RESUMO
BACKGROUND: Neuromyelitis Optica Spectrum Disorder (NMOSD) is an inflammatory autoimmune disease with high risk of recurrence and disability, the treatment goal is a recurrence free state. Area postrema (AP) is one of the most common involved area of NMOSD, which may have a particular significance in the pathogenesis of NMOSD and clinical heterogeneity. Our study is to investigate the clinical and recurrent characteristics AP onset NMOSD patients. METHODS: A retrospective study was done in a cohort of 166 AQP4-IgG seropositive NMOSD patients which were identified by the 2015 IPND criteria. The patients were divided into AP onset (APO-NMOSD) group and non-AP onset (NAPO-NMOSD) group based on the initial episode location. Clinical features and recurrence differences of two groups were compared. RESULTS: The APO-NMOSD group and NAPO-NMOSD group had a population ratio of 24:142. APO-NMOSD patients were younger (34.6y VS 42.3y, P = 0.013), had lower EDSS at first episode (0.7 VS 4.2, p = 0.028) and last follow up (1.9 VS 3.3, p = 0.001), more likely to have multi-core lesions at the first attack (33.3% VS 9.2%, P = 0.001). Also, they had a higher annual recurrence rate (0.4 ± 0.28 VS 0.19 ± 0.25, P = 0.012). In natural course NMOSD patients without immunotherapy, APO-NMSOD had a shorter time of first relapse (P < 0.001) and higher annual recurrence rate (0.31 ± 0.22 VS 0.16 ± 0.26, P = 0.038) than NAPO-NMOSD. APO-NMOSD group also have a higher risk of having the first relapsing compared to optic neuritis onset-NMOSD (HR 2.641, 95% CI 1.427-4.887, p = 0.002) and myelitis onset-NMOSD group (HR 3.593, 95% CI 1.736-7.438, p = 0.001). Compared to NAPO-NMOSD, APO-NMOSD has a higher likelihood of brainstem recurrence (28.6% vs. 4.7%, p<0.001) during the first recurrence, while NAPO-NMOSD is more susceptible to optic nerve involvement (10.7% vs. 41.1%, p = 0.01). CONCLUSION: AQP4-IgG seropositive NMOSD patients with AP onset are youngers and have higher risk of recurrence. Clinicians should pay attention to AP damage in NMOSD, as it indicates a potential risk of recurrence. TRIAL REGISTRATION: Retrospectively registered.
Assuntos
Área Postrema , Neuromielite Óptica , Recidiva , Humanos , Neuromielite Óptica/epidemiologia , Neuromielite Óptica/diagnóstico , Feminino , Estudos Retrospectivos , Adulto , Masculino , Pessoa de Meia-Idade , Área Postrema/patologia , Adulto Jovem , Estudos de Coortes , Aquaporina 4/imunologiaRESUMO
BACKGROUND: To investigate Ranvier's autoantibodies prevalence and isotypes in various peripheral neuropathy variants, compare clinical features between seronegative and seropositive patients, and elucidate immune mechanisms underlying antibody generation. METHODS: Antibodies against anti-neurofascin-155 (NF155), NF186, contactin-1 (CNTN1), CNTN2, contactin-associated protein 1 (CASPR1), and CASPR2 were identified through cell-based assays. Plasma cytokines were analyzed in anti-NF155 antibody-positive chronic inflammatory demyelinating polyneuropathy (NF155+ CIDP) and Ranvier's antibodies-negative CIDP (Ab- CIDP) patients using a multiplexed fluorescent immunoassay, validated in vitro in a cell culture model. RESULTS: In 368 plasma samples, 50 Ranvier's autoantibodies were found in 45 individuals, primarily in CIDP cases (25 out of 69 patients) and in 10 out of 122 Guillain-Barré syndrome patients. Anti-NF155 and CNTN1-IgG were exclusive to CIDP. Fourteen samples were NF155-IgG, primarily IgG4 subclass, linked to CIDP features including early onset, tremor, sensory disturbance, elevated CSF protein, prolonged motor latency, conduction block, and poor treatment response. NF155-IgG had low sensitivity (20.28%) but high specificity (100%) for CIDP, rising to 88.88% with tremor and prolonged motor latency. Cytokine profiling in NF155+ CIDP revealed distinct immune responses involving helper T cells, toll-like receptor pathways. Some NF155+ CIDP patients had circulating NF155-specific B cells producing NF155-IgG without antigen presence, suggesting therapeutic potential. CONCLUSION: The study emphasizes the high specificity and sensitivity of NF155-IgG for diagnosing CIDP characterized by distinctive features. Further investigation into circulating NF155-specific B cell phenotypes may pave the way for B cell directed therapy.
Assuntos
Autoanticorpos , Moléculas de Adesão Celular , Fatores de Crescimento Neural , Fenótipo , Polirradiculoneuropatia Desmielinizante Inflamatória Crônica , Humanos , Polirradiculoneuropatia Desmielinizante Inflamatória Crônica/sangue , Polirradiculoneuropatia Desmielinizante Inflamatória Crônica/imunologia , Polirradiculoneuropatia Desmielinizante Inflamatória Crônica/diagnóstico , Masculino , Feminino , Moléculas de Adesão Celular/sangue , Moléculas de Adesão Celular/imunologia , Fatores de Crescimento Neural/imunologia , Fatores de Crescimento Neural/sangue , Pessoa de Meia-Idade , Autoanticorpos/sangue , Idoso , Adulto , Citocinas/sangue , Nós Neurofibrosos/imunologia , Contactina 1/imunologiaRESUMO
INTRODUCTION: Systemic prolactin levels have been found to increase in 19 patients diagnosed with neuromyelitis optica spectrum disorders (NMOSD). However, the relationship between plasma prolactin levels and clinical manifestations in NMOSD patients remains unclear. METHODS: This cross-sectional study was conducted as part of a Registered Cohort Study of Inflammatory Demyelination Disease (NCT04386018). A total of 95 patients diagnosed with central nervous system demyelinating diseases and 43 healthy controls were recruited between May 2020 and February 2022 at the First Affiliated Hospital of Fujian Medical University. Plasma samples were collected from all participants and analyzed for prolactin levels using electrochemiluminescence immunoassay. The study aimed to investigate the correlation between plasma prolactin levels and clinical features in patients with central nervous system demyelinating diseases. RESULTS: Plasma prolactin levels in NMOSD patients were significantly higher than those in multiple sclerosis/myelin oligodendrocyte glycoprotein antibody-associated diseases patients and controls (p<0.05, respectively), and were found to be correlated with disease activity, sensory abnormalities, thoracic spinal cord lesions, and MR lesion enhancement (p<0.05). A total of 16.28% of NMOSD patients exhibited macroprolactinemia. However, there was no correlation found between macroprolactin levels and disease activity (p>0.05). CONCLUSION: Prolactin may play a role in the pro-inflammatory regulation mechanism of NMOSD.
Assuntos
Neuromielite Óptica , Humanos , Neuromielite Óptica/diagnóstico , Aquaporina 4 , Estudos de Coortes , Estudos Transversais , Prolactina , Glicoproteína Mielina-Oligodendrócito , AutoanticorposRESUMO
Increased B cell activating factor (BAFF) expression in patients with neuromyelitis optica spectrum disorder (NMOSD) is associated with B cell overstimulation, but the underlying mechanism remains unclear. This study aimed to reveal the emerging mechanisms that regulate BAFF expression in the inflammatory process of NMOSD. The results showed that the expression of miR-30b-5p was significantly decreased in NMOSD CD14+ monocytes compared with the normal control. Furthermore, we confirmed that metastasis-associated lung adenocarcinoma transcription 1 (MALAT1) is an upstream target of miR-30b-5p, and it could act as a ceRNA and absorb miR-30b-5p with reduced expression of miR-30b-5p. The low expression of miR-30b-5p could not bind to BAFF messenger RNA (mRNA), which resulted in the overexpression of both BAFF mRNA and protein expression. Overexpression of BAFF could bind to the corresponding receptors on B cells, which may initiate activation and proliferation of B cells and increase their production of autoantibodies. Therefore, these findings interpreted that excessive MALAT1 expression in NMOSD mononuclear macrophages led to increased BAFF expression by targeting miR-30b-5p, which caused B cell autoimmune reaction and autoantibodies production, aggravated the disease progression of NMOSD.
RESUMO
Importance: Immunoglobulin G autoantibodies for aquaporin 4 (AQP4-IgG) serve as diagnostic biomarkers for neuromyelitis optica spectrum disorder (NMOSD), and the most sensitive and specific laboratory tests for their detection are cell-based assays (CBAs). Nevertheless, the limited availability of special instruments limits the widespread use of CBAs in routine laboratories. Objective: To validate an enzyme immunodot assay for simple and rapid detection of AQP4-IgG. Design, Setting, and Participants: This multicenter case-control study, conducted from May 2020 to February 2023, involved 4 medical centers (3 in China and 1 in Korea). The study included patients with AQP4-IgG-positive NMOSD, patients with other immune-related diseases, and healthy control individuals. Participants were excluded if they did not agree to participate or if their serum sample had turbidity. Exposures: Serum AQP4 antibodies measured with immunodot assay. Main Outcomes and Measures: The main outcome was performance of the immunodot assay compared with the gold standard CBA for detecting AQP4-IgG. To examine generalizability, cross-validation in Korea and at a second site in China, validation of patients with other immune-related diseases, and follow-up validation of the original cohort were performed. Results: A total of 836 serum samples were collected; 400 were included in the diagnostic study and 436 in the validation sets. In a head-to-head diagnostic study involving 200 patients with NMOSD with AQP4-IgG (mean [SD] age, 43.1 [13.5] years; 188 [94%] female) and 200 healthy controls, use of an immunodot assay demonstrated antibody detection performance comparable to that of the gold standard (κ = 98.0%). The validation sets included 47 patients with NMOSD and 26 patients with other autoimmune diseases from Korea, 31 patients with NMOSD at a second site in China, 275 patients with other diseases, and 57 patients with NMOSD at follow-up. In the validation study, of 436 cases, 2 (<1%) were false positive and none were false negative. The CBA identified 332 AQP4-IgG-positive samples and 504 negative samples (200 [40%] in controls and 304 [60%] in patients with other diseases); 2 of the positive cases (<1%) were false negative and 4 of the negative cases (<1%) were false positive. The overall sensitivity of the immunodot assay was 99.4% (95% CI, 97.8%-99.9%), and the specificity was 99.2% (95% CI, 98.0%-99.8%). Conclusions and Relevance: This case-control study found that the immunodot assay was comparable to CBA for detecting AQP4-IgG. With its time- and cost-efficient characteristics, the immunodot assay may be a practical option for AQP4-IgG detection.
Assuntos
Neuromielite Óptica , Humanos , Feminino , Adulto , Masculino , Estudos de Casos e Controles , Aquaporina 4 , Autoanticorpos , Imunoglobulina GRESUMO
Multiple sclerosis (MS) is a condition that affects the veins and small blood vessels. Previous research suggests that individuals with MS have an increased risk of vascular events and higher mortality rates. However, the relationship between MS and cerebral small vessel disease (CSVD) remains uncertain. This study aims to investigate the association between MS and lacunes. A prospective observational study was conducted, including a total of 112 participants, of which 46 had MS and 66 had CSVD. All participants underwent an MRI scan and a battery of neurological functional assessments. The presence of definite lacunes and black holes was determined through the analysis of T2-weighted, T1-weighted, and FLAIR images. The occurrence of lacunes in MS patients was found to be 19.6%. Notably, the duration of MS was identified as the sole risk factor for the development of lacune lesions in MS patients [odds ratio (OR) = 1.3, 95% confidence interval (CI) = 1.1-1.6, p = 0.008]. Comparatively, MS patients with lacunes exhibited a higher frequency of attacks and larger volumes of T2 lesions compared to MS patients without lacunes. Further analysis using receiver operating characteristic (ROC) curves showed that lacune lesions had limited ability to discriminate between MS and CSVD when disease duration exceeded 6 years. The presence of small arterial lesions in the brain of individuals with MS, along with the duration of the disease, contributes to the development of lacunes in MS patients.
RESUMO
BACKGROUND: Perihematomal edema (PHE) is an important determinant of outcome in spontaneous intracerebral hemorrhage (ICH) due to cerebral small vessel disease (CSVD). However, it is not known to date whether the severity of CSVD is associated with the extent of PHE progression in the acute phase. PURPOSE: To investigate the association between the magnetic resonance imaging (MRI) marker of severe chronic-ischemia cerebral small vessel changes (sciSVC) and PHE growth or hematoma absorption among ICH patients with hypertension. STUDY TYPE: Retrospective. POPULATION: Three hundred and sixty-eight consecutive hypertensive ICH patients without surgical treatment. FIELD STRENGTH/SEQUENCE: 3 T; spin-echo echo-planar imaging-diffusion-weighted imaging (DWI); T2-weighted, fluid-attenuated inversion recovery (FLAIR), T2*-weighted gradient-recalled echo and T1-weighted. ASSESSMENT: The hematoma and PHE volumes at 24 hours and 5 days after symptom onset were measured in 121 patients with spontaneous ICH who had been administered standard medical treatment. Patients were grouped into two categories: those with sciSVC and those without. The imaging marker of sciSVC was defined as white matter hyperintensities (WMHs) Fazekas 2-3 combined cavitating lacunes. STATISTICAL TESTS: Univariable analyses, χ2 test, Mann-Whitney U test, and multiple linear regression. RESULTS: The presence of sciSVC (multiple lacunes and confluent WMH) had a significant negative influence on PHE progress (Beta = -5.3 mL, 95% CI = -10.3 mL to -0.3 mL), and hematoma absorption (Beta = -3.2 mL, 95% CI = -5.9 mL to -0.4 mL) compared to that observed in the absence of sciSVC, as determined by multivariate linear regression analysis. DATA CONCLUSIONS: The presence of sciSVC (multiple lacunes and confluent WMH) negatively influenced hematoma absorption and PHE progress in ICH patients. LEVEL OF EVIDENCE: 4 TECHNICAL EFFICACY: Stage 3.
Assuntos
Edema Encefálico , Doenças de Pequenos Vasos Cerebrais , Hemorragia Intracraniana Hipertensiva , Humanos , Hemorragia Intracraniana Hipertensiva/complicações , Estudos Retrospectivos , Doenças de Pequenos Vasos Cerebrais/complicações , Doenças de Pequenos Vasos Cerebrais/diagnóstico por imagem , Hemorragia Cerebral/complicações , Hemorragia Cerebral/diagnóstico por imagem , Imageamento por Ressonância Magnética/métodos , Hematoma/complicações , Hematoma/diagnóstico por imagem , Edema/complicaçõesRESUMO
Objective: The prevalence of multiple sclerosis (MS) in China is low, although it has been increasing recently. Owing to the paucity of data on immunotherapy acceptance in the Chinese population, we conducted this study to analyze factors affecting the acceptance of immunotherapy and selection of disease-modifying therapies (DMTs) based on personal and clinical data of patients with MS. Methods: In this study, data were obtained from the Multiple Sclerosis Patient Survival Report 2018, which was the first national survey of patients with MS in China. There were 1,212 patients with MS from 31 provinces who were treated at 49 Chinese hospitals over a 4-month period from May 2018 to August 2018, and the patients were asked to complete online questionnaires to assess their understanding of the disease. Results: In general, highly educated patients with frequent relapses were more willing to receive treatment regardless of DMTs or other immunotherapy, and patients with more understanding of the disease opted to be treated. Younger patient population, patients with severe disease course, and those with more symptoms were likely to choose the treatment. Moreover, a higher proportion of women chose to be treated with DMTs than with other immunotherapies. Conclusions: Education status and patient awareness of the disease impact the treatment acceptance in Chinese patients with MS. Therefore, we call for improving the awareness of MS disease and social security to help patients to improve their quality of life.
RESUMO
A colorimetric assay for highly selective and sensitive detection of tricyclazole using fluorescein-functionalized silver nanoparticles (F-AgNPs) as sensing probes was investigated. As the addition of tricyclazole to F-AgNPs, a drastic decrease in the absorbance at 394 nm was detected, which was accompanied with a noticeable color change from yellow to gray. The sensing mechanism involved an interaction between tricyclazole and F-AgNPs, which led to aggregation of the latter, inducing a color change from yellow to gray. An excellent linear calibration curve (R2 = 0.9994) was achieved between absorbance at 394 nm and the tricyclazole concentration in the range between 0.06 and 1.0 ppm. Moreover, the detection limit was estimated at 0.051 ppm. The developed colorimetric assay also showed good selectivity and was successfully utilized to quantify tricyclazole in rice samples with satisfactory recoveries. The proposed assay has been successfully applied for monitoring tricyclazole in rice samples.
Assuntos
Colorimetria/métodos , Nanopartículas Metálicas/química , Prata/química , Tiazóis/análise , Fluoresceína/química , Limite de Detecção , Oryza/química , Oryza/metabolismoRESUMO
OBJECTIVES: Cerebral artery fenestrations detected incidentally during computed tomographic angiography (CTA) or magnetic resonance angiography (MRA) are reported to be associated with aneurysmal dilatation, which may cause cerebrovascular diseases, arteriovenous malformations, or, rarely, ischemic symptoms. METHODS: We retrospectively analyzed CTA and MRA of patients with cerebral artery fenestration examined between January 2014 and December 2017. The location, shape, and other associated vascular diseases were described. RESULTS: Two hundred eleven cerebral artery fenestrations were found in 208 patients for a detection rate of 1.13% (208/18,360). Basilar artery fenestrations were most common, accounting for 50.2% (106/211). The fenestration was <5 mm in 115 patients (54.5%), 5-10 mm in 63 (29.9%), and ≥10 mm in 33 (15.6%). Forty-one patients had other vascular malformations, including 29 aneurysms. Except for one aneurysm, which was at the site of the fenestration, all other aneurysms were separate from the fenestrations. 26 patients had cerebral infarctions; among them, 11 had cerebral infarctions in the blood supply area of the arterial fenestration. CONCLUSIONS: Cerebral artery fenestration is an uncommon finding at cerebral imaging, but mostly affects the basilar artery. Cerebral artery fenestrations could be associated with cerebrovascular diseases and malformations, but the present study could not evaluate the cause-to-effect relationship.
Assuntos
Artérias Cerebrais/diagnóstico por imagem , Transtornos Cerebrovasculares/diagnóstico por imagem , Adulto , Malformações Arteriovenosas/complicações , Artéria Basilar , Angiografia Cerebral , Angiografia por Tomografia Computadorizada , Feminino , Humanos , Aneurisma Intracraniano/complicações , Angiografia por Ressonância Magnética , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Tomografia Computadorizada por Raios XRESUMO
BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (râ=â0.65869, Pâ=â0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.
Assuntos
Meningite Criptocócica/líquido cefalorraquidiano , Meningite Criptocócica/genética , Biologia Computacional , Cryptococcus/patogenicidade , Testes Diagnósticos de Rotina , Feminino , Genótipo , Humanos , Masculino , Meningite Criptocócica/diagnóstico , Análise MultivariadaRESUMO
Basilar artery fenestration is an uncommon congenital dysplasia and may be associated with ischaemic stroke. We present a case of a previously healthy 36-year-old man who presented with vertigo and vomiting. MRI showed posterior circulation territory infarction. High-resolution magnetic resonance angiography revealed a slit-like fenestration in the basilar artery. This patient had no traditional vascular risk factors or aetiology of cryptogenic stroke. The patient recovered from his neurological deficit after antiplatelet therapy and was given prophylactic aspirin therapy. There was no recurrence of symptoms after 12 months of follow-up.
Assuntos
Ataxia/diagnóstico por imagem , Artéria Basilar/anormalidades , Artéria Basilar/diagnóstico por imagem , Acidente Vascular Cerebral/diagnóstico por imagem , Acidente Vascular Cerebral/etiologia , Insuficiência Vertebrobasilar/complicações , Insuficiência Vertebrobasilar/diagnóstico por imagem , Adulto , Anti-Inflamatórios não Esteroides/uso terapêutico , Aspirina/uso terapêutico , Ataxia/etiologia , Angiografia Cerebral , Clopidogrel , Humanos , Imageamento por Ressonância Magnética , Masculino , Inibidores da Agregação Plaquetária/uso terapêutico , Acidente Vascular Cerebral/tratamento farmacológico , Ticlopidina/análogos & derivados , Ticlopidina/uso terapêutico , Resultado do Tratamento , Insuficiência Vertebrobasilar/tratamento farmacológico , Vertigem , VômitoRESUMO
BACKGROUND Recent studies identified a set of differentially expressed miRNAs in whole blood that may discriminate neuromyelitis optica spectrum disorders (NMOSD) from relapsing-remitting multiple sclerosis (RRMS). This study invalidated 9 known miRNAs in Chinese patients. MATERIAL AND METHODS The levels of miRNAs in whole blood were assayed in healthy controls (n=20) and patients with NMOSD (n=45), RRMS (n=17) by quantitative real-time polymerase chain reaction (qRT-PCR), and pairwise-compared between groups. They were further analyzed for association with clinical features and MRI findings of the diseases. RESULTS Compared with healthy controls, miR-22b-5p, miR-30b-5p and miR-126-5p were down-regulated in NMOSD, in contrast, both miR-101-5p and miR-126-5p were up-regulated in RRMS. Moreover, the levels of miR-101-5p, miR-126-5p and miR-660-5p, were significantly higher in RRMS than in NMOSD (P=0.04, 0.01 and 0.02, respectively). The level of miR-576-5p was significantly higher in patients underwent relapse for ≤3 times than those for ≥4 times. In addition, its level was significantly higher in patients suffered from a severe visual impairment (visual sight ≤0.1). Moreover, the levels of each of the 9 miRNAs were lower in NMOSD patients with intracranial lesions (NMOSD-IC) than those without (NMOSD-non-IC). Despite correlations of miRNAs with these disease subtypes, all AUCs of ROC generated to discriminate patients and controls, as well as intracranial lesions, were <0.8. CONCLUSIONS Certain miRNAs are associated with RRMS and NMOSD. They are also related to the clinical features, especially intracranial lesions of NMOSD. However, none of the miRNAs alone or in combination was powerful to ensure the diagnosis and differentiation of the 2 disease subtypes.
Assuntos
Povo Asiático/genética , MicroRNAs/sangue , Esclerose Múltipla/sangue , Esclerose Múltipla/genética , Neuromielite Óptica/sangue , Neuromielite Óptica/genética , Adulto , Diagnóstico Diferencial , Feminino , Regulação da Expressão Gênica , Humanos , Masculino , MicroRNAs/genética , Pessoa de Meia-Idade , Esclerose Múltipla/diagnóstico , Esclerose Múltipla Recidivante-Remitente/sangue , Esclerose Múltipla Recidivante-Remitente/diagnóstico , Esclerose Múltipla Recidivante-Remitente/genética , Neuromielite Óptica/diagnóstico , Desnaturação de Ácido Nucleico , Transdução de Sinais/genéticaRESUMO
The human glutamate receptor delta 2 gene (GRID2) shares 90% homology with the orthologous mouse gene. The mouse Grid2 gene is involved with functions of the cerebellum and spontaneous mutation of Grid2 leads to a spinocerebellar ataxia-like phenotype. To investigate whether such mutations occur in humans, we screened for mutations in the coding sequence of GRID2 in 24 patients with familial or sporadic spinocerebellar ataxia and in 52 normal controls. We detected no point mutations or insertion/deletion mutations in the 16 exons of GRID2. However, a polymorphic 4 nucleotide deletion (IVS5-121_-118 GAGT) and two single nucleotide polymorphisms (c.1251G>T and IVS14-63C>G) were identified. The frequency of these polymorphisms was similar between spinocerebellar ataxia patients and normal controls. These data indicate that spontaneous mutations do not occur in GRID2 and that the incidence of spinocerebellar ataxia in humans is not associated with GRID2 mutation or polymorphisms.
RESUMO
Neuromyelitis optica (NMO) is a disease distinct from multiple sclerosis in terms of clinical and magnetic resonance imaging (MRI) manifestations. Antibody to aquaporin-4 (AQP4) has been identified as a specific biomarker and part of the diagnostic criteria for NMO. Although it is relatively common in Asia, a comprehensive clinical and imaging evaluation of NMO has not been reported in Chinese patients. Here, we reviewed data from 57 Chinese cases. The patients had an obvious female preponderance (female/male = 8.5:1), and transverse myelitis (82.5%) and optic neuritis (56.1%) were the most common manifestations. In MRI, longitudinally extensive transverse myelitis (6.9 ± 2.3 segments) dominated the spinal cord lesions, which were mainly (69.7%) distributed in cervical and thoracic cord. However, the length of the lesions was not correlated with onset age, paralysis severity, relapse rate, or duration. Among 29 patients who underwent AQP4 antibody assay, 17 (58.6%) were positive. There was no difference between seropositive and seronegative patients in terms of female preponderance, onset age, relapse rate, and Expanded Disability Status Scale score. However, seropositive patients had significantly more damaged segments (8.3 ± 3.5) than did seronegative patients (4.5 ± 1.6) (p < 0.001). The data revealed the clinical and MRI characteristics and AQP4 antibody status of NMO in Chinese patients and the correlations between them, which may have important implications for the diagnosis of the disease.
Assuntos
Neuromielite Óptica/patologia , Medula Espinal/patologia , Adulto , Aquaporina 4/imunologia , Povo Asiático , Autoanticorpos/sangue , China , Feminino , Humanos , Imageamento por Ressonância Magnética , Masculino , Pessoa de Meia-Idade , Mielite Transversa/sangue , Mielite Transversa/líquido cefalorraquidiano , Mielite Transversa/patologia , Neuromielite Óptica/sangue , Neuromielite Óptica/líquido cefalorraquidiano , Transtornos da Visão/sangue , Transtornos da Visão/líquido cefalorraquidiano , Transtornos da Visão/patologia , Adulto JovemRESUMO
In multiple sclerosis, gray matter atrophy is extensive, and cognitive deficits and mood disorders are frequently encountered. It has been conjectured that focal atrophy is associated with emotional decline. However, conventional MRI has revealed that the pathological characteristics cannot fully account for the mood disorders. Moreover, there is no correlation between cognitive disorders and MRI results in clinically isolated syndromes or in cases of definite multiple sclerosis. In this case-control study, voxel-based morphometric analysis was performed on 11 subjects with relapsing-remitting multiple sclerosis, and the results show that these patients exhibit gray matter atrophy. Moreover, the gray matter atrophy in the superior and middle gyri of the right frontal lobe in patients with multiple sclerosis was correlated with scores from the Hamilton Anxiety Rating Scale. The scores obtained with the Repeatable Battery for the Assessment of Neuropsychological Status were associated with gray matter atrophy in the middle gyrus of the left frontal lobe, the superior and middle gyrus of the right frontal lobe, the middle gyrus of the left cingulate, the superior and middle gyri of the left frontal lobe, and the triangular area of the left frontal lobe. However, there was no statistical significance. These findings suggest that the cingulate and frontal cortices of the nant hemisphere are the most severely atrophic regions of the brain, and this atrophy is correlated with cognitive decline and emotional abnormalities.
RESUMO
Association of HLA class II with multiple sclerosis (MS) has been widely studied in both Western and Oriental populations. However, such an association is not well documented in Chinese. The objective of this study was to examine the association between the susceptibility to conventional MS in Southern Chinese with HLA-DRB1,-DPB1 alleles and putative DRB1-DPB1 haplotypes. Genotyping of HLA-DRB1 and -DPB1 alleles was performed in 60 patients with conventional MS and 95 controls. Allele frequencies were compared between patients and controls to identify MS-associated alleles. Relative predisposing effect method was used to compare haplotype frequencies in patients and controls and to identify possible predisposing DRB1-DPB1 haplotypes, which were further examined for differences in haplotype carriage rates between the two groups. We found that the allele frequency of DRB1*1501 was not different between patients (18.3%) and controls (21.1%) (p = 0.837). In contrast, frequency of the DPB1*0501 allele was significantly higher in patients (90%) than in controls (67.4%) (odds ratio = 4.36, p = 0.0013, pcorr = 0.025). DRB1-DPB1 linkage haplotype in patients (8.33%) was significantly higher than in controls (0%) (p < 0.0001) and the carriage rate of this haplotype was significantly increased in patients (15%) as compared with controls (0%) (p = 0.00013, pcorr = 0.003). Combined, these results suggest that HLA-DRB1*1501 is not associated with susceptibility to conventional MS in Southern Chinese. Instead, both the DPB1*0501 allele and the DRB1*1602- DPB1*0501 haplotype are strong predisposing factors for conventional MS in this population. Our results establish that the HLA profiles of MS in Southern Chinese are distinct from other populations.
Assuntos
Povo Asiático/genética , Antígenos HLA-DP/genética , Antígenos HLA-DR/genética , Esclerose Múltipla/genética , Adolescente , Adulto , Idoso , Estudos de Casos e Controles , China/epidemiologia , Feminino , Frequência do Gene , Estudos de Associação Genética , Predisposição Genética para Doença , Antígenos HLA-DP/imunologia , Cadeias beta de HLA-DP , Antígenos HLA-DR/imunologia , Cadeias HLA-DRB1 , Haplótipos , Humanos , Desequilíbrio de Ligação , Masculino , Pessoa de Meia-Idade , Esclerose Múltipla/etnologia , Esclerose Múltipla/imunologia , Razão de Chances , Fenótipo , Medição de Risco , Fatores de Risco , Adulto JovemRESUMO
OBJECTIVE: To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes. METHODS: Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls. RESULTS: Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P< 0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P< 0.05). CONCLUSION: Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.