibiotic selection for identifying chaperones that improve protein solubility.

Background: Heterologous expression of active, native-folded protein in Escherichia coli is critical in both academic research and biotechnology settings. When expressing non-native recombinant proteins in E. coli, obtaining soluble and active protein can be challenging. Numerous techniques can be used to enhance a proteins solubility, and largely focus on either altering the expression strain, plasmid vector features, growth conditions, or the protein coding sequence itself. However, there is no one-size-fits-all approach for addressing issues with protein solubility, and it can be both time and labor intensive to find a solution. An alternative approach is to use the co-expression of chaperones to assist with increasing protein solubility. By designing a genetic system where protein solubility is linked to viability, the appropriate protein folding factor can be selected for any given protein of interest. To this end, we developed a Split Antibiotic Selection (SAS) whereby an insoluble protein is inserted in-frame within the coding sequence of the hygromycin B resistance protein, aminoglycoside 7″-phosphotransferase-Ia (APH(7″)), to generate a tripartite fusion. By creating this tripartite fusion with APH(7″), the solubility of the inserted protein can be assessed by measuring the level of hygromycin B resistance of the cells. Results: We demonstrate the functionality of this system using a known protein and co-chaperone pair, the human mitochondrial Hsp70 ATPase domain (ATPase70) and its co-chaperone human escort protein (Hep). Insertion of the insoluble ATPase70 within APH(7'') renders the tripartite fusion insoluble and results in sensitivity to hygromycin B. Antibiotic resistance can be rescued by expression of the co-chaperone Hep which assists in the folding of the APH(7'')-ATPase70-APH(7'') tripartite fusion and find that cellular hygromycin B resistance correlates with the total soluble fusion protein. Finally, using a diverse chaperone library, we find that SAS can be used in a pooled genetic selection to identify chaperones capable of improving client protein solubility. Conclusions: The tripartite APH(7'') fusion links the in vivo solubility of the inserted protein of interest to hygromycin B resistance. This construct can be used in conjunction with a chaperone library to select for chaperones that increase the solubility of the inserted protein. This selection system can be applied to a variety of client proteins and eliminates the need to individually test chaperone-protein pairs to identify those that increase solubility.

Prognosis prediction and risk stratification of breast cancer patients based on a mitochondria-related gene signature.

As the malignancy with the highest global incidence, breast cancer represents a significant threat to women's health. Recent advances have shed light on the importance of mitochondrial function in cancer, particularly in metabolic reprogramming within tumors. Recognizing this, we developed a novel risk signature based on mitochondrial-related genes to improve prognosis prediction and risk stratification in breast cancer patients. In this study, transcriptome data and clinical features of breast cancer samples were extracted from two sources: the TCGA, serving as the training set, and the METABRIC, used as the independent validation set. We developed the signature using LASSO-Cox regression and assessed its prognostic efficacy via ROC curves. Furthermore, the signature was integrated with clinical features to create a Nomogram model, whose accuracy was validated through clinical calibration curves and decision curve analysis. To further elucidate prognostic variations between high and low-risk groups, we conducted functional enrichment and immune infiltration analyses. Additionally, the study encompassed a comparison of mutation landscapes and drug sensitivity, providing a comprehensive understanding of the differing characteristics in these groups. Conclusively, we established a risk signature comprising 8 mitochondrial-related genes-ACSL1, ALDH2, MTHFD2, MRPL13, TP53AIP1, SLC1A1, ME3, and BCL2A1. This signature was identified as an independent risk predictor for breast cancer patient survival, exhibiting a significant high hazard ratio (HR = 3.028, 95%CI 2.038-4.499, P < 0.001). Patients in the low-risk group showed a more favorable prognosis, with enhanced immune infiltration, distinct mutation landscapes, and greater sensitivity to anti-tumor drugs. In contrast, the high-risk group exhibited an adverse trend in these aspects. This risk signature represents a novel and effective prognostic indicator, suggesting valuable insights for patient stratification in breast cancer.

Development and analytical validation of a novel nasopharynx swab-based Epstein-Barr virus C promoter methylation quantitative assay for nasopharyngeal carcinoma detection.

OBJECTIVES: Epstein-Barr virus (EBV) C promoter (Cp) hypermethylation, a crucial factor for EBV latent infection of nasopharyngeal epithelial cells, has been recognized as a promising biomarker for nasopharyngeal carcinoma (NPC) detection. In this study, we develop a novel EBV Cp methylation quantification (E-CpMQ) assay and evaluate its diagnostic performance for NPC detection. METHODS: A novel qPCR assay for simultaneous quantification of methylated- and unmethylated EBV Cp was developed by the combinational modification of MethyLight and QASM, with an innovative calibrator to improve the detection accuracy and consistency. The NP swab samples and synthetic standards were used for the analytical validation of the E-CpMQ. The diagnostic efficacy of the developed E-CpMQ assay was validated in 137 NPC patients and 137 non-NPC controls. RESULTS: The E-CpMQ assay can detect the EBV Cp methylation ratio in one reaction system under 10 copies with 100 % recognition specificity, which is highly correlated to pyrosequencing with a correlation coefficient over 0.99. The calibrated E-CpMQ assay reduces the coefficient of variation by an average of 55.5 % with a total variance of less than 0.06 units standard deviation (SD). Linear methylation ratio detection range from 4.76 to 99.01 %. The sensitivity and specificity of the E-CpMQ respectively are 96.4 % (95 % CI: 91.7-98.8 %), 89.8 % (95 % CI: 83.5-94.3 %). CONCLUSIONS: The developed E-CpMQ assay with a calibrator enables accurate and reproducible EBV Cp methylation ratio quantification and offers a sensitive, specific, cost-effective method for NPC early detection.

A flavin-monooxygenase catalyzing oxepinone formation and the complete biosynthesis of vibralactone.

Oxepinone rings represent one of structurally unusual motifs of natural products and the biosynthesis of oxepinones is not fully understood. 1,5-Seco-vibralactone (3) features an oxepinone motif and is a stable metabolite isolated from mycelial cultures of the mushroom Boreostereum vibrans. Cyclization of 3 forms vibralactone (1) whose ß-lactone-fused bicyclic core originates from 4-hydroxybenzoate, yet it remains elusive how 4-hydroxybenzoate is converted to 3 especially for the oxepinone ring construction in the biosynthesis of 1. In this work, using activity-guided fractionation together with proteomic analyses, we identify an NADPH/FAD-dependent monooxygenase VibO as the key enzyme performing a crucial ring-expansive oxygenation on the phenol ring to generate the oxepin-2-one structure of 3. The crystal structure of VibO reveals that it forms a dimeric phenol hydroxylase-like architecture featured with a unique substrate-binding pocket adjacent to the bound FAD. Computational modeling and solution studies provide insight into the likely VibO active site geometry, and suggest possible involvement of a flavin-C4a-OO(H) intermediate.

An updated analysis on the association of GSTM1 polymorphism and smoking exposure with the increased risk of coronary heart disease.

OBJECTIVE: To undertake a meta-analysis to investigate if there is an association between the glutathione S-transferase mu 1 (GSTM1) gene polymorphism, coronary artery disease (CAD) susceptibility and smoking. METHODS: Electronic databases, including PubMed®, Web of Science and Embase®, were searched for relevant case-control studies. Data were extracted and the odds ratio (OR) was calculated and appropriate statistical methods were used for the meta-analysis. RESULTS: The analysis included eight studies with a total of 1880 cases with CAD and 1758 control subjects. The results of this meta-analysis demonstrated that there is no association between the GSTM1 null and CAD (OR 1.24, 95% confidence interval [CI] 1.00, 1.55). An increased risk of CAD was observed in the smoking population with the GSTM1 null genotype (OR 1.48, 95% CI 1.02, 2.15). Subgroup analyses of geographical region, genotyping method and publication language category demonstrated potential relationships among gene polymorphism, smoking and CAD. CONCLUSIONS: Based on the current literature, the GSTM1 null genotype was associated to CAD in the smoking population. The interaction between smoking and GSTM1 polymorphism may contribute to the susceptibility of CAD.