Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 122
Filtrar
1.
Biomater Adv ; 166: 214048, 2024 Sep 19.
Artigo em Inglês | MEDLINE | ID: mdl-39317044

RESUMO

Designing bio-based polyurethane materials with excellent mechanical, biocompatibility, and self-healing properties simultaneously is currently a significant challenge due to the increasing demands for high-performance materials. In this study, we propose an asymmetric backbone strategy utilizing bio-based polycarbonate as the soft segment, equimolar ratios of lysine diisocyanate and isophorone diisocyanate as asymmetric hard segments, and isophorone diamine as the chain extender. The resulting polyurethane elastomers exhibit excellent mechanical properties, including high tensile stress (46.1 MPa), toughness (213.9 MJ/m3), and fracture energy (98.47 kJ/m3). The polyurethane elastomers demonstrate good self-healing and recyclable properties under simple heat treatment. Furthermore, biological experiments confirm the degradability and bio-safety of the bio-based polyurethane elastomers, which have shown potential in accelerating wound healing in mice when used as surgical sutures. These findings highlight the promising prospects of the obtained polyurethane elastomers in various applications, including biomedicine, flexible sensing, and electronic components.

2.
Mol Med Rep ; 30(4)2024 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-39155879

RESUMO

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR­545­3p (5'­TGGCTCAGTTCAGCAGGAAC­3') was actually for miR­24­3p (5'­UGGCUCAGUUCAGCAGGAACAG­3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR­670­5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR­670­5p and miR­545­3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

3.
Sci Total Environ ; 929: 172417, 2024 Jun 15.
Artigo em Inglês | MEDLINE | ID: mdl-38631633

RESUMO

Soil erosion plays a crucial role in soil organic carbon (SOC) redistribution and mineralization. Meanwhile, the soil extracellular enzymes (EEs) drive C mineralization. However, the response of soil EEs mediated SOC mineralization to soil erosion remains unclear. We investigated the SOC and soil EEs distribution in long gentle sloping farmland (LGSF) under slop-ridge tillage (SRT) and cross-ridge tillage (CRT) in the black soil region (BSR) of northeast China. The results indicated that the SOC mineralization at the upper slope position was higher than that on the toe-slope (133 % âˆ¼ 340 %) under CRT. However, for SRT, SOC mineralization on the back-slope was 126 % and 164 % higher than on the summit- and shoulder-slope. The SOC, dissolved organic carbon (DOC) content, and ß-glucosidase (BG) activities underwent spatial migration and deposition in the lower region under both tillage practices. As for CRT, the SOC content of the back-slope was 19.21 % higher than on the summit-slope, while the DOC content at the back-slope was 29.20 % higher than on the toe-slope. The BG activity was the highest at the toe-slope, followed by the foot-and back-slope, which were 41.74 %-74.73 % higher than at the summit-slope. As for SRT, the SOC, DOC, and BG activities on the back-slope were significantly higher than other slope positions (P < 0.05). The SOC on the back-slope were 47.82 % and 31.72 % higher than those on the summit- and shoulder-slope, respectively. The DOC and BG on the back-slope were 10.98 % and 67.78 % higher than on the summit-slope. The soil EES results indicated strong C and P limitation. Spatial differences in soil C distribution resulted in a significant positive correlation between C limitation and mineralization. This indicated that soil C and nutrient distribution under different slope positions driven by soil erosion, leading to soil nutrient limitation, is a key factor influencing spatial differences in C sources or sinks.

4.
Surg Endosc ; 38(5): 2444-2453, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38453750

RESUMO

BACKGROUND: Peroral endoscopic myotomy (POEM) has emerged as a widely accepted treatment for achalasia, with limited studies for over 2 years. Additionally, traditional measurements of achalasia after POEM have deficiencies. The study aimed to analyze the long-term outcomes of POEM under different criteria. METHODS: Patients with achalasia who received POEM between November 2012 and March 2021 were recruited. Patients and characteristics were shown, and risk factors related to two novel definitions of recurrence, symptomatic reflux, and reflux esophagitis were analyzed. RESULTS: Three hundred and twenty-one patients were included. At a median follow-up of 52 months, twenty-three failures happened (7.17%) under the modified criterion, and forty-seven failures occurred (14.64%) under the normal standard. Hospitalization (P = 0.027) and esophageal myotomy length (P = 0.039) were significantly associated with long-term efficacy under the modified and normal criteria, respectively. Fifty-two patients (16.20%) reported reflux symptoms and endoscopy performed in 88 patients revealed reflux esophagitis in 22 cases (25.00%). There were no predictors in the analysis of symptomatic reflux and gender (P = 0.010), LESP (P = 0.013), IRP (P = 0.015), and the esophageal myotomy length (P = 0.032) were statistically related to reflux esophagitis. CONCLUSION: POEM is an extremely safe and effective treatment for achalasia with long-term follow-up. Shorter hospitalization and shorter esophageal myotomy length may decrease the incidence of recurrence under the modified and normal criteria, respectively. Long-term outcomes of POEM are unpredictable. No risk factors were related to symptomatic reflux, and male patients with low preoperative LESP and IRP needed relatively shorter esophageal myotomy to prevent reflux esophagitis.


Assuntos
Acalasia Esofágica , Humanos , Acalasia Esofágica/cirurgia , Masculino , Feminino , Pessoa de Meia-Idade , Adulto , Resultado do Tratamento , Miotomia/métodos , Cirurgia Endoscópica por Orifício Natural/métodos , Recidiva , Idoso , Seguimentos , Esofagoscopia/métodos , Estudos Retrospectivos , Adulto Jovem , Adolescente , Esofagite Péptica/etiologia , Esofagite Péptica/prevenção & controle , Fatores de Risco
5.
Luminescence ; 39(4): e4729, 2024 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-38548706

RESUMO

To further explore the relationship between aryl substituents and mechanofluorochromic (MFC) behaviors, four salicylaldimine-based difluoroboron complexes (ts-Ph BF2, ts-Ph-NA BF2, ts-2NA BF2, and ts-triphenylamine [TPA] BF2), including aromatic substituents with different steric hindrance effects, were designed and successfully synthesized. Four complexes with twisted molecular conformation displayed intramolecular charge transfer and aggregation-induced emission properties. Under external mechanical stimuli, the as-synthesized powders of ts-Ph BF2, ts-Ph-NA BF2, and ts-TPA BF2 exhibited redshift fluorescence emission behaviors, and ts-Ph BF2 and ts-TPA BF2 could be recovered to original shifts by fuming, but ts-Ph-NA BF2 displayed irreversible switching. ts-2NA BF2 had no change during the grinding and fuming processes. The results indicated that the MFC behaviors could be attributed to the phase transformation between the well-defined crystalline and disordered amorphous states by X-ray diffraction measurement. Further research illustrated that ts-TPA BF2 with the most significant MFC phenomenon could be applied in data security protection in ink-free rewritable paper.


Assuntos
Segurança Computacional , Difração de Raios X
6.
Biol Reprod ; 110(1): 48-62, 2024 Jan 13.
Artigo em Inglês | MEDLINE | ID: mdl-37812443

RESUMO

Genomic integrity is critical for sexual reproduction, ensuring correct transmission of parental genetic information to the descendant. To preserve genomic integrity, germ cells have evolved multiple DNA repair mechanisms, together termed as DNA damage response. The RNA N6-methyladenosine is the most abundant mRNA modification in eukaryotic cells, which plays important roles in DNA damage response, and YTH N6-methyladenosine RNA binding protein 2 (YTHDF2) is a well-acknowledged N6-methyladenosine reader protein regulating the mRNA decay and stress response. Despite this, the correlation between YTHDF2 and DNA damage response in germ cells, if any, remains enigmatic. Here, by employing a Ythdf2-conditional knockout mouse model as well as a Ythdf2-null GC-1 mouse spermatogonial cell line, we explored the role and the underlying mechanism for YTHDF2 in spermatogonial DNA damage response. We identified that, despite no evident testicular morphological abnormalities under the normal circumstance, conditional mutation of Ythdf2 in adult male mice sensitized germ cells, including spermatogonia, to etoposide-induced DNA damage. Consistently, Ythdf2-KO GC-1 cells displayed increased sensitivity and apoptosis in response to DNA damage, accompanied by the decreased SET domain bifurcated 1 (SETDB1, a histone methyltransferase) and H3K9me3 levels. The Setdb1 knockdown in GC-1 cells generated a similar phenotype, but its overexpression in Ythdf2-null GC-1 cells alleviated the sensitivity and apoptosis in response to DNA damage. Taken together, these results demonstrate that the N6-methyladenosine reader YTHDF2 promotes DNA damage repair by positively regulating the histone methyltransferase SETDB1 in spermatogonia, which provides novel insights into the mechanisms underlying spermatogonial genome integrity maintenance and therefore contributes to safe reproduction.


Assuntos
Acetatos , Fenóis , Proteínas de Ligação a RNA , Espermatogônias , Animais , Masculino , Camundongos , Dano ao DNA , Reparo do DNA , Histona Metiltransferases/genética , Histona Metiltransferases/metabolismo , Histona-Lisina N-Metiltransferase/genética , Histona-Lisina N-Metiltransferase/metabolismo , Proteínas de Ligação a RNA/genética , Proteínas de Ligação a RNA/metabolismo , Espermatogônias/metabolismo , Fatores de Transcrição/genética
7.
J Clin Gastroenterol ; 58(1): 31-38, 2024 01 01.
Artigo em Inglês | MEDLINE | ID: mdl-36730560

RESUMO

GOALS: A combination of multiple tests was introduced to noninvasively investigate the differences in pathophysiologies among functional dyspepsia (FD) subgroups, including postprandial distress syndrome (PDS), epigastric pain syndrome (EPS), and overlap. BACKGROUND: It has not been extensively evaluated whether different pathophysiologies are involved in FD subgroups. STUDY: This multicenter study included 364 FD patients fulfilling Rome IV criteria and 47 healthy controls. A combined noninvasive gastric and autonomic function test was performed: The electrogastrogram and electrocardiogram were recorded simultaneously in the fasting state and after a drink test. Symptoms after drinking were recorded using visual analog scale. RESULTS: (1) Compared with HC, FD patients showed a decreased maximum tolerable volume (MTV) ( P <0.01) and percentage of normal gastric slow waves [normal gastric slow waves (%NSW)] ( P <0.01), and increased postdrinking symptoms, anxiety ( P <0.01), and depression ( P <0.01). The drink reduced %NSW in both FD patients and HC; however, the effect was more potent in patients. (2) The PDS and overlap groups displayed a reduced MTV ( P <0.05). The overlap group exhibited a higher symptom score at 30 minutes after drinking, and higher anxiety and depression scores, and a higher sympathovagal ratio than the EPS ( P <0.05 for all) and PDS ( P <0.01 for all). (3) In the PDS subgroup, the MTV, postprandial sympathovagal ratio, and depression were associated with the overall dyspepsia symptom scale (DSS, P =0.034, 0.021, 0.043, respectively). No significant associations were found in the other 2 subgroups. CONCLUSIONS: The combination of multiple tests can detect pathophysiological abnormities in FD patients. Overall, patients with overlap symptoms display more severe pathophysiologies.


Assuntos
Dispepsia , Gastrite , Humanos , Dor Abdominal/etiologia , Dor Abdominal/diagnóstico , Gastrite/complicações , Período Pós-Prandial/fisiologia
8.
ChemSusChem ; 17(5): e202301656, 2024 Mar 08.
Artigo em Inglês | MEDLINE | ID: mdl-38102888

RESUMO

A major hindrance in the commercialization of alkaline polyelectrolyte-based electrochemical energy conversion devices is the development of durable anion exchange membranes (AEMs). Despite many alkali-stable cations that have been explored, the stability of these cationic moieties at the membrane scale is in the blind. Herein, we present a molecularly designed polyaromatic AEM with cationic moieties in an alternating manner to unbiasedly compare the alkaline stability of piperidinium and ammonium groups at the membrane state. Using nuclear magnetic resonance spectroscopy, we demonstrate that the pentyltrimethyl group is about 2-fold more stable than piperidinium within a polyaromatic scaffold, either in ex-situ alkaline soaking or in-situ cell operation. This finding challenges the judgment extrapolated from the stability trend of cations, that is, the piperidinium-functionalized AEM is more alkali-stable than the counterparts based on quaternary ammoniums. Moreover, the deterioration mechanism of piperidinium moiety after being embedded in polyaromatic backbone is rationalized by density functional theory.

9.
Am J Cancer Res ; 13(11): 5082-5093, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38058832

RESUMO

OBJECTIVE: To establish and validate a nomogram model for predicting the risk of cholangiocarcinoma with perineural invasion. METHODS: We retrospectively collected the clinical data of 356 patients with surgically confirmed cholangiocarcinoma, including 98 cases of extrahepatic cholangiocarcinoma (eCCA), 197 cases of intrahepatic cholangiocarcinoma (iCCA), and 61 cases of perihilar cholangiocarcinoma (pCCA). RESULTS: Based on these data, we determined the influencing factors of preoperative perineural invasion risk in patients with cholangiocarcinoma by forward multivariate regression analysis. Based on these variables, we established two nomogram models. The model variables for predicting perineural invasion of eCCA included prothrombin time, high-density lipoprotein and tumor size (all P<0.05). The consistency index (C-index) of internal and external validation was 0.845 and 0.806, respectively. In addition, the model variables for predicting perineural invasion of iCCA included carcinoembryonic antigen, carbohydrate antigen 19-9 and tumor size (all P<0.05). The internal and external validation of the C-index was 0.735 and 0.886, respectively. Both models have considerable results in terms of calibration accuracy and clinical decision-making. Kaplan-Meier survival analysis showed that the survival time of patients with perineural invasion was significantly reduced (P=0.033). CONCLUSIONS: We established a predictive model for preoperative perineural invasion in patients with iCCA and eCCA, and this model can provide good predictive value for clinicians. However, we have not obtained relevant predictive variables for predicting perineural invasion of pCCA, and the number of modeling cases was relatively small, so this study needs to be further explored.

10.
ACS Omega ; 8(45): 42028-42044, 2023 Nov 14.
Artigo em Inglês | MEDLINE | ID: mdl-38024735

RESUMO

Light addressable potentiometric sensors (LAPS) are a competitive tool for unmarked biochemical imaging, especially imaging on microscale. It is essential to optimize the imaging speed and spatial resolution of LAPS since the imaging targets of LAPS, such as cell, microfluidic channel, etc., require LAPS to image at the micrometer level, and a fast enough imaging speed is a prerequisite for the dynamic process involved in biochemical imaging. In this study, we discuss the improvement of LAPS in terms of imaging speed and spatial resolution. The development of LAPS in imaging speed and spatial resolution is demonstrated by the latest applications of biochemistry monitoring and imaging on the microscale.

11.
Adv Sci (Weinh) ; 10(33): e2303421, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-37822163

RESUMO

Broadband near-infrared (NIR) photonic materials have wide applications. Although extensive studies on rare-earth, transition-metal, and even semiconductor-activated materials have enabled the development of a rich NIR material pool, developing broadband and efficient photonic candidates covering the NIR I and II regions from 750 to 1500 nm has been met with limited success. Here, it is reported that a subnano Te cluster with a characteristic configuration different from that of the ion state may fill the aforementioned gap. Further, a strategy is proposed for the in situ generation and stabilization of Te clusters by tuning the cluster evolution in glass. A novel active photonic glass embedded with a Te cluster is fabricated; it exhibits intense and broadband short-wave NIR luminescence with a central wavelength at 1030 nm and a bandwidth exceeding 330 nm. Interestingly, the glass exhibited a full visible-spectrum conversion ability from 300 to 800 nm. The application of this unique broadband excitation feature for night vision and tissue penetration is demonstrated using a smartphone as the excitation source. These findings demonstrate a fundamental principle of cluster design in glass for creating new properties and provide a new direction for developing novel cluster-derived functional composite materials.

12.
BMC Cancer ; 23(1): 912, 2023 Sep 28.
Artigo em Inglês | MEDLINE | ID: mdl-37770853

RESUMO

Long non-coding RNAs (lncRNAs) play important roles in many pathophysiological processes, including cancer progression. Namely, lncRNA Receptor-tyrosine-kinase-like orphan receptor-1 antisense 1 (ROR1-AS1) is crucial for cancer occurrence and progression in organs such as the liver or bladder. However, its expression and role in cholangiocarcinoma (CCA) have not been thoroughly explored.Firstly, we assessed cell viability, proliferation, invasion, and migration using three cell lines (HuCCT-1, QBC399, and RBE) to explore the biological characteristics of ROR1-AS1 in CCA. Secondly, to determine the in vivo effect of ROR1-AS1 on tumor growth, ROR1-AS1 knockdown (KD) HuCCT-1 cells were subcutaneously injected into nude mice to evaluate tumor growth. Finally, we conducted a bioinformatic analysis to confirm the role of ROR1-AS1 in the prognosis and immunity of CCA.In this study, we found that lncRNA ROR1-AS1 was increased in CCA samples and patients with higher ROR1-AS1 expression had a shorter overall survival period. siRNA-mediated KD of ROR1-AS1 significantly reduced cell proliferation and inhibited the migration of CCA cells. In addition, ROR1-AS1 KD HuCCT-1 cells injected into nude mice grew slower than normal CCA cells.In summary, our results show that ROR1-AS1 can promote CCA progression and might serve as a new target for diagnosis and treatment of CCA.


Assuntos
Neoplasias dos Ductos Biliares , Colangiocarcinoma , MicroRNAs , RNA Longo não Codificante , Animais , Camundongos , Humanos , Camundongos Nus , Linhagem Celular Tumoral , RNA Longo não Codificante/genética , RNA Longo não Codificante/metabolismo , Movimento Celular/genética , MicroRNAs/genética , Processos Neoplásicos , Colangiocarcinoma/patologia , Proliferação de Células/genética , Neoplasias dos Ductos Biliares/patologia , Ductos Biliares Intra-Hepáticos/patologia , Regulação Neoplásica da Expressão Gênica , Receptores Órfãos Semelhantes a Receptor Tirosina Quinase/genética , Receptores Órfãos Semelhantes a Receptor Tirosina Quinase/metabolismo
13.
Immunopharmacol Immunotoxicol ; 45(6): 682-691, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-37417915

RESUMO

BACKGROUND: Chronic obstructive pulmonary disease (COPD) has a high fatality rate and poses a great threat to human health. Astragaloside IV (AS-IV) is proven to attenuate cigarette smoke (CS)-induced pulmonary inflammation, based on which this research focuses on the mechanism of AS-IV in COPD. METHODS: To evaluate the effects of AS-IV, CD4+ T cells received different concentrations of AS-IV. CD4+ T cell viability, T helper 17 (Th17)/regulatory T (Treg) markers and CXCR4 expressions in CD4+ T cells or spleen/lung tissues were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay, quantitative real-time polymerase chain reaction and Western blot. The proportions of Treg and Th17 cells were assessed by flow cytometry. Enzyme-linked immune sorbent assay was employed to determine cytokine contents in serum and lung tissues. RESULTS: AS-IV with concentration exceeding 40 µM inhibited CD4+ T cell viability. In vitro, AS-IV suppressed the expressions of CXCR4, retinoid-related orphan receptor γt (RORγt), and interleukin (IL)-17A as well as Th17 cells but promoted the expressions of forkhead box p3 (Foxp3) and IL-10 as well as Treg cells, while CXCR4 overexpression reversed the effects of AS-IV. In vivo, AS-IV alleviated COPD, and CS-induced Th17/Treg imbalance in mice and reduced CS-induced down-regulation of IL-10 in serum and lung tissues and Foxp3 and up-regulation of IL-1ß, tumor necrosis factor alpha (TNF-α), IL-6, and IL-17A in serum and lung tissues and RORγt. AS-IV mitigated CS-induced CXCR4 up-regulation. Above effects of AS-IV on mice were offset by CXCR4 overexpression. CONCLUSIONS: AS-IV restores Th17/Treg balance via impeding CXCR4 to ameliorate COPD.


Assuntos
Doença Pulmonar Obstrutiva Crônica , Receptores CXCR4 , Saponinas , Linfócitos T Reguladores , Células Th17 , Masculino , Animais , Camundongos , Camundongos Endogâmicos ICR , Receptores CXCR4/metabolismo , Doença Pulmonar Obstrutiva Crônica/tratamento farmacológico , Doença Pulmonar Obstrutiva Crônica/imunologia , Saponinas/farmacologia , Triterpenos/farmacologia , Citocinas/metabolismo , Baço/citologia , Pulmão/citologia
14.
RSC Adv ; 13(24): 16352-16362, 2023 May 30.
Artigo em Inglês | MEDLINE | ID: mdl-37266503

RESUMO

The objective of this study was to synthesize lignin carboxyl betaine zwitterionic surfactants (LCBS) from alkali lignin through a three-step reaction involving epoxidation, amination, and quaternization. The synthesized LCBS were characterized using infrared spectroscopy (IR) and thermogravimetric (TG) analysis. To assess their potential for enhanced oil recovery (EOR), the physicochemical properties of the LCBS surfactants, such as surface tension, emulsification, temperature resistance, salt resistance, and interfacial properties, were evaluated using standard experimental methods for surfactants applied in oil displacement. The LCBS surfactants exhibited higher surface activity, with low surface tension values ranging from 29.65 mN m-1 to 31.85 mN m-1 at the corresponding critical micelle concentration (cmc), also the significant emulsifying performance of LCBS surfactants was proved in the emulsifying experiments. Moreover, the synthesized LCBS surfactants were found to be suitable for use in harsh reservoirs of high-salinity and high-temperature, as confirmed by the temperature and salt resistance measurements. The interfacial tension (IFT) tests between Huabei crude oil and LCBS surfactants suggested that these surfactants could effectively extract the crude oil containing heavy components such as colloid and asphaltene, and ultra-low IFT values could be achieved with the addition of weak alkali.

15.
Opt Lett ; 48(9): 2457-2460, 2023 May 01.
Artigo em Inglês | MEDLINE | ID: mdl-37126297

RESUMO

A Ga hybridization strategy is proposed for simultaneously enhancing the near-infrared activity and extending the bandwidth of Bi-activated photonic glass. Systematic studies on the near-infrared optical responses of Ga/Bi and Al/Bi co-doped silica glasses are performed. It is interesting to note that Ga/Bi co-doped glasses have a similar near-infrared emission center to Al/Bi co-doped glass, while the former is more effective in improving near-infrared activity. The different luminescence mechanisms of Ga/Bi and Al/Bi co-doped silica glasses are elucidated, and the corresponding microstructure-optical response relationship is discussed. In addition, the Ga/Bi co-doped silica optical fiber is successfully prepared, and the principal fiber amplifier device is fabricated. Furthermore, amplified spontaneous emission and broadband on-off gain are realized. The results suggest that Ga-hybridized Bi-activated photonic glass is a promising gain material for broadband fiber amplifiers.

16.
Front Neurol ; 14: 1133091, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37122297

RESUMO

Objective: The typical pressure cooker technique (PCT) and several modifications with similar mechanisms have been introduced to enhance the embolization of brain arteriovenous malformations (bAVMs). This study aimed to assess the effectiveness of transarterial embolization of bAVMs with the PCT. Method: From January 2019 to December 2021, 125 consecutive patients with bAVM managed by transarterial embolization in the prospective database on cerebral vascular diseases of a single center were retrospectively reviewed. Patient data and lesion characteristics were collected. According to the treatment strategy, the patients were assigned to the PCT group (46 patients) and conventional embolization technique (CET) group (79 patients). Results: Baseline patient features were comparable between the two groups. After the first procedure, complete obliteration immediately was observed in 61 and 42% of patients in the PCT and CET groups, respectively. The rate was markedly elevated in the PCT group (p = 0.04). In subgroup analysis, the rate of immediate complete obliteration was starkly increased in PCT group patients with Spetzler-Martin grade I/II bAVM (86 and 53% in the PCT and CET groups, respectively; p = 0.0036). The overall complication rates were similar in the two groups (13 and 10% in the PCT and CET groups, respectively; p = 0.77). In multivariable analysis, nidus size >3 cm (OR = 8.826, 95% CI: 1.250-62.312; p = 0.03) and deep location (OR = 8.576, 95% CI: 1.480-49.690; p = 0.02) were significant factors affecting complete obliteration in the PCT group. Conclusion: The PCT may yield a higher rate of immediate complete obliteration with transarterial embolization of bAVMs, without increasing the rate of procedure-related complications.

17.
Medicine (Baltimore) ; 102(13): e33314, 2023 Mar 31.
Artigo em Inglês | MEDLINE | ID: mdl-37000091

RESUMO

The aim of this retrospective study was to investigate the association between preoperative serological and clinical indicators and postoperative recovery in patients who had undergone resection of intrahepatic cholangiocarcinoma (ICC). We collected data form the medical records of patients who underwent operations for the treatment of ICC at Qingdao University Affiliated Hospital from 2015 to 2021. We analyzed the data to explore the independent predictors of disease prognosis after surgery for ICC. By univariate analysis, we found that the following factors were significantly associated with overall survival and tumor-free survival in patients with ICC: TNM stage; degree of vascular invasion; levels of hemoglobin, carcinoembryonic antigen, carbohydrate antigen 125, direct bilirubin, alkaline phosphatase, and albumin; prothrombin time; neutrophil to lymphocyte ratio; prothrombin time to albumin ratio; albumin to alkaline phosphatase ratio; albumin to gamma-glutamyl transferase ratio; prognostic nutrition Index, and incisional margin. However, only carbohydrate antigen 24-2 and glutamyl transpeptidase were correlated with overall survival in patients with ICC. However, only a positive history of biliary surgery was significantly associated with tumor-free survival in patients with ICC. Preoperative prothrombin time, vascular invasion, N-stage, incisal edge, and carcinoembryonic antigen levels may be simple predictors of disease progression in ICC after hepatectomy.


Assuntos
Neoplasias dos Ductos Biliares , Colangiocarcinoma , Humanos , Estudos Retrospectivos , Antígeno Carcinoembrionário , Fosfatase Alcalina , Prognóstico , Colangiocarcinoma/patologia , Hepatectomia , gama-Glutamiltransferase , Ductos Biliares Intra-Hepáticos/patologia , Neoplasias dos Ductos Biliares/patologia , Albuminas , Carboidratos
18.
Genes Genomics ; 45(5): 673-680, 2023 05.
Artigo em Inglês | MEDLINE | ID: mdl-36662390

RESUMO

BACKGROUND: Gastroesophageal reflux disease (GERD) is a highly prevalent and troublesome disease. Several differentially expressed microRNAs (miRNAs) have been found in GERD. OBJECTIVE: This study was to analyze the correlation of miR-29a-3p expression and CYP2C19 genotypes in exfoliated cells from tongue coating of GERD patients and its prognostic value. METHODS: Tongue coating specimens were collected from 130 GERD patients and 70 healthy volunteers and their clinical baseline information was recorded. miR-29a-3p expression in exfoliated cells from tongue coating was determined via RT-qPCR, and its diagnostic efficiency on GERD was evaluated via receiver operating characteristic curve. CYP2C19 genotypes and their correlation with miR-29a-3p were analyzed via polymerase chain reaction restriction fragment length polymorphism technique. The adverse events of patients were documented via 12-month follow-up. The impact of miR-29a-3p expression on the healing rate of patients was analyzed via Kaplan-Meier method. Qualification of miR-29a-3p as an independent prognostic factor of GERD patients was analyzed via multivariate Cox regression analysis. RESULTS: miR-29a-3p was highly-expressed in exfoliated cells from tongue coating of GERD patients. miR-29a-3p expression had high specificity and sensitivity in diagnosing GERD. CYP2C19 genotypes in GERD patients comprised rapid metabolizers, intermedia metabolizers, and poor metabolizers. miR-29a-3p expression showed a correlation with CYP2C19 genotypes. Higher miR-29a-3p expression predicted higher cumulative incidences of adverse outcomes. Highly-expressed miR-29a-3p was an independent prognostic factor for adverse outcomes of GERD patients. CONCLUSION: High expression of miR-29a-3p aided the diagnosis and predicted poor prognosis of GERD patients.


Assuntos
Refluxo Gastroesofágico , MicroRNAs , Humanos , Citocromo P-450 CYP2C19/genética , Prognóstico , MicroRNAs/genética , MicroRNAs/metabolismo , Refluxo Gastroesofágico/diagnóstico , Refluxo Gastroesofágico/genética , Genótipo , Língua/metabolismo
19.
Anal Chim Acta ; 1238: 340599, 2023 Jan 15.
Artigo em Inglês | MEDLINE | ID: mdl-36464443

RESUMO

Light addressable potentiometric sensor (LAPS) with the structure of electrolyte-insulator-semiconductor is a kind of field effect sensor that detects local potential changes caused by protonation and deprotonation between electrolyte and insulator by light pulse. And scanned light pulse allows two-dimensional imaging of the distribution of chemical/biological species on the surface of sensor. An important challenge is to achieve low-cost, strong anti-interference and high-performance silicon-based LAPS. In this study, we propose to combine microsphere lithography with wet etching to fabricate well-ordered, tunable and low-cost pyramidal pits-patterned silicon as semiconductor of LAPS. The morphology and optical properties of pyramidal pits-patterned silicon are tested and analyzed. The sensing characteristics and the pH imaging performance of LAPS are tested and evaluated. The experiment results and theoretical analyses show that LAPS with pyramidal pits-patterned silicon has acceptable pH response, good long-term stability, and high performance in terms of photocurrent enhancement ratio, signal-to-noise ratio and pH imaging. This work can provide a simple, low-cost, strong anti-interference and high-performance device for pH-related chemical/biological analysis.


Assuntos
Semicondutores , Silício , Potenciometria , Microesferas , Cromatografia Gasosa
20.
Immun Inflamm Dis ; 10(11): e727, 2022 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-36301031

RESUMO

OBJECTIVE: Hilar cholangiocarcinoma (HCCA) is a malignancy related to chronic biliary tract inflammation. Tumor immune escape is a necessary process of tumorigenesis. Forkhead box M1 (FoxM1) could affect the progression of various carcinomas. This study attempted to elaborate on the mechanism of FoxM1 in HCCA immune escape. METHODS: HCCA cell lines were collected to measure the expression of FoxM1 and FoxP3. CD8+ T cells were extracted to establish the co-culture system with HCCA cells and Treg cells. pcDNA3.1-FoxM1 or si-FoxP3 was transfected into HCCA cells in the co-culture system. HCCA cell viability, mobility, and invasiveness as well as levels of transforming growth factor (TGF)-ß and interleukin (IL)-6 were evaluated. The binding relation between FoxM1 and FoxP3 promoter was verified. HCCA cells with pcDNA3.1-FoxM1 were subcutaneously injected into mice to establish the xenograft mouse models. RESULTS: FoxM1 and FoxP3 were overexpressed in HCCA cells. The co-culture of CD8+ T and HCCA cells inhibited HCCA cell activity and Treg cells limited CD8+ T killing. FoxM1 overexpression strengthened the inhibiting role of Treg cells in CD8+ T killing, upregulated TGF-ß and IL-6 levels, and encouraged HCCA immune escape. FoxM1 bound to the FoxP3 promoter region to promote FoxP3 transcription. Silencing of FoxP3 neutralized the promoting role of FoxM1 overexpression in Treg cell immunosuppression and HCCA cell immune escape. FoxM1 aggravated tumor development, upregulated FoxP3 expression, increased Treg cells, and reduced CD8+ T cells. CONCLUSION: FoxM1 bound to the FoxP3 promoter region to promote FoxP3 transcription and recruited FoxP3+ Treg cells, thereby inducing HCCA immune escape.


Assuntos
Neoplasias dos Ductos Biliares , Tumor de Klatskin , Humanos , Camundongos , Animais , Linfócitos T Reguladores , Linfócitos T CD8-Positivos , Fatores de Transcrição Forkhead/genética , Tumor de Klatskin/metabolismo , Tumor de Klatskin/patologia , Fator de Crescimento Transformador beta/metabolismo , Neoplasias dos Ductos Biliares/genética , Neoplasias dos Ductos Biliares/metabolismo , Neoplasias dos Ductos Biliares/patologia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA