Enhanced Hydrogen Production via Photothermal-Coupled Ultrasound Pyrolysis of Waste Bio-Oil.

The creation of hydrogen using the lower-cost feedstock, waste organics (WOs), e.g. kitchen waste bio-oil, is a win-win solution, because it can both solve energy problems and reduce environmental pollution. Ultrasound has received considerable interest in organic decomposition; however, the application of ultrasound alone is not a good choice for the hydrogen production from WOs, because of the energy consumption and efficiency. To boost the hydrogen production based on ultrasonic cavitation cracking of bio-oil, photothermal materials are introduced into the hydrogen production system to form localized hot spots. Materials carbon black (CB), carbon nanotubes (CNT), and silicon dioxide (SiO2) all exhibit significant enhancing effects on the hydrogen production from bio-oil, and the CB exhibits the most significant strengthening effect among these materials. When the dosage of CB is 5 mg, hydrogen production rate is 180.1 µmol · h-1, representing a notable 1.7-fold increase compared to the production rate without CB. In the presence of light and ultrasound, the hydrogen production rate can be increased by 66.7-fold compared to the situation where only light is present without ultrasound.

Engineering a Self-Assembled Protein Cage for Targeted Dual Functionalization.

Self-assembled protein cages are attractive scaffolds for organizing various proteins of interest (POIs) toward applications in synthetic biology and medical science. However, specifically attaching multiple POIs to a single protein cage remains challenging, resulting in diversity among the functionalized particles. Here, we present the engineering of a self-assembled protein cage, DTMi3ST, capable of independently recruiting two different POIs using SpyCatcher (SC)/SpyTag (ST) and DogCatcher (DC)/DogTag (DT) chemistries, thereby reducing variability between assemblies. Using fluorescent proteins as models, we demonstrate controlled targeting of two different POIs onto DTMi3ST protein cages both in vitro and inside living cells. Furthermore, dual functionalization of the DTMi3ST protein cage with a membrane-targeting peptide and ß-galactosidase resulted in the construction of membrane-bound enzyme assemblies in Escherichia coli, leading to a 69.6% enhancement in substrate utilization across the membrane. This versatile protein cage platform provides dual functional nanotools for biological and biomedical applications.

Melatonergic Signaling Sustains Food Allergy Through FcεRI Recycling.

The prevalence of food allergies is increasing dramatically and causing serious public health concerns. Notably, melatonin metabolism imbalance in patients with food allergies; however, the role of melatonin in food allergies remains unclear. Here, we demonstrated that melatonin suppresses food allergy responses and reprograms the gut microbiota of food-allergic mice, while melatonin aggravates food allergy during gut microbiota depletion. Mechanistically, melatonin boosts the degranulation of mast cells by up-regulating the expression of membrane high-affinity immunoglobulin E (IgE) receptor (FcεRI). Melatonin increases the mRNA expression of Rabenosyn-5 (a component of factors for endosome recycling and Rab interactions) through melatonin receptor 2 (MT2)-extracellular signal-regulated kinase (ERK) signaling, thereby driving the recycling of FcεRI and elevating the abundance of membrane FcεRI. Likewise, the inhibition of MT2 attenuates melatonin-induced food allergy in mice with gut microbiota depletion. Collectively, our finding provides insights into the pathogenesis of food allergies and provides a potential therapeutic target for the prevention and treatment of food allergies.

Metabolic and microbial mechanisms related to the effects of dietary wheat levels on intramuscular fat content in finishing pigs.

The current study aimed to investigate the metabolic and microbial mechanisms behind the effects of dietary wheat levels on intramuscular fat (IMF) content in the psoas major muscle (PM) of finishing pigs. Thirty-six barrows were arbitrarily assigned to two groups and fed with diets containing 25% or 55% wheat. Enhancing dietary wheat levels led to low energy states, resulting in reduced IMF content. This coincided with reduced serum glucose and low-density lipoprotein cholesterol levels. The AMP-activated protein kinase α2/sirtuin 1/peroxisome proliferator-activated receptor-γ coactivator 1α pathway may be activated by high-wheat diets, causing downregulation of adipogenesis and lipogenesis genes, and upregulation of lipolysis and gluconeogenesis genes. High-wheat diets decreased relative abundance of Lactobacillus and Coprococcus, whereas increased SMB53 proportion, subsequently decreasing colonic propionate content. Microbial glycolysis/gluconeogenesis, d-glutamine and D-glutamate metabolism, flagellar assembly, and caprolactam degradation were linked to IMF content. Metabolomic analysis indicated that enhancing dietary wheat levels promoted the protein digestion and absorption and affected amino acids and lipid metabolism. Enhancing dietary wheat levels reduced serum glucose and colonic propionate content, coupled with strengthened amino acid metabolism, contributing to the low energy states. Furthermore, alterations in microbial composition and propionate resulted from high-wheat diets were associated with primary bile acid biosynthesis, arachidonic acid metabolism, steroid hormone biosynthesis, and biosynthesis of unsaturated fatty acids, as well as IMF content. Colonic microbiota played a role in reducing IMF content through modulating the propionate-mediated peroxisome proliferators-activated receptor signaling pathway. In conclusion, body energy and gut microbiota balance collectively influenced lipid metabolism.

Impacts of Dietary Standardized Ileal Digestible Lysine to Net Energy Ratio on Lipid Metabolism in Finishing Pigs Fed High-Wheat Diets.

The present study aimed to investigate the impacts of dietary standardized ileal digestible lysine to net energy (SID Lys:NE) ratio on lipid metabolism in pigs fed high-wheat diets. Thirty-six crossbred growing barrows (65.20 ± 0.38 kg) were blocked into two treatment groups, fed high-wheat diets with either a high SID Lys:NE ratio (HR) or a low SID Lys:NE ratio (LR). Each treatment group consisted of three replicates, with six pigs per pen in each replicate. The diminishing dietary SID Lys:NE ratio exhibited no adverse impacts on the carcass trait (p > 0.05) but increased the marbling score of the longissimus dorsi muscle (p < 0.05). Meanwhile, LR diets tended to increase the serum triglyceride concentration (p < 0.1). LR diets upregulated fatty acid transport protein 4 and acetyl-coA carboxylase α expression levels and downregulated the expression level of adipose triglyceride lipase (p < 0.05). LR diets improved energy metabolism via decreasing the expression levels of AMP-activated protein kinase (AMPK) α1, sirtuin 1 (SIRT1), and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) (p < 0.05). Additionally, LR diets stimulated hepatic bile acid synthesis via upregulating the expression levels of cytochrome P450 family 7 subfamily A member 1 and cytochrome P450 family 27 subfamily A member 1, and downregulating farnesol X receptor (FXR) and small heterodimer partner (SHP) expression levels (p < 0.05). A lowered SID Lys:NE ratio affected the colonic microbial composition, characterized by increased relative abundances of YRC22, Parabacteroides, Sphaerochaeta, and Bacteroides, alongside a decreased in the proportion of Roseburia, f_Lachnospiraceae_g_Clostridium, Enterococcus, Shuttleworthia, Exiguobacterium, Corynebacterium, Subdoligranulum, Sulfurospirillum, and Marinobacter (p < 0.05). The alterations in microbial composition were accompanied by a decrease in colonic butyrate concentration (p < 0.1). The metabolomic analysis revealed that LR diets affected primary bile acid synthesis and AMPK signaling pathway (p < 0.05). And the mantel analysis indicated that Parabacteroides, Sphaerochaeta, f_Lachnospiraceae_g_Clostridium, Shuttleworthia, and Marinobacter contributed to the alterations in body metabolism. A reduced dietary SID Lys:NE ratio improves energy metabolism, stimulates lipogenesis, and inhibits lipolysis in finishing pigs by regulating the AMPKα/SIRT1/PGC-1α pathway and the FXR/SHP pathway. Parabacteroides and Sphaerochaeta benefited bile acids synthesis, whereas f_Lachnospiraceae_g_Clostridium, Shuttleworthia, and Marinobacter may contribute to the activation of the AMPK signaling pathway. Overall, body metabolism and colonic microbiota collectively controlled the lipid metabolism in finishing pigs.

Dynamic Metabolons Using Stimuli-Responsive Protein Cages.

Naturally evolved metabolons have the ability to assemble and disassemble in response to environmental stimuli, allowing for the rapid reorganization of chemical reactions in living cells to meet changing cellular needs. However, replicating such capability in synthetic metabolons remains a challenge due to our limited understanding of the mechanisms by which the assembly and disassembly of such naturally occurring multienzyme complexes are controlled. Here, we report the synthesis of chemical- and light-responsive protein cages for assembling synthetic metabolons, enabling the dynamic regulation of enzymatic reactions in living cells. Particularly, a chemically responsive domain was fused to a self-assembled protein cage subunit, generating engineered protein cages capable of displaying proteins containing cognate interaction domains on their surfaces in response to small molecular cues. Chemical-induced colocalization of sequential enzymes on protein cages enhances the specificity of the branched deoxyviolacein biosynthetic reactions by 2.6-fold. Further, by replacing the chemical-inducible domain with a light-inducible dimerization domain, we created an optogenetic protein cage capable of reversibly recruiting and releasing targeted proteins onto and from the exterior of the protein cages in tens of seconds by on-off of blue light. Tethering the optogenetic protein cages to membranes enables the formation of light-switchable, membrane-bound metabolons, which can repeatably recruit-release enzymes, leading to the manipulation of substrate utilization across membranes on demand. Our work demonstrates a powerful and versatile strategy for constructing dynamic metabolons in engineered living cells for efficient and controllable biocatalysis.

Gut microbiota regulates host melatonin production through epithelial cell MyD88.

Melatonin has various physiological effects, such as the maintenance of circadian rhythms, anti-inflammatory functions, and regulation of intestinal barriers. The regulatory functions of melatonin in gut microbiota remodeling have also been well clarified; however, the role of gut microbiota in regulating host melatonin production remains poorly understood. To address this, we studied the contribution of gut microbiota to host melatonin production using gut microbiota-perturbed models. We demonstrated that antibiotic-treated and germ-free mice possessed diminished melatonin levels in the serum and elevated melatonin levels in the colon. The influence of the intestinal microbiota on host melatonin production was further confirmed by fecal microbiota transplantation. Notably, Lactobacillus reuteri (L. R) and Escherichia coli (E. coli) recapitulated the effects of gut microbiota on host melatonin production. Mechanistically, L. R and E. coli activated the TLR2/4/MyD88/NF-κB signaling pathway to promote expression of arylalkylamine N-acetyltransferase (AANAT, a rate-limiting enzyme for melatonin production), and MyD88 deficiency in colonic epithelial cells abolished the influence of intestinal microbiota on colonic melatonin production. Collectively, we revealed a specific underlying mechanism of gut microbiota to modulate host melatonin production, which might provide novel therapeutic ideas for melatonin-related diseases.

Dynamic Regulation of brsk2 in the Social and Motor Development of Zebrafish: A Developmental Behavior Analysis.

Both social and motor development play an essential role in an individual's physical, psychological, and social well-being. It is essential to conduct a dynamic analysis at multiple time points during the developmental process as it helps us better understand and evaluate the trajectory and changes in individual development. Recently, some studies found that mutations in the BRSK2 gene may contribute to motor impairments, delays in achieving motor milestones, and deficits in social behavior and communication skills in patients. However, little is known about the dynamic analysis of social and motor development at multiple time points during the development of the brsk2 gene. We generated a novel brsk2-deficient (brsk2ab-/-) zebrafish model through CRISPR/Cas9 editing and conducted comprehensive morphological and neurobehavioral evaluations, including that of locomotor behaviors, social behaviors, and anxiety behaviors from the larval to adult stages of development. Compared to wild-type zebrafish, brsk2ab-/- zebrafish exhibited a catch-up growth pattern of body length and gradually improved locomotor activities during the developmental process. In contrast, multimodal behavior tests showed that the brsk2ab-/- zebrafish displayed escalating social deficiency and anxiety-like behaviors over time. We reported for the first time that the brsk2 gene had dynamic regulatory effects on motor and social development. It helps us understand developmental trends, capture changes, facilitate early interventions, and provide personalized support and development opportunities for individuals.

Efficacy and Safety of Methylphenidate and Atomoxetine in Medication-Naive Children with Attention-Deficit Hyperactivity Disorder in a Real-World Setting.

BACKGROUND AND OBJECTIVE: Methylphenidate (MPH) and atomoxetine (ATX) are the most common medications used to treat attention-deficit hyperactivity disorder (ADHD) in China; however, despite this, there is still a paucity of studies comparing their efficacy and safety, particularly for different characteristics. To address the lack of research, a real-world prospective cohort study was conducted to examine these properties of MPH and ATX, and to analyze correlations associated with age, sex, and different ADHD presentation. METHODS: Children with ADHD meeting the eligibility criteria were recruited from January 2016 to July 2021. Study participants were treated with either MPH or ATX prescribed in the real-world setting, and were followed up for 26 weeks. Clinical efficacy response and adverse events (AEs) were recorded and measured. Subgroup analysis was performed to examine the efficacy response and AEs associated with age, sex, and different ADHD presentation. RESULTS: A total of 1050 children were recruited and 29 children were lost to follow-up. Of the 1021 children remaining, 533 were treated with MPH and 488 were treated with ATX. No significant differences were found in intelligence quotient, age, sex, or ADHD presentation between the MPH- and ATX-treated groups (p > 0.05). The response rates were 84.6% in the MPH-treated group and 63.3% in the ATX-treated group. Subgroup analysis of response rate demonstrated that the treatment effect of MPH over ATX was consistent across subgroups except in the girls (odds ratio [OR] 2.09, 95% confidence interval [CI] 0.97-4.7) and the hyperactive/impulsive presentation group (OR 2.88, 95% CI 0.77-12.76). A total of 47.8% of children experienced AEs during MPH treatment, significantly lower than the rate of 56.8% during ATX treatment (p < 0.05). The incidence of AEs in the MPH-treated group was higher in young children (<8 years: 56.8%; 8-10 years: 47.2%) and lower in children over 10 years of age (29.0%). CONCLUSIONS: Overall, MPH was more effective and better tolerated than ATX. The incidence of AEs in children treated with MPH varied with age, and was higher in young children and lower in children over 10 years of age.

Clinical characterization of PLAG1- related Silver-Russell syndrome：A clinical report.

BACKGROUND: Silver-Russell syndrome (SRS) is a rare genetic disorder that is mainly associated with prenatal and postnatal growth retardation. Loss of methylation on chromosome 11p15 and maternal uniparental disomy on chromosome 7 (upd(7)mat) are two common causes, accounting for approximately 50% and 10% of all patients, respectively. Pathogenic variants of genes, such as HMGA2, IGF2, CDKN1C, and PLAG1, have also been detected in patients with SRS. So far, SRS caused by PLAG1 alterations have only been described in two sporadic cases and three families. PATIENT PRESENTATION: The genetic and clinical manifestations of SRS in a patient carrying a novel variant of PLAG1 were reported and these results were compared with those of five previously reported cases. Trio-based whole-exome sequencing revealed a heterozygous variation in PLAG1 (NM_002655.3: c.131del; p.(Asn44Thrfs*6)) in an infant girl with clinical suspicion of SRS. Familial studies confirmed that the mutation was inherited from her father. As seen in previously reported cases, the patient presented with prenatal and postnatal growth retardation, relative macrocephaly at birth, prominent forehead during infancy, and triangular face. However, no clinical characteristics such as feeding difficulties, hypothyroidism, or psychomotor and speech delay. CONCLUSIONS: This study identified the sixth documented case of PLAG1 variants leading to SRS and expanded our knowledge of the molecular spectrum of SRS phenotypes.

Melatonin in food allergy: Mechanism and potential therapy.

Food allergy affects more than 500 million people in the world, and its prevalence is increasing at an alarming rate causing serious public health concerns; however, prevention and treatment methods are still under investigation and are relatively scarce so far. Insights on pathophysiology reveal a complex interplay of the immune cells (e.g., DCs, T cells, and B cells) resulting in allergy or tolerance. Studies have shown that melatonin metabolisms are altered in patients with allergic diseases, suggesting that melatonin might impact allergic diseases. Notably, melatonin can orchestrate the differentiation and function of immune cells. Additionally, the disease severities of many allergic diseases and the function of the immune system exhibit circadian rhythmicity. Therefore, melatonin, a rhythm regulator, may also act indirectly on the immune system through the circadian clock to regulate food allergies. Herein, we reviewed the impacts of melatonin on food allergy and its underlying regulatory mechanisms, providing a theoretical reference for melatonin as effective means of prevention and treatment for food allergy in the future.

First Report of Epicoccum latusicollum Causing Leaf Spot Disease on Banana in China.

Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (∼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 µl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.

A multicenter clinical study on parent-implemented early intervention for children with global developmental delay.

Objective: Early identification and intervention for children with global developmental delay (GDD) can significantly improve their prognosis and reduce the possibility of developing intellectual disability in the future. This study aimed to explore the clinical effectiveness of a parent-implemented early intervention program (PIEIP) for GDD, providing a research basis for the extended application of this intervention strategy in the future. Methods: During the period between September 2019 and August 2020, children aged 3 to 6 months diagnosed with GDD were selected from each research center as the experimental group and the control group. For the experimental group, the PIEIP intervention was conducted for the parent-child pair. Mid-term and end-stage assessments were performed, respectively, at 12 and 24 months of age, and parenting stress surveys were completed. Results: The average age of the enrolled children was 4.56 ± 1.08 months for the experimental group (n = 153) and 4.50 ± 1.04 months for the control group (n = 153). The comparative analysis of the variation in the progress between the two groups by independent t-test showed that, after the experimental intervention, the developmental quotient (DQ) of locomotor, personal-social, and language, as well as the general quotient (GQ) of the Griffiths Mental Development Scale-Chinese (GDS-C), the children in the experimental group demonstrated higher progress than those in the control group (P < 0.05). Furthermore, there was a significant decrease in the mean standard score of dysfunctional interaction, difficult children and the total level of parental stress in the term test for the experimental groups (P < 0.001 for all). Conclusions: PIEIP intervention can significantly improve the developmental outcome and prognosis of children with GDD, especially in the areas of locomotor, personal-social, and language.

Dietary nucleotides influences intestinal barrier function, immune responses and microbiota in 3-day-old weaned piglets.

Nucleotides (NTs) play a pivotal role in the growth and development of the intestine. This study aimed to evaluate the effects of nucleotides supplementation on the intestinal barrier function, immune responses and microbiota in 3-day-old weaned piglets. Ninety-six piglets weaned at 3-days after birth were randomly assigned to 2 treatments (6 replicates/treatment, 8 piglets/replicate) according to the average body weight. The dietary treatments consisted of the control (CON; fed a basal artificial milk) and nucleotides groups (NT; fed a basal artificial milk with 0.035 % nucleotides, the contents of CMP, UMP, AMP, GMP, and IMP were 1:1:1:1:1, respectively). Diarrhea rates were recorded, and blood and intestinal samples were collected on day 35 of the piglets. The current study showed that NTs supplementation tended to decrease the diarrhea rate of weaned piglets (P < 0.10). NTs increased villus height and the villus height-to-crypt depth (V/C) ratio in the ileum (P < 0.05). Dietary NTs up-regulated protein expression of ZO-1 in ileal mucosa (P < 0.05), and the protein expression of Occludin tended to increase. Furthermore, NTs up-regulated the mRNA expression of Mucin (MUC)2, while the mRNA expression of MUC4 was down-regulated in the ileal mucosa (P < 0.05). Besides, supplementation with NTs increased the ileal mucosa genes expression of IL-21, INF-γ, IL-10, IL-4, IL-6 and TNF-α (P < 0.05). Furthermore, dietary NTs increased the protein expression of NF-κB, IL-6 and TNF-α (P < 0.05), and the proteins expression of Occludin and p-NF-κB tended to be up-regulated in the ileal mucosa (P < 0.10). Furthermore, NTs supplementation increased short chain fatty acid in the colonic (P < 0.05). And NTs supplementation reduced the Firmicutes/Bacteroidota ratio in the colon, at the genus level, NTs enriched the relative abundance of Prevotella, Faecalibacterium and Olsenella (P < 0.05). These data indicate that NTs could increase the villus height, increase the V/C, regulate the expression of tight junction protein and mucin, improve the intestinal barrier of piglets, regulate the secretion of cytokines, improve the biological immunity, increase the abundance of beneficial bacteria, and thus reduce the diarrhea of piglets.

Behavioral and Sensory Deficits Associated with Dysfunction of GABAergic System in a Novel shank2-Deficient Zebrafish Model.

Hyper-reactivity to sensory inputs is a common and debilitating symptom of autism spectrum disorder (ASD), but the underlying neural abnormalities remain unclear. Two of three patients in our clinical cohort screen harboring de novo SHANK2 mutations also exhibited high sensitivity to visual, auditory, and tactile stimuli, so we examined whether shank2 deficiencies contribute to sensory abnormalities and other ASD-like phenotypes by generating a stable shank2b-deficient zebrafish model (shank2b-/-). The adult shank2b-/- zebrafish demonstrated reduced social preference and kin preference as well as enhanced behavioral stereotypy, while larvae exhibited hyper-sensitivity to auditory noise and abnormal hyperactivity during dark-to-light transitions. This model thus recapitulated the core developmental and behavioral phenotypes of many previous genetic ASD models. Expression levels of γ-aminobutyric acid (GABA) receptor subunit mRNAs and proteins were also reduced in shank2b-/- zebrafish, and these animals exhibited greater sensitivity to drug-induced seizures. Our results suggest that GABAergic dysfunction is a major contributor to the sensory hyper-reactivity in ASD, and they underscore the need for interventions that target sensory-processing disruptions during early neural development to prevent disease progression.

The efficacy of pediatric ultrasound guided brachial plexus block anesthesia and determination of optimal anesthetic drug dosage.

BACKGROUND: The objective of the present study was to investigate the effect of pediatric ultrasound guided brachial plexus block anesthesia and to determine the optimal anesthetic drug dosage. METHODS: Ninety-seven children who required elective upper limb surgery were randomly divided into three groups: group A with 32 cases, group B with 35 cases and group C with 30 cases. All three groups of patients underwent ultrasound guided brachial plexus block anesthesia. To compare differences of anesthetic effect, group A received 0.30% ropivacaine, group B received 0.40% ropivacaine, and group C received 0.50% ropivacaine. RESULTS: The total volume was 24 mL in each group. The onset time of ulnar nerve block in Group A was significantly longer than in Group B and Group C (P<0.05); there were no significant differences in onset time of nerve block of the other nerves among the three groups (P>0.05). Block maintenance time in Group A was significantly less than in Group B and Group C (P<0.05). The effective rate of anesthesia of Group A was lower than in Group B and Group C and the differences were statistically significant (P<0.05). There was no significant difference in the incidence of anesthetic complications among the three groups (P>0.05). CONCLUSIONS: Pediatric ultrasound guided brachial plexus block anesthesia is safe and reliable. Ropivacaine used at 0.40% is the optimal lower-concentration anesthetic dosage.

Rumen microbiota responses to the enzymatic hydrolyzed cottonseed peptide supplement under high-concentrate diet feeding process.

In current dairy production, dietary energy is always excessively provided with a high-concentrate diet feeding to improve milk production. However, this feeding practice disturbed the rumen microbial ecosystem and the balance between ruminal energy and nitrogen, resulting in decreased nutrient fermentability, which in turn declined the milk yield of dairy cows. Therefore, supplementation of dietary degradable nitrogen may be helpful for high dairy production. In this study, we evaluated the regulatory effects of easily utilized enzymatic hydrolyzed cottonseed peptide (EHP) supplements on rumen microbiota communities and rumen nutrient fermentability under high-concentrate feeding. For this purpose, a gradient concentrate of EHP (from 0.2 to 1.0%) was added to the high-concentrate basal substrates for an in vitro experiment. Each treatment contained three replicates, with three bottles in each replicate. Rumen fermentable parameters included microbial protein content, volatile fatty acids, and ammonia-N; the rumen nutrient degradability of dry matter, crude protein, neutral detergent fiber, acid detergent fiber, ether extracts, calcium, and phosphorus were further investigated after in vitro fermentation for 72 h. Then, rumen microbiota communities and their correlation with ruminal fermentation parameters and rumen nutritional degradability were analyzed to understand the regulatory mechanism of the EHP supplements on rumen fermentability. Results indicate that treatment with 0.6% of EHP supplements had the highest content of acetate, butyrate, and neutral detergent fiber degradability among all treatments. Furthermore, EHP supplements significantly increased the relative abundance of rumen cellulose and starch-degrading bacteria such as Ruminococcus, Bifidobacterium, and Acetitomaculum, and the high nitrogen utilizing bacteria Butyrivibrio and Pseudobutyrivibrio, which may further promote the rumen carbohydrate and nitrogen metabolism. In summary, supplementation of easily degraded small peptides helps reestablish rumen energy and nitrogen balance to promote the rumen fermentable functions and nutritional degradability under high-concentrate diet feeding circumstances. These findings may further promote dairy production.

Glycerol Monolaurate to Ameliorate Efficacy of Inactivated Pseudorabies Vaccine.

The present study is aimed to evaluate the effect of glycerol monolaurate (GML) on the growth performance and immune enhancement of pseudorabies virus (PRV)-inactivated vaccine in the early-weaned piglets. One hundred and twenty-five 28-day-old weaned piglets were randomly assigned to a control group (CON, no vaccine and no challenge), challenge control group (C-CON), inactivated PRV vaccine group (IPV), IPV + 500 mg/kg GML group (L-GML), and IPV + 1,000 mg/kg GML group (H-GML) during the entire 28-day experimental period. All the data analyses were performed by one-way analysis of variance (ANOVA) and multiple comparisons. Our results showed that the final weight, average daily gain (ADG), and average daily feed intake (ADFI) of H-GML were the highest in each group, and F/G of H-GML was increased but there was no significant difference with CON (p > 0.05). Levels of PRV glycoprotein B (gB) antibody and immunoglobulin in serum of L-GML and H-GML were higher than those of IPV, but only gB antibody levels and immunoglobulin G (IgG) in H-GML were significantly increased (p < 0.05). Compared with IPV, the contents of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and interleukin-1ß (IL-1ß) in serum of L-GML (TNF-α and IL-1ß: p > 0.05, IL-6: p < 0.05, respectively) and H-GML (p < 0.01, both) were all decreased, and the content of interleukin-10 (IL-10) in H-GML was increased (p > 0.05). Furthermore, reverse transcription-polymerase chain reaction (RT-PCR) experiments proved that L-GML and H-GML were both superior to IPV in inhibiting the expression of TNF-α (p < 0.01), IL-6 (p > 0.05), and IL-1ß (p < 0.01) mRNAs and promoting the expression of IL-10 mRNA (L-GML: p > 0.05, H-GML: p < 0.05, respectively) in the superficial inguinal lymph nodes. Histopathological examination found mild congestion in the lung and inguinal lymph nodes of IPV, while the tissues (brain, lung, and inguinal lymph nodes) of L-GML and H-GML were the same as CON with no obvious lesions. The above results indicate that GML may improve the growth performance of weaned piglets and enhance the immunity of PRV-inactivated vaccine by increasing the levels of PRV gB antibody and immunoglobulin and regulating cytokine levels.

Deleterious Variation in BR Serine/Threonine Kinase 2 Classified a Subtype of Autism.

Recently, deleterious variants in the BR serine/threonine kinase 2 (BRSK2) gene have been reported in patients with autism spectrum disorder (ASD), suggesting that BRSK2 is a new high-confidence ASD risk gene, which presents an opportunity to understand the underlying neuropathological mechanisms of ASD. In this study, we performed clinical and neurobehavioral evaluations of a proband with a de novo non-sense variant in BRSK2 (p.R222X) with other reported BRSK2 mutant patients. To validate BRSK2 as an ASD risk gene, we generated a novel brsk2b-deficient zebrafish line through CRISPR/Cas9 and characterized its morphological and neurobehavioral features as well as performed molecular analysis of neurogenesis-related markers. The proband displayed typical ASD behaviors and language and motor delay, which were similar to other published BRSK2 mutant patients. Morphologically, brsk2b -/- larvae exhibited a higher embryonic mortality and rate of pericardium edema, severe developmental delay, and depigmentation as well as growth retardation in the early developmental stage. Behaviorally, brsk2b-/- zebrafish displayed significantly decreased activity in open field tests and enhanced anxiety levels in light/dark tests and thigmotaxis analysis. Specifically, brsk2b-/- zebrafish showed a prominent reduction of social interaction with peers and disrupted social cohesion among homogeneous groups. Molecularly, the mRNA expression levels of homer1b (a postsynaptic density scaffolding protein), and mbpa, mpz, and plp1b (molecular markers of oligodendrocytes and myelination) were increased in the brain tissues of adult brsk2b-/- zebrafish, while the expression level of isl1a, a marker of motor neurons, was decreased. Taken together, for the first time, we established a novel brsk2b-deficient zebrafish model that showed prominent ASD-like behaviors. In addition, the disturbed mRNA expression levels of neurogenesis-related markers implied that the processes of postsynaptic signaling as well as oligodendrocytes and myelination may be involved. This discovery may suggest a path for further research to identify the underlying neuropathological mechanisms between BRSK2 and ASD.

Substation equipment temperature prediction based on multivariate information fusion and deep learning network.

Background: Substation equipment temperature is difficult to achieve accurate prediction because of its typical seasonality, periodicity and instability, complex working environment and less available characteristic information. Methods: To overcome these difficulties, a substation equipment temperature prediction method is proposed based on multivariate information fusion, convolutional neural network (CNN) and gated recurrent unite (GRU) in this article. Firstly, according to the correlation analysis including linear correlation mapping, autocorrelation function and partial autocorrelation function for substation equipment temperature data, the feature vectors from ambient, time and space are determined, that is the multivariate information fusion feature vector (denoted as MIFFV); secondly, the dimension of MIFFV is reduced by principal component analysis (PCA), extract some of the most important features and form the reduced feature vector (denoted as RFV); then, CNN is used for deep learning to extract the relationship between RFV and the high-dimensional space feature, and construct the high-dimensional feature vector of multivariate time series (denoted as HDFV); finally, the high-dimensional feature vector is used to train GRU deep learning network and predict the equipment temperature. Results: A substation equipment in Taizhou City, Zhejiang Province is conducted by the method proposed in this article. Through the comparative experiment from the two aspects of features and methods, under the two prediction performance evaluation indexes of mean absolute percentage error (MAPE) and root mean square error (RSME), two main conclusions are drawn: (1) MIFFV from three aspects of ambient features, time features and space features have better prediction performance than the single feature vector and the combined feature vector of two aspects; (2) compared with other four related models under the same conditions, RFV is regarded as the input of the models, the proposed model has better prediction performance.