Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Early recruitment of PARP-dependent m8A RNA methylation at DNA lesions is subsequently accompanied by active DNA demethylation.

RNA methylation, especially 6-methyladenosine (m6A)-modified RNAs, plays a specific role in DNA damage response (DDR). Here, we also observe that RNA modified at 8-methyladenosine (m8A) is recruited to UVA-damaged chromatin immediately after microirradiation. Interestingly, the level of m8A RNA at genomic lesions was reduced after inhibition of histone deacetylases and DNA methyltransferases. It appears in later phases of DNA damage response, accompanied by active DNA demethylation. Also, PARP inhibitor (PARPi), Olaparib, prevented adenosine methylation at microirradiated chromatin. PARPi abrogated not only m6A and m8A RNA positivity at genomic lesions, but also XRCC1, the factor of base excision repair (BER), did not recognize lesions in DNA. To this effect, Olaparib enhanced the genome-wide level of γH2AX. This histone modification interacted with m8A RNAs to a similar extent as m8A RNAs with DNA. Pronounced interaction properties we did not observe for m6A RNAs and DNA; however, m6A RNA interacted with XRCC1 with the highest efficiency, especially in microirradiated cells. Together, we show that the recruitment of m6A RNA and m8A RNA to DNA lesions is PARP dependent. We suggest that modified RNAs likely play a role in the BER mechanism accompanied by active DNA demethylation. In this process, γH2AX stabilizes m6A/m8A-positive RNA-DNA hybrid loops via its interaction with m8A RNAs. R-loops could represent basic three-stranded structures recognized by PARP-dependent non-canonical m6A/m8A-mediated DNA repair pathway.

The Highest Density of Phosphorylated Histone H1 Appeared in Prophase and Prometaphase in Parallel with Reduced H3K9me3, and HDAC1 Depletion Increased H1.2/H1.3 and H1.4 Serine 38 Phosphorylation.

BACKGROUND: Variants of linker histone H1 are tissue-specific and are responsible for chromatin compaction accompanying cell differentiation, mitotic chromosome condensation, and apoptosis. Heterochromatinization, as the main feature of these processes, is also associated with pronounced trimethylation of histones H3 at the lysine 9 position (H3K9me3). METHODS: By confocal microscopy, we analyzed cell cycle-dependent levels and distribution of phosphorylated histone H1 (H1ph) and H3K9me3. By mass spectrometry, we studied post-translational modifications of linker histones. RESULTS: Phosphorylated histone H1, similarly to H3K9me3, has a comparable level in the G1, S, and G2 phases of the cell cycle. A high density of phosphorylated H1 was inside nucleoli of mouse embryonic stem cells (ESCs). H1ph was also abundant in prophase and prometaphase, while H1ph was absent in anaphase and telophase. H3K9me3 surrounded chromosomal DNA in telophase. This histone modification was barely detectable in the early phases of mitosis. Mass spectrometry revealed several ESC-specific phosphorylation sites of H1. HDAC1 depletion did not change H1 acetylation but potentiated phosphorylation of H1.2/H1.3 and H1.4 at serine 38 positions. CONCLUSIONS: Differences in the level and distribution of H1ph and H3K9me3 were revealed during mitotic phases. ESC-specific phosphorylation sites were identified in a linker histone.

The SC-35 Splicing Factor Interacts with RNA Pol II and A-Type Lamin Depletion Weakens This Interaction.

The essential components of splicing are the splicing factors accumulated in nuclear speckles; thus, we studied how DNA damaging agents and A-type lamin depletion affect the properties of these regions, positive on the SC-35 protein. We observed that inhibitor of PARP (poly (ADP-ribose) polymerase), and more pronouncedly inhibitors of RNA polymerases, caused DNA damage and increased the SC35 protein level. Interestingly, nuclear blebs, induced by PARP inhibitor and observed in A-type lamin-depleted or senescent cells, were positive on both the SC-35 protein and another component of the spliceosome, SRRM2. In the interphase cell nuclei, SC-35 interacted with the phosphorylated form of RNAP II, which was A-type lamin-dependent. In mitotic cells, especially in telophase, the SC35 protein formed a well-visible ring in the cytoplasmic fraction and colocalized with ß-catenin, associated with the plasma membrane. The antibody against the SRRM2 protein showed that nuclear speckles are already established in the cytoplasm of the late telophase and at the stage of early cytokinesis. In addition, we observed the occurrence of splicing factors in the nuclear blebs and micronuclei, which are also sites of both transcription and splicing. This conclusion supports the fact that splicing proceeds transcriptionally. According to our data, this process is A-type lamin-dependent. Lamin depletion also reduces the interaction between SC35 and ß-catenin in mitotic cells.

Cell differentiation and aging accompanied by depletion of the ACE2 protein.

ACE2 was observed as the cell surface receptor of the SARS-CoV-2 virus. Interestingly, we also found ACE2 positivity inside the cell nucleus. The ACE2 levels changed during cell differentiation and aging and varied in distinct cell types. We observed ACE2 depletion in the aortas of aging female mice, similarly, the aging caused ACE2 decrease in the kidneys. Compared with that in the heart, brain and kidneys, the ACE2 level was the lowest in the mouse lungs. In mice exposed to nicotine, ACE2 was not changed in olfactory bulbs but in the lungs, ACE2 was upregulated in females and downregulated in males. These observations indicate the distinct gender-dependent properties of ACE2. Differentiation into enterocytes, and cardiomyocytes, caused ACE2 depletion. The cardiomyogenesis was accompanied by renin upregulation, delayed in HDAC1-depleted cells. In contrast, vitamin D2 decreased the renin level while ACE2 was upregulated. Together, the ACE2 level is high in non-differentiated cells. This protein is more abundant in the tissues of mouse embryos and young mice in comparison with older animals. Mostly, downregulation of ACE2 is accompanied by renin upregulation. Thus, the pathophysiology of COVID-19 disease should be further studied not only by considering the ACE2 level but also the whole renin-angiotensin system.

A device for investigation of natural cell mobility and deformability.

A microfluidic device made of polydimethylsiloxane was developed for continuous evaluation of natural migration mobility of many eukaryotic cells in relaxed and deformed state. The device was fabricated by standard photolithography and soft lithography techniques using the SU-8 3010 negative photoresist on a glass wafer as the master mold. The simple flow-free device exploits the chemotactic movement of cells through a set of mechanical barriers in the direction of concentration gradients of attractants. The barriers are formed by arrays of circular cross-section pillars with decreasing spacing 7, 5, and 3 µm. To pass through the obstacles, the cells are deformed and change their cytoskeletal architecture. The instantaneous migration velocities of cells are monitored in a time-lapse setup of the scanning confocal microscope. Thus, the cellular deformability and migratory activity can easily be evaluated. The functionality of the device was tested with model HeLa cells stably transfected with fluorescent Premo FUCCI Cell Cycle Sensor. The designed device has the potential to be implemented for testing the tendency of patients' tumors to metastasis.

N6-Adenosine Methylation in RNA and a Reduced m3G/TMG Level in Non-Coding RNAs Appear at Microirradiation-Induced DNA Lesions.

The DNA damage response is mediated by both DNA repair proteins and epigenetic markers. Here, we observe that N6-methyladenosine (m6A), a mark of the epitranscriptome, was common in RNAs accumulated at UV-damaged chromatin; however, inhibitors of RNA polymerases I and II did not affect the m6A RNA level at the irradiated genomic regions. After genome injury, m6A RNAs either diffused to the damaged chromatin or appeared at the lesions enzymatically. DNA damage did not change the levels of METTL3 and METTL14 methyltransferases. In a subset of irradiated cells, only the METTL16 enzyme, responsible for m6A in non-coding RNAs as well as for splicing regulation, was recruited to microirradiated sites. Importantly, the levels of the studied splicing factors were not changed by UVA light. Overall, if the appearance of m6A RNAs at DNA lesions is regulated enzymatically, this process must be mediated via the coregulatory function of METTL-like enzymes. This event is additionally accompanied by radiation-induced depletion of 2,2,7-methylguanosine (m3G/TMG) in RNA. Moreover, UV-irradiation also decreases the global cellular level of N1-methyladenosine (m1A) in RNAs. Based on these results, we prefer a model in which m6A RNAs rapidly respond to radiation-induced stress and diffuse to the damaged sites. The level of both (m1A) RNAs and m3G/TMG in RNAs is reduced as a consequence of DNA damage, recognized by the nucleotide excision repair mechanism.

DNA Damage Changes Distribution Pattern and Levels of HP1 Protein Isoforms in the Nucleolus and Increases Phosphorylation of HP1ß-Ser88.

The family of heterochromatin protein 1 (HP1) isoforms is essential for chromatin packaging, regulation of gene expression, and repair of damaged DNA. Here we document that γ-radiation reduced the number of HP1α-positive foci, but not HP1ß and HP1γ foci, located in the vicinity of the fibrillarin-positive region of the nucleolus. The additional analysis confirmed that γ-radiation has the ability to significantly decrease the level of HP1α in rDNA promoter and rDNA encoding 28S rRNA. By mass spectrometry, we showed that treatment by γ-rays enhanced the HP1ß serine 88 phosphorylation (S88ph), but other analyzed modifications of HP1ß, including S161ph/Y163ph, S171ph, and S174ph, were not changed in cells exposed to γ-rays or treated by the HDAC inhibitor (HDACi). Interestingly, a combination of HDACi and γ-radiation increased the level of HP1α and HP1γ. The level of HP1ß remained identical before and after the HDACi/γ-rays treatment, but HDACi strengthened HP1ß interaction with the KRAB-associated protein 1 (KAP1) protein. Conversely, HP1γ did not interact with KAP1, although approximately 40% of HP1γ foci co-localized with accumulated KAP1. Especially HP1γ foci at the periphery of nucleoli were mostly absent of KAP1. Together, DNA damage changed the morphology, levels, and interaction properties of HP1 isoforms. Also, γ-irradiation-induced hyperphosphorylation of the HP1ß protein; thus, HP1ß-S88ph could be considered as an important marker of DNA damage.

A role of the 53BP1 protein in genome protection: structural and functional characteristics of 53BP1-dependent DNA repair.

Nuclear architecture plays a significant role in DNA repair mechanisms. It is evident that proteins involved in DNA repair are compartmentalized in not only spontaneously occurring DNA lesions or ionizing radiation-induced foci (IRIF), but a specific clustering of these proteins can also be observed within the whole cell nucleus. For example, 53BP1-positive and BRCA1-positive DNA repair foci decorate chromocenters and can appear close to nuclear speckles. Both 53BP1 and BRCA1 are well-described factors that play an essential role in double-strand break (DSB) repair. These proteins are members of two protein complexes: 53BP1-RIF1-PTIP and BRCA1-CtIP, which make a "decision" determining whether canonical nonhomologous end joining (NHEJ) or homology-directed repair (HDR) is activated. It is generally accepted that 53BP1 mediates the NHEJ mechanism, while HDR is activated via a BRCA1-dependent signaling pathway. Interestingly, the 53BP1 protein appears relatively quickly at DSB sites, while BRCA1 is functional at later stages of DNA repair, as soon as the Mre11-Rad50-Nbs1 complex is recruited to the DNA lesions. A function of the 53BP1 protein is also linked to a specific histone signature, including phosphorylation of histone H2AX (γH2AX) or methylation of histone H4 at the lysine 20 position (H4K20me); therefore, we also discuss an epigenetic landscape of 53BP1-positive DNA lesions.

H3K9me3 and H4K20me3 represent the epigenetic landscape for 53BP1 binding to DNA lesions.

Methylation of histones H4 at lysine 20 position (H4K20me), which is functional in DNA repair, represents a binding site for the 53BP1 protein. Here, we show a radiation-induced increase in the level of H4K20me3 while the levels of H4K20me1 and H4K20me2 remained intact. H4K20me3 was significantly pronounced at DNA lesions in only the G1 phase of the cycle, while this histone mark was reduced in very late S and G2 phases when PCNA was recruited to locally micro-irradiated chromatin. H4K20me3 was diminished in locally irradiated Suv39h1/h2 double knockout (dn) fibroblasts, and the same phenomenon was observed for H3K9me3 and its binding partner, the HP1ß protein. Immunoprecipitation showed the existence of an interaction between H3K9me3-53BP1 and H4K20me3-53BP1; however, HP1ß did not interact with 53BP1. Together, H3K9me3 and H4K20me3 represent epigenetic markers that are important for the function of the 53BP1 protein in non-homologous end joining (NHEJ) repair. The very late S phase represents the cell cycle breakpoint when a DDR function of the H4K20me3-53BP1 complex is abrogated due to recruitment of the PCNA protein and other DNA repair factors of homologous recombination to DNA lesions.

Irradiation by γ-rays reduces the level of H3S10 phosphorylation and weakens the G2 phase-dependent interaction between H3S10 phosphorylation and γH2AX.

Histone posttranslational modifications regulate diverse nuclear functions, including DNA repair. Here, we use mass spectrometry, western blotting, immunohistochemistry and advanced confocal microscopy in order to show radiation-specific changes in the histone signature. We studied wild-type mouse embryonic stem cells (mESCs) and mESCs with a depletion of histone deacetylase 1 (HDAC1), which plays a role in DNA repair. Irradiation by γ-rays increased the S139 phosphorylation of histone H2AX but reduced the level of the H3K9-R17 peptide, which contains S10 phosphorylation (H3S10ph). On an individual cellular level, H3S10ph was low in highly γH2AX-positive UV laser-induced DNA lesions, and this nuclear distribution pattern was not changed by HDAC1 depletion. Despite this fact, spontaneous γH2AX-positive DNA lesions colocalized with large H3S10ph-positive nuclear bodies that appear in the G2 phase of the cell cycle. Similarly, by FLIM-FRET analysis, we observed an interaction between H3S10ph and γH2AX in the G2 phase. However, this interaction was reduced when cells were exposed to γ-rays. A mutual link between H3S10ph and γH2AX was not observed in the G1 phase of the cell cycle. Together, our data show that despite the fact that H3S10ph is not directly involved in DNA repair, a decrease in H3S10 phosphorylation and weakened interaction between H3S10ph and γH2AX is a result of radiation-induced damage of the genome. In this case, γ-irradiation also decreased the number of cells in the G1 phase, characterized by no interaction between H3S10ph and γH2AX.

Depletion of A-type lamins and Lap2α reduces 53BP1 accumulation at UV-induced DNA lesions and Lap2α protein is responsible for compactness of irradiated chromatin.

We studied how deficiency in lamins A/C and lamina-associated polypeptide 2α (Lap2α) affects DNA repair after irradiation. A-type lamins and Lap2α were not recruited to local DNA lesions and did not accumulate to γ-irradiation-induced foci (IRIF), as it is generally observed for well-known marker of DNA lesions, 53BP1 protein. At micro-irradiated chromatin of lmna double knockout (dn) and Lap2α dn cells, 53BP1 protein levels were reduced, compared to locally irradiated wild-type counterpart. Decreased levels of 53BP1 we also observed in whole populations of lmna dn and Lap2α dn cells, irradiated by UV light. We also studied distribution pattern of 53BP1 protein in a genome outside micro-irradiated region. In Lap2α deficient cells, identical fluorescence of mCherry-tagged 53BP1 protein was found at both microirradiated region and surrounding chromatin. However, a well-known marker of double strand breaks, γH2AX, was highly abundant in the lesion-surrounding genome of Lap2α deficient cells. Described changes, induced by irradiation in Lap2α dn cells, were not accompanied by cell cycle changes. In Lap2α dn cells, we additionally performed analysis by FLIM (Fluorescence Lifetime Imaging Microscopy) that showed different dynamic behavior of mCherry-tagged 53BP1 protein pools when it was compared with wild-type (wt) fibroblasts. This analysis revealed three different fractions of mCherry-53BP1 protein. Two of them showed identical exponential decay times (τ1 and τ3), but the decay rate of τ2 and amplitudes of fluorescence decays (A1-A3) were statistically different in wt and Lap2α dn fibroblasts. Moreover, γ-irradiation weakened an interaction between A-type lamins and Lap2α. Together, our results demonstrate how depletion of Lap2α affects DNA damage response (DDR) and how chromatin compactness is changed in Lap2α deficient cells exposed to radiation.

HDAC1 and HDAC3 underlie dynamic H3K9 acetylation during embryonic neurogenesis and in schizophrenia-like animals.

Although histone acetylation is one of the most widely studied epigenetic modifications, there is still a lack of information regarding how the acetylome is regulated during brain development and pathophysiological processes. We demonstrate that the embryonic brain (E15) is characterized by an increase in H3K9 acetylation as well as decreases in the levels of HDAC1 and HDAC3. Moreover, experimental induction of H3K9 hyperacetylation led to the overexpression of NCAM in the embryonic cortex and depletion of Sox2 in the subventricular ependyma, which mimicked the differentiation processes. Inducing differentiation in HDAC1-deficient mouse ESCs resulted in early H3K9 deacetylation, Sox2 downregulation, and enhanced astrogliogenesis, whereas neuro-differentiation was almost suppressed. Neuro-differentiation of (wt) ESCs was characterized by H3K9 hyperacetylation that was associated with HDAC1 and HDAC3 depletion. Conversely, the hippocampi of schizophrenia-like animals showed H3K9 deacetylation that was regulated by an increase in both HDAC1 and HDAC3. The hippocampi of schizophrenia-like brains that were treated with the cannabinoid receptor-1 inverse antagonist AM251 expressed H3K9ac at the level observed in normal brains. Together, the results indicate that co-regulation of H3K9ac by HDAC1 and HDAC3 is important to both embryonic brain development and neuro-differentiation as well as the pathophysiology of a schizophrenia-like phenotype.

Advanced Confocal Microscopy Techniques to Study Protein-protein Interactions and Kinetics at DNA Lesions.

Local microirradiation with lasers represents a useful tool for studies of DNA-repair-related processes in live cells. Here, we describe a methodological approach to analyzing protein kinetics at DNA lesions over time or protein-protein interactions on locally microirradiated chromatin. We also show how to recognize individual phases of the cell cycle using the Fucci cellular system to study cell-cycle-dependent protein kinetics at DNA lesions. A methodological description of the use of two UV lasers (355 nm and 405 nm) to induce different types of DNA damage is also presented. Only the cells microirradiated by the 405-nm diode laser proceeded through mitosis normally and were devoid of cyclobutane pyrimidine dimers (CPDs). We also show how microirradiated cells can be fixed at a given time point to perform immunodetection of the endogenous proteins of interest. For the DNA repair studies, we additionally describe the use of biophysical methods including FRAP (Fluorescence Recovery After Photobleaching) and FLIM (Fluorescence Lifetime Imaging Microscopy) in cells with spontaneously occurring DNA damage foci. We also show an application of FLIM-FRET (Fluorescence Resonance Energy Transfer) in experimental studies of protein-protein interactions.

An Endogenously Tagged Fluorescent Fusion Protein Library in Mouse Embryonic Stem Cells.

Embryonic stem cells (ESCs), with their dual capacity to self-renew and differentiate, are commonly used to study differentiation, epigenetic regulation, lineage choices, and more. Using non-directed retroviral integration of a YFP/Cherry exon into mouse ESCs, we generated a library of over 200 endogenously tagged fluorescent fusion proteins and present several proof-of-concept applications of this library. We show the utility of this library to track proteins in living cells; screen for pluripotency-related factors; identify heterogeneously expressing proteins; measure the dynamics of endogenously labeled proteins; track proteins recruited to sites of DNA damage; pull down tagged fluorescent fusion proteins using anti-Cherry antibodies; and test for interaction partners. Thus, this library can be used in a variety of different directions, either exploiting the fluorescent tag for imaging-based techniques or utilizing the fluorescent fusion protein for biochemical pull-down assays, including immunoprecipitation, co-immunoprecipitation, chromatin immunoprecipitation, and more.

Mutations in the TP53 gene affected recruitment of 53BP1 protein to DNA lesions, but level of 53BP1 was stable after γ-irradiation that depleted MDC1 protein in specific TP53 mutants.

53BP1 is a very well-known protein that is recruited to DNA lesions. The focal accumulation of p53 binding protein, 53BP1, is a main feature indicating the repair of spontaneous or irradiation-induced foci (IRIF). Thus, here, we addressed the question of whether mutations in the TP53 gene, which often affect the level of p53 protein, can change the recruitment of 53BP1 to γ- or UVA-irradiated chromatin. In various TP53 mutants, we observed a distinct accumulation of 53BP1 protein to UV-induced DNA lesions: in R273C mutants, 53BP1 appeared transiently at DNA lesions, during 10-30 min after irradiation; the mutation R282W was responsible for accumulation of 53BP1 immediately after UVA-damage; and in L194F mutants, the first appearance of 53BP1 protein at the lesions occurred during 60-70 min. These results showed that specific mutations in the TP53 gene stand behind not only different levels of p53 protein, but also affect the localized kinetics of 53BP1 protein in UVA-damaged chromatin. However, after γ-irradiation, only G245S mutation in TP53 gene was associated with surprisingly decreased level of 53BP1 protein. In other mutant cell lines, levels of 53BP1 were not affected by γ-rays. To these effects, we conversely found a distinct number of 53BP1-positive irradiation-induced foci in various TP53 mutants. The R280K, G245S, L194F mutations, or TP53 deletion were also characterized by radiation-induced depletion in MDC1 protein. Moreover, in mutant cells, an interaction between MDC1 and 53BP1 proteins was abrogated when compared with wild-type counterpart. Together, the kinetics of 53BP1 accumulation at UV-induced DNA lesions is different in various TP53 mutant cells. After γ-irradiation, despite changes in a number and a volume of 53BP1-positive foci, levels of 53BP1 protein were relatively stable. Here, we showed a link between the status of MDC1 protein and TP53 gene, which specific mutations caused radiation-induced MDC1 down-regulation. This observation is significant, especially with regard to radiotherapy of tumors with abrogated function of TP53 gene.

Neural Differentiation in HDAC1-Depleted Cells Is Accompanied by Coilin Downregulation and the Accumulation of Cajal Bodies in Nucleoli.

Cajal bodies (CBs) are important compartments containing accumulated proteins that preferentially regulate RNA-related nuclear events, including splicing. Here, we studied the nuclear distribution pattern of CBs in neurogenesis. In adult brains, coilin was present at a high density, but CB formation was absent in the nuclei of the choroid plexus of the lateral ventricles. Cells of the adult hippocampus were characterized by a crescent-like morphology of coilin protein. We additionally observed a 70 kDa splice variant of coilin in adult mouse brains, which was different to embryonic brains and mouse pluripotent embryonic stem cells (mESCs), characterized by the 80 kDa standard variant of coilin. Here, we also showed that depletion of coilin is induced during neural differentiation and HDAC1 deficiency in mESCs caused coilin accumulation inside the fibrillarin-positive region of the nucleoli. A similar distribution pattern was observed in adult brain hippocampi, characterized by lower levels of both coilin and HDAC1. In summary, we observed that neural differentiation and HDAC1 deficiency lead to coilin depletion and coilin accumulation in body-like structures inside the nucleoli.

Function of heterochromatin protein 1 during DNA repair.

This review focuses on the function of heterochromatin protein HP1 in response to DNA damage. We specifically outline the regulatory mechanisms in which HP1 and its interacting partners are involved. HP1 protein subtypes (HP1α, HP1ß, and HP1γ) are the main components of constitutive heterochromatin, and HP1α and HP1ß in particular are responsible for heterochromatin maintenance. The recruitment of these proteins to DNA lesions is also important from the perspective of proper DNA repair mechanisms. For example, HP1α is necessary for the binding of the main DNA damage-related protein 53BP1 at DNA repair foci, which are positive not only for the HP1α protein but also for the RAD51 protein, a component of DNA repair machinery. The HP1ß protein also appears in monomeric form in DNA lesions together with the evolutionarily well-conserved protein called proliferating cell nuclear antigen (PCNA). The role of HP1 in DNA lesions is also mediated via the Kap1 transcription repressor. Taken together, these results indicate that the function of HP1 after DNA injury depends strongly on the kinetics of other DNA repair-related factors and their post-translational modifications, such as the phosphorylation of Kap-1.

PCNA is recruited to irradiated chromatin in late S-phase and is most pronounced in G2 phase of the cell cycle.

DNA repair is a complex process that prevents genomic instability. Many proteins play fundamental roles in regulating the optimal repair of DNA lesions. Proliferating cell nuclear antigen (PCNA) is a key factor that initiates recombination-associated DNA synthesis after injury. Here, in very early S-phase, we show that the fluorescence intensity of mCherry-tagged PCNA after local micro-irradiation was less than the fluorescence intensity of non-irradiated mCherry-PCNA-positive replication foci. However, PCNA protein accumulated at locally irradiated chromatin in very late S-phase of the cell cycle, and this effect was more pronounced in the following G2 phase. In comparison to the dispersed form of PCNA, a reduced mobile fraction appeared in PCNA-positive replication foci during S-phase, and we observed similar recovery time after photobleaching at locally induced DNA lesions. This diffusion of mCherry-PCNA in micro-irradiated regions was not affected by cell cycle phases. We also studied the link between function of PCNA and A-type lamins in late S-phase. We found that the accumulation of PCNA at micro-irradiated chromatin is identical in wild-type and A-type lamin-deficient cells. Only micro-irradiation of the nuclear interior, and thus the irradiation of internal A-type lamins, caused the fluorescence intensity of mCherry-tagged PCNA to increase. In summary, we showed that PCNA begins to play a role in DNA repair in late S-phase and that PCNA function in repair is maintained during the G2 phase of the cell cycle. However, PCNA mobility is reduced after local micro-irradiation regardless of the cell cycle phase.

Localized Movement and Levels of 53BP1 Protein Are Changed by γ-irradiation in PML Deficient Cells.

We studied epigenetics, distribution pattern, kinetics, and diffusion of proteins recruited to spontaneous and γ-radiation-induced DNA lesions. We showed that PML deficiency leads to an increased number of DNA lesions, which was accompanied by changes in histone signature. In PML wt cells, we observed two mobile fractions of 53BP1 protein with distinct diffusion in spontaneous lesions. These protein fractions were not detected in PML-deficient cells, characterized by slow-diffusion of 53BP1. Single particle tracking analysis revealed limited local motion of 53BP1 foci in PML double null cells and local motion 53BP1 foci was even more reduced after γ-irradiation. However, radiation did not change co-localization between 53BP1 nuclear bodies and interchromatin granule-associated zones (IGAZs), nuclear speckles, or chromocenters. This newly observed interaction pattern imply that 53BP1 protein could be a part of not only DNA repair, but also process mediated via components accumulated in IGAZs, nuclear speckles, or paraspeckles. Together, PML deficiency affected local motion of 53BP1 nuclear bodies and changed composition and a number of irradiation-induced foci. J. Cell. Biochem. 117: 2583-2596, 2016. © 2016 Wiley Periodicals, Inc.