Identification of a Broad-Spectrum Peptidoglycan Hydrolase Associated with the Particle of Xanthomonas oryzae Phage Xop411.

Virion-associated peptidoglycan hydrolases (VAPGH) in bacteriophages are potential antimicrobials. Xop411 is a syphophage infecting the Gram-negative Xanthomonas oryzae pv. oryzae that causes bacterial leaf blight in rice plants. The Xop411 gp21 protein was identified here as a peptidoglycan glycohydrolase by Western blotting and zymogram assay, and localized to the phage tail by immunogold-labelling electron microscopy. This protein showed an apparent molecular mass of 17 kDa in SDS-polyacrylamide gels, larger than that calculated from the amino acid sequence, 15 kDa with 130 residues. The recombinant gp21 expressed in Escherichia coli formed inclusion bodies, which gained enzyme activity after in-gel renaturation. In contrast, the secreted recombinant protein (s-gp21His) expressed in Pichia pastoris was soluble and enzymatically active. Plate assays showed that s-gp21His was capable of killing 3 species of Xanthomonas, a genus containing 27 closely related plant pathogenic species, as well as the opportunistic Pseudomonas aeruginosa and Stenotrophomonas maltophilia causing nosocomial infections. These results indicate that the Xop411 gp21 has possible wide applications as an antimicrobial against xanthomonads and at least 2 opportunistic bacteria. Several other VAPGH from Xanthomonas phages were also identified by bioinformatic analysis, with 1 being confirmed by Western blotting.

Functional properties of the major outer membrane protein in Stenotrophomonas maltophilia.

Stenotrophomonas maltophilia is an opportunistic pathogen that is closely associated with high morbidity and mortality in debilitated and immunocompromised individuals. Therefore, to investigate the pathogenesis mechanism is urgently required. However, there are very few studies to evaluate the functional properties of outer membrane protein, which may contribute to the pathogenesis in S. maltophilia. In this study, three abundant proteins in the outer membrane fraction of S. maltophilia were identified by liquid chromatography-tandem mass spectrometry as OmpW1, MopB, and a hypothetical protein. MopB, a member of the OmpA family, was firstly chosen for functional investigation in this study because many OmpA-family proteins are known to be involved in pathogenesis and offer potential as vaccines. Membrane fractionation analyses demonstrated that MopB was indeed the most abundant outer membrane protein (OMP) in S. maltophilia. For functional studies, the mopB mutant of S. maltophilia (SmMopB) was constructed by insertional mutation. MopB deficiency resulted in a change in the protein composition of OMPs and altered the architecture of the outer membrane. The SmMopB strain exhibited reduced cytotoxicity toward L929 fibroblasts and was more sensitive to numerous stresses, including human serum, sodium dodecyl sulfate, and hydrogen peroxide compared with wildtype S. maltophilia. These results suggest that MopB may be a good candidate for the design of vaccines or anti-MopB drugs for controlling serious nosocomial infections of multidrug-resistant S. maltophilia, especially in immunosuppressed patients.

Genomic sequence of temperate phage Smp131 of Stenotrophomonas maltophilia that has similar prophages in xanthomonads.

BACKGROUND: Stenotrophomonas maltophilia is a ubiquitous Gram-negative bacterium previously named as Xanthomonas maltophilia. This organism is an important nosocomial pathogen associated with infections in immunocompromised patients. Clinical isolates of S. maltophilia are mostly resistant to multiple antibiotics and treatment of its infections is becoming problematic. Several virulent bacteriophages, but not temperate phage, of S. maltophilia have been characterized. RESULTS: In this study, a temperate myophage of S. maltophilia (Smp131) was isolated and characterized. Sequence analysis showed that its genome is 33,525-bp long with 47 open reading frames (ORFs). Its similarity to P2-like phages and prophages in S. maltophilia and several Xanthomonas pathovars includes genomic organization, arrangement of several operons, and possession of a slippery sequence T7G for translational frameshifting in tail assembly genes. Smp131 encodes a tyrosine family integrase that shares low degrees of similarity with those of other phages and a lysin belonging to family 19 chitinase that is observed in plants and some bacteria, although not in phages. tRNA are the preferred sites for host integration of Smp131 and the related phages: tRNA-Thr for Smp131 and prophage of S. maltophilia K279a; tRNA-Lys for prophages of X. campestris pv. campestris ATCC33913, X. oryzae pv. oryzae strains MAFF311018, and KACC10331; and tRNA-Asn for prophage of X. oryzae pv. oryzae PXO99A and remnant of X. axonopodis pv. citri 306. Regions flanking the prophages are varied highly in nucleotide sequence and rich in transposase genes, suggesting that frequent insertion/excision had occurred. CONCLUSIONS: Prevalence of closely related prophages in Stenotrophomonas and Xanthomonads may have contributed to the diversity of these closely related species owing to possible horizontal gene transfer mediated by the phages.

Contribution of Phe-7 to Tat-dependent export of ß-lactamase in Xanthomonas campestris.

Strains of Xanthomonas campestris pv. campestris isolated in Taiwan are commonly resistant to ampicillin owing to the constitutive expression of a chromosomally encoded ß-lactamase that is secreted into the periplasm. In this study, we found that levels of ß-lactamase vary among X. campestris pv. campestris strains, a difference that can be attributed to amino acid substitutions at least at positions 7 and 206, with the former having the major impact. Bioinformatic and PCR analyses indicated that X. campestris pv. campestris possesses tatABC genes and that the signal peptide of X. campestris pv. campestris pre-Bla contains the typical twin-arginine motif (N-R-R-Q-F-L at amino acid residues 3 to 8 in strain X. campestris pv. campestris strain 11), suggesting that Bla is secreted via the Tat pathway. To assess the importance of Phe(7) in the efficient export of X. campestris pv. campestris Bla, we prepared mutant constructs containing amino acid substitutions and monitored their expression by measuring enzyme activity and detecting Bla protein by Western blotting. The results indicate that replacement of Phe(7) with Leu severely inhibited Bla export whereas replacement with Pro almost abolished it. Although a change to Arg caused moderate inhibition of export, replacement with Tyr had no effect. These results suggest that for efficient export of Bla by X. campestris pv. campestris, the aromatic-aromatic interactions and stability of protein structure around the twin-arginine motif are important, since only proteins that can attain a folded state in the cytoplasm are competent for export via the Tat pathway.

Lytic myophage Abp53 encodes several proteins similar to those encoded by host Acinetobacter baumannii and phage phiKO2.

Acinetobacter baumannii is an important Gram-negative opportunistic pathogen causing nosocomial infections. The emergence of multiple-drug-resistant A. baumannii isolates has increased in recent years. Directed toward phage therapy, a lytic phage of A. baumannii, designated Abp53, was isolated from a sputum sample in this study. Abp53 has an isometric head and a contractile tail with tail fibers (belonging to Myoviridae), a latent period of about 10 min, and a burst size of approximately 150 PFU per infected cell. Abp53 could completely lyse 27% of the A. baumannii isolates tested, which were all multiple drug resistant, but not other bacteria. Mg(2+) enhanced the adsorption and productivity of, and host lysis by, Abp53. Twenty Abp53 virion proteins were visualized in SDS-polyacrylamide gel electrophoresis, with a 47-kDa protein being the predicted major capsid protein. Abp53 has a double-stranded DNA genome of 95 kb. Sequence analyses of a 10-kb region revealed 8 open reading frames. Five of the encoded proteins, including 3 tail components and 2 hypothetical proteins, were similar to proteins encoded by A. baumannii strain ACICU. ORF1176 (one of the tail components, 1,176 amino acids [aa]), which is also similar to tail protein gp21 of Klebsiella phage phiKO2, contained repeated domains similar to those within the ACICU_02717 protein of A. baumannii ACICU and gp21. These findings suggest a common ancestry and horizontal gene transfer during evolution. As phages can expand the host range by domain duplication in tail fiber proteins, repeated domains in ORF1176 might have a similar significance in Abp53.

Characterization of Xanthomonas campestris pv. campestris heat shock protein A (HspA), which possesses an intrinsic ability to reactivate inactivated proteins.

hspA encodes a small heat shock protein (sHSP) in Xanthomonas campestris pv. campestris, the causative agent of black rot in cruciferous plants. In this study, two-dimensional gel electrophoresis, promoter activity assays, and Northern hybridization results revealed that HspA expression was induced by heat shock but not by other stresses, although low-level expression was detectable by reverse transcription-polymerase chain reaction (RT-PCR) under normal culture conditions. An hspA mutant exhibited reduced tolerance to heat, especially in the presence of MgSO4, but no change in pathogenicity. Results of size-exclusion chromatography indicated that purified HspA(his), containing six C-terminal histidine residues, formed two different size classes of oligomeric complexes--410 and 820 kDa. In contrast, HspA(ter), the unmodified protein translated from the original hspA gene, formed only the 820-kDa complex. These results suggest that the C-terminus of HspA is important for oligomerization. Both HspA820(his) and HspA410(his) were able to partially protect luciferase against heat-induced aggregation. Unlike other reported sHSPs that commonly capture denaturing proteins in refoldable states until refolded by adenosine triphosphate-dependent chaperone systems, HspA(his) alone was capable of reactivating heat-inactivated EcoRI. Thus, Xanthomonas campestris pv. campestris HspA has potential application as a protective agent during the storage of proteins.

Mutation of the gene encoding a major outer-membrane protein in Xanthomonas campestris pv. campestris causes pleiotropic effects, including loss of pathogenicity.

Xanthomonas campestris pv. campestris (Xcc) is the phytopathogen that causes black rot in crucifers. The xanthan polysaccharide and extracellular enzymes produced by this organism are virulence factors, the expression of which is upregulated by Clp (CRP-like protein) and DSF (diffusible signal factor), which is synthesized by RpfF. It is also known that biofilm formation/dispersal, regulated by the effect of controlled synthesis of DSF on cell-cell signalling, is required for virulence. Furthermore, a deficiency in DSF causes cell aggregation with concomitant production of a gum-like substance that can be dispersed by addition of DSF or digested by exogenous endo-beta-1,4-mannanase expressed by Xcc. In this study, Western blotting of proteins from a mopB mutant (XcMopB) showed Xcc MopB to be the major outer-membrane protein (OMP); Xcc MopB shared over 97 % identity with homologues from other members of Xanthomonas. Similarly to the rpfF mutant, XcMopB formed aggregates with simultaneous production of a gummy substance, but these aggregates could not be dispersed by DSF or endo-beta-1,4-mannanase, indicating that different mechanisms were involved in aggregation. In addition, XcMopB showed surface deformation, altered OMP composition, impaired xanthan production, increased sensitivity to stressful conditions including SDS, elevated temperature and changes in pH, reduced adhesion and motility and defects in pathogenesis. The finding that the major OMP is required for pathogenicity is unprecedented in phytopathogenic bacteria.

Genomic characterization of the intron-containing T7-like phage phiL7 of Xanthomonas campestris.

The lytic phage phiL7, which morphologically belongs to the Siphoviridae family, infects Xanthomonas campestris pv. campestris. Nucleotide sequence analysis has revealed that phiL7 contains a linear double-stranded DNA genome (44,080 bp, 56% G+C) with a 3'-protruding cos site (5'-TTACCGGAC-3') and 59 possible genes. Among the deduced proteins, 32 have homologs with known functions and 18 show no database similarities; moreover, the genes encoding these 18 proteins mostly have varying G+C contents and form clusters dispersed along the genome. Only 39 genes have sequences related (27% to 78%) to those of sequenced genes of X. oryzae pv. oryzae phages, although the genome size and architecture of these Xanthomonas phages are similar. These findings suggest that phiL7 acquired genes by horizontal transfer, followed by evolution via various types of mutations. Major differences were found between phiL7 and the X. oryzae pv. oryzae phages: (i) phiL7 has a group I intron inserted in the DNA polymerase gene, the first such intron observed in Xanthomonas phages; (ii) although infection of phiL7 exerted inhibition to the host RNA polymerase, similar to the situations in X. oryzae pv. oryzae phages Xp10 and Xop411, sequence analysis did not identify a homologue of the Xp10 p7 that controls the shift from host RNA polymerase (RNAP) to viral RNAP during transcription; and (iii) phiL7 lacks the tail fiber protein gene that exhibits domain duplications thought to be important for host range determination in OP1, and sequence analysis suggested that p20 (tail protein III) instead has the potential to play this role.

Comparison of genomes of three Xanthomonas oryzae bacteriophages.

BACKGROUND: Xp10 and OP1 are phages of Xanthomonas oryzae pv. oryzae (Xoo), the causative agent of bacterial leaf blight in rice plants, which were isolated in 1967 in Taiwan and in 1954 in Japan, respectively. We recently isolated the Xoo phage Xop411. RESULTS: The linear Xop411 genome (44,520 bp, 58 ORFs) sequenced here is 147 bp longer than that of Xp10 (60 ORFs) and 735 bp longer than that of OP1 (59 ORFs). The G+C contents of OP1 (51%) and Xop411 and Xp10 (52% each) are less than that of the host (65%). The 9-bp 3'-overhangs (5'-GGACAGTCT-3') in Xop411 and Xp10 are absent from OP1. More of the deduced Xop411 proteins share higher degrees of identity with Xp10 than with OP1 proteins, while the right end of the genomes of Xp10 and OP1, containing all predicted promoters, share stronger homology. Xop411, Xp10, and OP1 contain 8, 7, and 6 freestanding HNH endonuclease genes, respectively. These genes can be classified into five groups depending on their possession of the HNH domain (HNN or HNH type) and/or AP2 domain in intact or truncated forms. While the HNN-AP2 type endonuclease genes dispersed in the genome, the HNH type endonuclease genes, each with a unique copy, were located within the same genome context. Mass spectrometry and N-terminal sequencing showed nine Xop411 coat proteins, among which three were identified, six were assigned as coat proteins (4) and conserved phage proteins (2) in Xp10. The major coat protein, in which only the N-terminal methionine is removed, appears to exist in oligomeric forms containing 2 to 6 subunits. The three phages exhibit different patterns of domain duplication in the N-terminus of the tail fiber, which are involved in determination of the host range. Many short repeated sequences are present in and around the duplicated domains. CONCLUSION: Geographical separation may have confined lateral gene transfer among the Xoo phages. The HNN-AP2 type endonucleases were more likely to transfer their genes randomly in the genome and may degenerate after successful transmission. Some repeated sequences may be involved in duplication/loss of the domains in the tail fiber genes.

Characterization of a novel T4-type Stenotrophomonas maltophilia virulent phage Smp14.

Stenotrophomonas maltophilia (Sm), with most of the isolates being resistant to multidrugs, is an opportunistic bacterium causing nosocomial infections. In this study, a novel virulent Sm phage, Smp14, was characterized. Electron microscopy showed that Smp14 resembled members of Myoviridae and adsorbed to poles of the host cells during infection. It lysed 37 of 87 clinical Sm isolates in spot test, displayed a latent period of ca. 20 min, and had a burst size of ca. 150. Its genome (estimated to be 160 kb by PFGE), containing m4C and two unknown modified bases other than m5C and m6A as identified by HPLC, resisted to digestion with many restriction endonucleases except MseI. These properties indicate that it is a novel Sm phage distinct from the previously reported phiSMA5 which has a genome of 250 kb digestible with various restriction enzymes. Sequencing of a 16 kb region revealed 12 ORFs encoding structural proteins sharing 15-45% identities with the homologues from T4-type phages. SDS-PAGE displayed 20 virion proteins, with the most abundant one being the 39 kDa major capsid protein (gp23), which had the N-terminal 52 amino acids removed. Phylogenetic analysis based on gp23 classified Smp14 into a novel single-membered T4-type subgroup.

A novel lysozyme from Xanthomonas oryzae phage varphiXo411 active against Xanthomonas and Stenotrophomonas.

In this study, a bacteriophage of Xanthomonas oryzae pv. oryzae designated as varphiXo411 was isolated. Random sequencing of its genome revealed that it is closely related to another X. oryzae phage, Xp10. A cloned fragment carries the lysozyme gene, lys411. The deduced protein, Lys411, shares 92% identity with Xp10 lysozyme, which contains an extra 46 aa at the N-terminus. Lys411 shows over 40% identities to several other phage lysozymes. The His-tagged protein, Lys411H, expressed in Escherichia coli largely formed as inclusion bodies. The insoluble protein was solubilized in urea and purified by passing through a His-bind column, and the lytic activity was then restored by a refolding process. The optimal assay conditions determined for Lys411H are in 0.1M potassium phosphate buffer, pH 6.6 containing 1 mM CuCl(2) at 25 degrees C. Lysis assays using different bacterial cells as the substrates indicate that Lys411H is the first lysozyme active against both Xanthomonas and Stenotrophomonas maltophilia. This suggests that Lys411 can be a candidate to be developed into a therapeutic agent for treating S. maltophilia infections, in addition to the potential use in control of the plant diseases caused by Xanthomonas. By analogy to the situation in Xp10, we predict that varphiXo411 has no holin, the protein required for lysozyme export, and the N-terminal signal-arrest-release sequence of Lys411 can accommodate its own export to the periplasm.

Unusually strong positive cooperativity in binding of peptides to latent membrane protein-1 DNA fragments of the Epstein-Barr viral gene.

The DNA-binding preferences of two oligopeptide amides, (His-Pro-Arg-Lys)(3)NH(2) (HR-12) and (Ser-Pro-Arg-Lys)(3)NH(2) (SP-12), have been examined by quantitative DNase I footprinting studies. Two different DNA fragments were investigated: a pair of 5'-(32)P-labeled duplexes from pBR322 with one or other of the complementary strands labeled and a corresponding pair of 5'-(32)P-labeled duplexes representing fragments of the latent membrane protein (LMP-1) gene from a pathogenic Epstein-Barr virus variant derived from nasopharyngeal carcinoma. The major objective was to examine molecular recognition and cooperative features associated with sequence-selective binding of synthetic peptides to the LMP-1 fragments. At various binding sites on the pBR322 fragments, Hill coefficients (n(H)) ranging from 1.9-2.2 were observed; these results indicate modest positive cooperativity between binding sites for both peptides. By contrast, unusually high values of n(H), ranging from 4.0-9.3, were observed at various binding sites on the LMP-1 fragments. Allosteric models can be constructed to interpret the observed cooperative interactions between different DNA recognition sites in the LMP-1 gene upon binding of the peptide ligands. It is noteworthy that these models feature a novel network of cooperativity interconnecting multiple DNA allosteric sites. The evidence of sequence selectivity and strong cooperativity discovered in this work may prove to be a general feature of peptide interactions with some nucleic acids.

Isolation and characterization of novel giant Stenotrophomonas maltophilia phage phiSMA5.

Stenotrophomonas maltophilia is one of the most prevalent opportunistic bacteria causing nosocomial infections. It has become problematic because most of the isolates are resistant to multiple antibiotics, and therefore, development of phage therapy has attracted strong attention. In this study, eight S. maltophilia phages were isolated from clinical samples including patient specimens, catheter-related devices, and wastewater. These phages can be divided into four distinct groups based on host range and digestibility of the phage DNAs with different restriction endonucleases. One of them, designated phiSMA5, was further characterized. Electron microscopy showed it resembled Myoviridae, with an isometric head (90 nm in diameter), a tail (90 nm long), a baseplate (25 nm wide), and short tail fibers. The phiSMA5 double-stranded DNA, refractory to digestion by most restriction enzymes, was tested and estimated to be 250 kb by pulsed-field gel electrophoresis. This genome size is second to that of the largest phage, phiKZ of Pseudomonas aeruginosa. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, 25 virion proteins were visualized. N-terminal sequencing of four of them suggested that each of them might have had its N terminus cleaved off. Among the 87 S. maltophilia strains collected in this study, only 61 were susceptible to phiSMA5, indicating that more phages are needed toward a phage therapy strategy. Since literature search yielded no information about S. maltophilia phages, phiSMA5 appears to be the first reported.

Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator.

Identification and characteristic analysis of the ampC gene encoding beta-lactamase from Vibrio fischeri.

Vibrio fischeri ATCC 7744 is an ampicillin resistant (Amp(r)) marine luminous bacterium. The MIC test indicates that V. fischeri is highly resistant to penicillins, and susceptible to cephalosporins. V. fischeri ampC gene was cloned and identified. Nucleotide sequence of an unidentified ufo gene and the ampC, ppiB genes (GenBank Accession No. AY438037) has been determined; whereas the ampC gene encodes the beta-lactamase (AmpC) and the ppiB gene encodes the peptidyl-prolyl cis-trans isomerase B. Alignment and comparison show that V. fischeri beta-lactamase is homologous to the related species'. The specific amino acid residues STFK (62nd to 65th), SDN (122nd to 124th), and D (155th) located 34 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. V. fischeri ampC gene encoding beta-lactamase has a calculated M(r) 31,181 and comprises 283 amino acid residues (pI 5.35). There is a signal peptide of 18 amino acid residues MKIKPFLFGLIVLANNAI in the pro-beta-lactamase, which functioned for secretion; thus, the matured protein only has M(r) 29,197 and comprises 265 amino acid residues (pI 4.95). SDS-PAGE and the beta-lactamase functional assays elicit that the M(r) of the beta-lactamases are close to 29kDa. IEF and the beta-lactamase functional assays show that the beta-lactamases' pI are close to 4.8 as predicted. The results elucidate that V. fischeri ampC gene and the cloned ampC gene in Escherichia coli are the same one. The gene order of the ampC and the related genes is -ufo-(P*-intern)-ampC-ppiB--> (P*-intern: intern promoter for sub-regulation), whereas the P*-intern promoter displays the function to lead the ampC gene's expression for stress response.

Constitutive expression of a chromosomal class A (BJM group 2) beta-lactamase in Xanthomonas campestris.

Sequencing of the upstream region of the beta-lactamase gene from Xanthomonas campestris pv. campestris 11 (bla(XCC-1)) revealed the cognate ampR1 gene (289 amino acids, 31 kDa). It runs divergently from bla(XCC-1) with a 100-bp intergenic region (IG) containing partially overlapped promoters with structural features typical of the bla-ampR IG. The deduced AmpR1 protein shows significant identity in amino acid sequence and conserved motifs with AmpR proteins of other species, e.g., of Pseudomonas aeruginosa (58.2% amino acid identity). Results of insertional mutation, complementation tests, and beta-lactamase assays suggested that expression of bla(XCC-1) was constitutive and dependent on AmpR1. Four bla genes and two ampR genes are present in the fully sequenced X. campestris pv. campestris ATCC 33913 genome, with XCC3039 and XCC3040 considered the analogues of bla(XCC-1) and ampR1, respectively. An ampR1 homologue was detected by Southern hybridization in the ampicillin-resistant Xanthomonas strains, which appear to express beta-lactamase constitutively. Although the significance remains to be studied, constitutive expression of beta-lactamase by a widespread bacterial genus raises environmental concerns regarding the dissemination of resistance genes.