Improved polyketide production in C. glutamicum by preventing propionate-induced growth inhibition.

Corynebacterium glutamicum is a promising host for production of valuable polyketides. Propionate addition, a strategy known to increase polyketide production by increasing intracellular methylmalonyl-CoA availability, causes growth inhibition in C. glutamicum. The mechanism of this inhibition was unclear before our work. Here we provide evidence that accumulation of propionyl-CoA and methylmalonyl-CoA induces growth inhibition in C. glutamicum. We then show that growth inhibition can be relieved by introducing methylmalonyl-CoA-dependent polyketide synthases. With germicidin as an example, we used adaptive laboratory evolution to leverage the fitness advantage of polyketide production in the presence of propionate to evolve improved germicidin production. Whole-genome sequencing revealed mutations in germicidin synthase, which improved germicidin titer, as well as mutations in citrate synthase, which effectively evolved the native glyoxylate pathway to a new methylcitrate pathway. Together, our results show that C. glutamicum is a capable host for polyketide production and we can take advantage of propionate growth inhibition to drive titers higher using laboratory evolution or to screen for production of polyketides.

Abundant synthesis of long-chain polyunsaturated fatty acids in Eutreptiella sp. (Euglenozoa) revealed by chromatographic and transcriptomic analyses.

Algal lipids are important molecules to store energy in algae and transfer energy in the marine food chain, and are potential materials for high value nutraceuticals (e.g., omega-3 fatty acids) or biofuel production. However, how lipid biosynthesis is regulated is not well understood in many species including Eutreptiella from the phylum of Euglenozoa. Here, we characterized the fatty acid (FA) profile of an Eutreptiella species isolated from Long Island Sound, USA, using gas chromatography-tandem mass spectrometry (GC/MS/MS) and investigated their biosynthesis pathways by transcriptome sequencing. We discovered 24 types of FAs including a relatively high proportion of long-chain unsaturated FAs. The abundances of C16, C18, and saturated FAs decreased when phosphate in the culture medium was depleted. Among the 24 FAs, docosahexaenoic acid (C22:6∆4,7,10,13,16,19 ) was most abundant, suggesting that Eutreptiella sp. preferentially invests in the synthesis of long-chain polyunsaturated fatty acids (LC-PFAs). Further transcriptomic analysis revealed that Eutreptiella sp. likely synthesizes LC-PFAs via ∆8 pathway and uses type I and II fatty acid synthases. Using RT-qPCR, we found that some of the lipid synthesis genes, such as ß-ketoacyl-ACP reductase, fatty acid desaturase, acetyl-CoA carboxylase, acyl carrier protein, ∆8 desaturase, and Acyl-ACP thioesterase, were more actively expressed during light period, and two carbon fixation genes were up-regulated in the high-lipid illuminated cultures, suggesting a linkage between photosynthesis and lipid production. The lipid profile renders Eutreptiella sp. a nutritional prey and valuable source for nutraceuticals, and the biosynthesis pathway documented here will be useful for future research and applications.

Comparative genomics reveals diverse capsular polysaccharide synthesis gene clusters in emerging Raoultella planticola.

Raoultella planticola is an emerging zoonotic pathogen that is associated with rare but life-threatening cases of bacteremia, biliary tract infections, and urinary tract infections. Moreover, increasing antimicrobial resistance in the organism poses a potential threat to public health. In spite of its importance as a human pathogen, the genome of R. planticola remains largely unexplored and little is known about its virulence factors. Although lipopolysaccharides has been detected in R. planticola and implicated in the virulence in earlier studies, the genetic background is unknown. Here, we report the complete genome and comparative analysis of the multidrug-resistant clinical isolate R. planticola GODA. The complete genome sequence of R. planticola GODA was sequenced using single-molecule real-time DNA sequencing. Comparative genomic analysis reveals distinct capsular polysaccharide synthesis gene clusters in R. planticola GODA. In addition, we found bla TEM-57 and multiple transporters related to multidrug resistance. The availability of genomic data in open databases of this emerging zoonotic pathogen, in tandem with our comparative study, provides better understanding of R. planticola and the basis for future work.

Genome Sequencing and Comparative Analysis of Stenotrophomonas acidaminiphila Reveal Evolutionary Insights Into Sulfamethoxazole Resistance.

Stenotrophomonas acidaminiphila is an aerobic, glucose non-fermentative, Gram-negative bacterium that been isolated from various environmental sources, particularly aquatic ecosystems. Although resistance to multiple antimicrobial agents has been reported in S. acidaminiphila, the mechanisms are largely unknown. Here, for the first time, we report the complete genome and antimicrobial resistome analysis of a clinical isolate S. acidaminiphila SUNEO which is resistant to sulfamethoxazole. Comparative analysis among closely related strains identified common and strain-specific genes. In particular, comparison with a sulfamethoxazole-sensitive strain identified a mutation within the sulfonamide-binding site of folP in SUNEO, which may reduce the binding affinity of sulfamethoxazole. Selection pressure analysis indicated folP in SUNEO is under purifying selection, which may be owing to long-term administration of sulfonamide against Stenotrophomonas.

Revealing the transcriptomic complexity of switchgrass by PacBio long-read sequencing.

BACKGROUND: Switchgrass (Panicum virgatum L.) is an important bioenergy crop widely used for lignocellulosic research. While extensive transcriptomic analyses have been conducted on this species using short read-based sequencing techniques, very little has been reliably derived regarding alternatively spliced (AS) transcripts. RESULTS: We present an analysis of transcriptomes of six switchgrass tissue types pooled together, sequenced using Pacific Biosciences (PacBio) single-molecular long-read technology. Our analysis identified 105,419 unique transcripts covering 43,570 known genes and 8795 previously unknown genes. 45,168 are novel transcripts of known genes. A total of 60,096 AS transcripts are identified, 45,628 being novel. We have also predicted 1549 transcripts of genes involved in cell wall construction and remodeling, 639 being novel transcripts of known cell wall genes. Most of the predicted transcripts are validated against Illumina-based short reads. Specifically, 96% of the splice junction sites in all the unique transcripts are validated by at least five Illumina reads. Comparisons between genes derived from our identified transcripts and the current genome annotation revealed that among the gene set predicted by both analyses, 16,640 have different exon-intron structures. CONCLUSIONS: Overall, substantial amount of new information is derived from the PacBio RNA data regarding both the transcriptome and the genome of switchgrass.

Fungal Transcriptomics.

Transcriptomics, the study of RNA molecules, provides in-depth understanding of cellular functions and the genomic landscape of transcription. Transcriptomics refers to the study of all classes on RNA molecules including mRNA, tRNA, and siRNA. In this chapter, we specifically focus on mRNA, which encodes the protein-coding portion of the genomic DNA. We discuss the use of mRNA in annotation of genomes and in studying differential regulation of genes under experimental conditions.

Fungal Epigenomics: Detection and Analysis.

Across Eukaryota, DNA modifications play an important role in regulation of gene expression. While 5-methylcytosine (5mC) has been explored in depth, other modifications such as 6-methyladenine (6 mA) have historically been overlooked, in part due to technical difficulties in collecting/analyzing these data. However, recent technological advances have enabled exploration of these marks with much greater detail and on a larger scale. In this chapter, we discuss multiple methods for identifying and analyzing both 5mC and 6 mA across fungi.

Comparative genomics and transcriptomics depict ericoid mycorrhizal fungi as versatile saprotrophs and plant mutualists.

Some soil fungi in the Leotiomycetes form ericoid mycorrhizal (ERM) symbioses with Ericaceae. In the harsh habitats in which they occur, ERM plant survival relies on nutrient mobilization from soil organic matter (SOM) by their fungal partners. The characterization of the fungal genetic machinery underpinning both the symbiotic lifestyle and SOM degradation is needed to understand ERM symbiosis functioning and evolution, and its impact on soil carbon (C) turnover. We sequenced the genomes of the ERM fungi Meliniomyces bicolor, M. variabilis, Oidiodendron maius and Rhizoscyphus ericae, and compared their gene repertoires with those of fungi with different lifestyles (ecto- and orchid mycorrhiza, endophytes, saprotrophs, pathogens). We also identified fungal transcripts induced in symbiosis. The ERM fungal gene contents for polysaccharide-degrading enzymes, lipases, proteases and enzymes involved in secondary metabolism are closer to those of saprotrophs and pathogens than to those of ectomycorrhizal symbionts. The fungal genes most highly upregulated in symbiosis are those coding for fungal and plant cell wall-degrading enzymes (CWDEs), lipases, proteases, transporters and mycorrhiza-induced small secreted proteins (MiSSPs). The ERM fungal gene repertoire reveals a capacity for a dual saprotrophic and biotrophic lifestyle. This may reflect an incomplete transition from saprotrophy to the mycorrhizal habit, or a versatile life strategy similar to fungal endophytes.

Comparative genomics reveals diverse capsular polysaccharide synthesis gene clusters in emerging Raoultella planticola

Raoultella planticola is an emerging zoonotic pathogen that is associated with rare but life-threatening cases of bacteremia, biliary tract infections, and urinary tract infections. Moreover, increasing antimicrobial resistance in the organism poses a potential threat to public health. In spite of its importance as a human pathogen, the genome of R. planticola remains largely unexplored and little is known about its virulence factors. Although lipopolysaccharides has been detected in R. planticola and implicated in the virulence in earlier studies, the genetic background is unknown. Here, we report the complete genome and comparative analysis of the multidrug-resistant clinical isolate R. planticola GODA. The complete genome sequence of R. planticola GODA was sequenced using single-molecule real-time DNA sequencing. Comparative genomic analysis reveals distinct capsular polysaccharide synthesis gene clusters in R. planticola GODA. In addition, we found bla TEM-57 and multiple transporters related to multidrug resistance. The availability of genomic data in open databases of this emerging zoonotic pathogen, in tandem with our comparative study, provides better understanding of R. planticola and the basis for future work.

Widespread adenine N6-methylation of active genes in fungi.

N6-methyldeoxyadenine (6mA) is a noncanonical DNA base modification present at low levels in plant and animal genomes, but its prevalence and association with genome function in other eukaryotic lineages remains poorly understood. Here we report that abundant 6mA is associated with transcriptionally active genes in early-diverging fungal lineages. Using single-molecule long-read sequencing of 16 diverse fungal genomes, we observed that up to 2.8% of all adenines were methylated in early-diverging fungi, far exceeding levels observed in other eukaryotes and more derived fungi. 6mA occurred symmetrically at ApT dinucleotides and was concentrated in dense methylated adenine clusters surrounding the transcriptional start sites of expressed genes; its distribution was inversely correlated with that of 5-methylcytosine. Our results show a striking contrast in the genomic distributions of 6mA and 5-methylcytosine and reinforce a distinct role for 6mA as a gene-expression-associated epigenomic mark in eukaryotes.

Draft Genome Sequence of Coniochaeta ligniaria NRRL 30616, a Lignocellulolytic Fungus for Bioabatement of Inhibitors in Plant Biomass Hydrolysates.

Here, we report the first draft genome sequence (42.38 Mb containing 13,657 genes) of Coniochaeta ligniaria NRRL 30616, an ascomycete with biotechnological relevance in the bioenergy field given its high potential for bioabatement of toxic furanic compounds in plant biomass hydrolysates and its capacity to degrade lignocellulosic material.

BAYESIAN SPATIAL-TEMPORAL MODELING OF ECOLOGICAL ZERO-INFLATED COUNT DATA.

A Bayesian hierarchical model is developed for count data with spatial and temporal correlations as well as excessive zeros, uneven sampling intensities, and inference on missing spots. Our contribution is to develop a model on zero-inflated count data that provides flexibility in modeling spatial patterns in a dynamic manner and also improves the computational efficiency via dimension reduction. The proposed methodology is of particular importance for studying species presence and abundance in the field of ecological sciences. The proposed model is employed in the analysis of the survey data by the Northeast Fisheries Sciences Center (NEFSC) for estimation and prediction of the Atlantic cod in the Gulf of Maine - Georges Bank region. Model comparisons based on the deviance information criterion and the log predictive score show the improvement by the proposed spatial-temporal model.

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

Ectobiotic and endobiotic bacteria associated with Eutreptiella sp. isolated from Long Island Sound.

Diversity and functional association of bacteria with Eutreptiella sp. was investigated. 16S rDNA analysis of ectobiotic bacteria revealed various lineages of Alphaproteobacteria and abundant Gammaproteobacteria, specifically Marinobacter. Antibiotic treatment yielded axenic cultures, and experiments based on them indicated that ectobiotic bacteria likely provide vitamin B(12) and other growth-enhancing factors for the alga. Further, DAPI staining and transmission electron microscopy revealed endobiotic bacteria in the cytoplasm of algal cells. 16S rDNA analysis showed that the bacteria belonged to one species that was most closely related to Rickettsiales endosymbionts of other organisms and phylogenetically affiliated with a new group of aquatic Rickettsiales. Observations from a diel experiment indicated that the endobiotic bacteria reproduced asynchronously with Eutreptiella sp. and had no adverse effects on lipid production (bioenergetics) or growth of the host alga. Our study reveals a diverse microbiome associated with this euglenoid alga, offering a system for studying the roles of algae-bacteria associations.