Heat capacity changes associated with G-quadruplex unfolding.

G-quadruplexes are four-stranded DNA structures that have been found in the cell and are thought to act as elements of control in genomic events. The measurements of the thermodynamic stability, ΔG, of G-quadruplexes shed light on the molecular forces involved in the stabilization of these structures. In thermodynamic studies, the differential heat capacity, ΔCP, of the folded and unfolded states of a G-quadruplex is a fundamental property that describes the temperature dependences of the differential enthalpy, ΔH, entropy, ΔS, and free energy, ΔG. Despite its recognized importance, the ΔCP of G-quadruplex unfolding has not been measured directly. Here, we use differential scanning calorimetry to evaluate changes in heat capacity, ΔCP, accompanying the unfolding transitions of G-quadruplexes formed by modified DNA sequences from the promoter regions of the c-MYC, VEGF, and Bcl-2 oncogenes. The average value of ΔCP is 0.49 ± 0.12 kcal mol-1 K-1. Our analysis revealed that disregarding ΔCP leads to significant errors in extrapolated values of the differential enthalpy, ΔH, and entropy, ΔS, of the folded and unfolded DNA conformations. Although the compensation between ΔH and ΔS weakens the effect of ΔCP on the differential free energy, ΔG, neglecting ΔCP may still result in relative errors in ΔG extrapolated to room temperature as great as 140%. We emphasize the importance of proper consideration of the effect of ΔCP in conformational studies of guanine-rich DNA molecules.

Individualized 3D printed navigation template-assisted atlantoaxial pedicle screws vs. free-hand screws for the treatment of upper cervical fractures.

Objective: This study aims to compare the efficacy and safety of freehand atlantoaxial pedicle screws against custom 3D printed navigation template screws in the treatment of upper cervical fractures. Methods: In our institution from 2010 to 2020, a retrospective cohort analysis of 23 patients with upper cervical fractures was done. These patients were separated into two groups: group A (N = 12), which received customized 3D printed navigation template-assisted screws with virtual reality techniques, and group B (N = 11), which received freehand screws assisted by intraoperative fluoroscopy. Every patient was monitored for more than 1 year. The two groups were contrasted in terms of screw implant accuracy, cervical spine Japanese Orthopaedic Association (JOA) score, American Spinal Injury Association (ASIA) score, visual analogue scale (VAS) score, surgical time, fluoroscopy times, and intraoperative blood loss. Results: A total of 88 atlantoaxial pedicle screws in all, 46 in group A and 42 in group B, were implanted. In group A, the screw insertion accuracy rate was 95.7%, compared to 80.0% in group B (P < 0.05). When compared to group B, group A had shorter surgery times, less blood loss, fewer fluoroscopies, a higher short-term JOA score, and overt pain reduction (P < 0.05). However, there was no discernible difference between the two groups' VAS scores, long-term JOA scores, or ASIA scores (sensory and motor), at the most recent follow-up. Conclusion: Individualized 3D printed guide leads to significant improvement in the screw safety, efficacy, and accuracy, which may be a promising strategy for the treatment of upper cervical fractures.

Distribution of Conformational States Adopted by DNA from the Promoter Regions of the VEGF and Bcl-2 Oncogenes.

We employed a previously described procedure, based on circular dichroism (CD) spectroscopy, to quantify the distribution of conformational states adopted by equimolar mixtures of complementary G-rich and C-rich DNA strands from the promoter regions of the VEGF and Bcl-2 oncogenes. Spectra were recorded at different pHs, concentrations of KCl, and temperatures. The temperature dependences of the fractional populations of the duplex, G-quadruplex, i-motif, and coiled conformations of each promoter were then analyzed within the framework of a thermodynamic model to obtain the enthalpy and melting temperature of each folded-to-unfolded transition involved in the equilibrium. A comparison of the conformational data on the VEGF and Bcl-2 DNA with similar results on the c-MYC DNA, which we reported previously, reveals that the distribution of conformational states depends on the specific DNA sequence and is modulated by environmental factors. Under the physiological conditions of room temperature, neutral pH, and elevated concentrations of potassium ions, the duplex conformation coexists with the G-quadruplex conformation in proportions that depend on the sequence. This observed conformational diversity has biological implications, and it further supports our previously proposed thermodynamic hypothesis of gene regulation. In that hypothesis, a specific distribution of duplex and tetraplex conformations in a promoter region is fine-tuned to maintain the healthy level of gene expression. Any deviation from a healthy distribution of conformational states may result in pathology stemming from up- or downregulation of the gene.

[Development and clinical application of a new transverse process retractor based on computer-aided design and 3D printing technology].

OBJECTIVE: To manufacture a new type of transverse process retractor by using computer-aided design(CAD) combined with 3D printing technology and investigate its clinical application effect. METHODS: A new type of transverse protrusion retractor was developed by CAD combined with 3D printing technology. From September 2018 to September 2019, the new transverse process retractor was applied in clinic. Sixty patients with lumbar single segment lesions who needed treatment by pedicle screw fixation, bone grafting and interbody fusion were divided into new transverse process retractor group and control group, with 30 cases in each group. There were 14 males and 16 females in new type transverse process retractor group, the age was (68.0±4.3) years old on average; lesion segment of 8 cases were L3,4, 9 cases were L4,5, 13 cases were L5S1;5 cases of lumbar disc herniation, 20 cases of lumbar spinal stenosis, 5 cases of degenerative lumbar spondylolisthesis;new transverse process retractor was used to pedicle screw placement. While there were 15 males and 15 females in control group, with an average age of (69.2±4.5) years old;lesion segment of 8 cases were L3,4, 10 cases were L4,5, 12 cases were L5S1;5 cases of lumbar disc herniation, 21 cases of lumbar spinal stenosis, 4 cases of degenerative lumbar spondylolisthesis;the traditional lamina retractor was used for soft tissue pulling and finished pedicle screw placement by freehand. The length of surgical incision, the time required for inserting a single screw, fluoroscopy times, the times of adjusting the positioning needle or screw in insertion process, and the visual analogue scale (VAS) of surgical incision 72 hours after operation were compared between two groups. RESULTS: Using CAD and 3D printing technology, a new type of transverse protrusion retractor was developed quickly. The length of surgical incision, the time required for inserting a single screw, fluoroscopy time, and the times of adjusting the positioning needle or screw in insertion process in new transverse process retractor group were less than those in control group(P<0.05). There was no significant difference in VAS of lumbar incision pain at 72 hours after operation between two groups(P>0.05). CONCLUSION: Using CAD combined with 3D printing technology to develop a new transverse protrusion retractor has the advantages of convenient design, short development cycle and low cost. It provides a new idea for the research and development of new medical devices. The new transverse process retractor has the advantages of easy operation, reliable fixation, less damage to paravertebral muscle, convenient pedicle screw placement, reducing fluoroscopy time and so on.

[Effectiveness of synchronous unilateral percutaneous kyphoplasty in the treatment of double noncontiguous thoracolumbar osteoporotic vertebral compression fractures].

OBJECTIVE: To investigate the effectiveness of synchronous unilateral percutaneous kyphoplasty (PKP) in the treatment of double noncontiguous thoracolumbar osteoporotic vertebral compression fracture (OVCF). METHODS: Between December 2018 and September 2020, 27 patients with double noncontiguous thoracolumbar OVCF were treated by synchronous unilateral PKP. There were 11 males and 16 females, with an average age of 75.4 years (range, 66-92 years). The fractures were caused by falls in 22 cases and sprains in 5 cases. The time from injury to hospital admission was 0.5-7.0 days, with an average of 2.1 days. The fractured vertebrae located at T 9 in 2 cases, T 10 in 3 cases, T 11 in 10 cases, T 12 in 15 cases, L 1 in 12 cases, L 2 in 6 cases, L 3 in 4 cases, and L 4 in 2 cases. The volume of bone cement injected into each vertebral body, operation time, and intraoperative fluoroscopy times were recorded. Anteroposterior and lateral X-ray films of thoracolumbar spine were taken to observe the anterior height of the injured vertebra, the Cobb angle of kyphosis, and the diffusion and good distribution rate of bone cement in the thoracolumbar spine. Visual analogue scale (VAS) score and Oswestry disability index (ODI) were used to evaluate the pain and functional improvement. RESULTS: All operations completed successfully. The operation time was 34-70 minutes, with an average of 45.4 minutes. The intraoperative fluoroscopy was 21- 60 times, with an average of 38.6 times. The volume of bone cement injected into each vertebral body was 2-9 mL, with an average of 4.3 mL. All patients were followed up 6-21 months, with an average of 11.3 months. X-ray film reexamination showed that the anterior height of the injured vertebra and Cobb angle at each time point after operation were significantly improved than those before operation ( P<0.05), and there was no significant difference between different time points after operation ( P>0.05). The distribution of bone cement was excellent in 40 vertebral bodies, good in 13 vertebral bodies, and poor in 1 vertebral body, and the excellent and good rate was 98.1% (53/54). The pain of all patients significantly relieved or disappeared, and the function improved. The VAS score and ODI at each time point after operation were significantly lower than those before operation ( P<0.05), and there was no significant difference between different time points after operation ( P>0.05). CONCLUSION: For the double noncontiguous thoracolumbar OVCF, the synchronous unilateral PKP has the advantages of simple puncture, less trauma, less intraoperative fluoroscopy, shorter operation time, satisfactory distribution of bone cement, etc. It can restore the height of the vertebral body, correct the kyphotic angle, significantly alleviate the pain, and improve the function.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions. In this work, we report changes in volume, ΔV, and adiabatic compressibility, ΔKS, accompanying interconversions of G-strand between the G-quadruplex, duplex, and coil conformations in the presence and absence of C-strand. We rationalize these volumetric characteristics in terms of the hydration and intrinsic properties of the DNA in each of the sampled conformational states. We further use our volumetric results in conjunction with the reported data on changes in expansibility, ΔE, and heat capacity, ΔCP, associated with G-quadruplex-to-coil transitions to construct the pressure-temperature phase diagram describing the stability of the G-quadruplex. The phase diagram is elliptic in shape, resembling the classical elliptic phase diagram of a globular protein, and is distinct from the phase diagram for duplex DNA. The observed similarity of the pressure-temperature phase diagrams of G-quadruplexes and globular proteins stems from their shared structural and hydration features that, in turn, result in the similarity of their volumetric properties. To the best of our knowledge, this is the first pressure-temperature stability diagram reported for a G-quadruplex.

Surgical treatment for upper cervical deformity with atlantoaxial joint dislocation using individualized 3D printing occipitocervical fusion instrument: A case report and literature review.

ABSTRACT: To introduce a novel technique of using individualized 3D printing occipitocervical fusion instrument (3D-OCF) for the treatment of upper cervical deformity with atlantoaxial joint dislocation.The surgery for deformity of the craniocervical junction area is a challenge in the field of spine. If the surgical deviation is too large to injure the spinal cord or vertebral artery, it will cause catastrophic damage to the patient. Therefore, it is controversial whether these patients should undergo surgical treatment. We provide a novel surgical approach for the challenging upper cervical surgery through 3D-OCF and a typical patient.We present a 54-year-old female patient, who suffered from dizziness and numbness in her limbs for 8 months. After the patient was admitted, we performed the three-dimensional CT scan, modeled using Mimics software 17.0, and designed customized occipitocervical fusion instrument. Besides, we repeatedly perform simulated surgery based on 3D-printed models before surgery.The operative time was 142 minutes and the intraoperative blood loss was 700 mL. X-ray showed reduction of atlantoaxial dislocation and accurate position of internal fixation. The patient's symptoms were significantly relieved: the sensation of dizziness and numbness of limbs was obviously relieved, and the sense of banding in chest, abdomen, and ankle was disappeared. At the last follow-up, imaging showed that 3D-OCF had bone-integration and Syringomyelia was disappeared. The patient's cervical JOA (Japanese Orthopaedic Association) score increased from 10 points to 17 points.Individualized 3D-OCF can improve the safety and accuracy of upper cervical surgery, reduce the operative time and the number of fluoroscopy. Our study provides a novel surgical approach for the challenging upper cervical surgery.

Duplex-tetraplex equilibria in guanine- and cytosine-rich DNA.

Noncanonical four-stranded DNA structures, including G-quadruplexes and i-motifs, have been discovered in the cell and are implicated in a variety of genomic regulatory functions. The tendency of a specific guanine- and cytosine-rich region of genomic DNA to adopt a four-stranded conformation depends on its ability to overcome the constraints of duplex base-pairing by undergoing consecutive duplex-to-coil and coil-to-tetraplex transitions. The latter ability is determined by the balance between the free energies of participating ordered and disordered structures. In this review, we present an overview of the literature on the stability of G-quadruplex and i-motif structures and discuss the extent of duplex-tetraplex competition as a function of the sequence context of the DNA and environmental conditions including temperature, pH, salt, molecular crowding, and the presence of G-quadruplex-binding ligands. We outline how the results of in vitro studies can be expanded to understanding duplex-tetraplex equilibria in vivo.

[Experimental study of individualized 3D printing-guided template combined with thoracolumbar pedicle screw placement for the treatment of ankylosing spondylitis].

OBJECTIVE: To evaluate accuracy and safety of individualized 3D printing guided template for thoracolumbar pedicle screw placement in patients with ankylosing spondylitis. METHODS: From January 2016 to September 2019, thoracolumbar spine three-dimensional CT data of 8 patients with ankylosing spondylitis were included, Mimics 17.0 and ideaMaker computer software were applied to design thoracolumbar pedicle screw guided template of patients with AS, physical model of all patients (T10-L2)were printed by 3D printer, 2 parts in each patient, and divided into guide-plate-assisted screw group (experimental group) and free-hand nail group (control group). Thoracolumbar pedicle screws of both groups were placed by the same spinal surgeon. The accuracy of pedicle screw placement between two groups were evaluated according to results of postoperative CT, the accuracy of the fixation of thoracolumbar pedicle screw was divided into 4 grades, grade 0 and 1 screws were acceptable nails, grade 2 and 3 screws were unacceptable nails. The diameter and length of pedicle screws, the distance between entry point and posterior median line designed by preoperative 3D printing were compared with actual use in operation. RESULTS: Twenty three blocks of thoracolumbar 3D printing screw of ankylosing spondylitis guided templates were designed and printed in guide-plate-assisted screw group, 46 screws were inserted and 44 screws were accepted. The time of implanting a screw into thoracolumbar pedicle was (4.20±1.15) min, the frequency of X-ray was (5.00±1.25) times and the average adjustment times of screw and Kirschner needle during screw placement was (1.76±1.32) times. In the control group, 46 nails were placed by traditional surgical method and 30 screws were accepted. The time of implanting a screw into thoracolumbar pedicle was (14.67±2.23) min, the frequency of X-ray fluoroscopy was (14.46±2.21) times and the average times of Kirschner needle adjustment was (4.76±3.39) times. The success rates between experimental group and control group were 95.65%(44 / 46) and 56.22%(30 / 46) respectively, and had statistical difference (χ2=13.538, P<0.05). There was no significant difference in diameter, length of pedicle screws and the distance of posterior median line between virtual designed by 3D printing before operation and actual situation in opertaion (P>0.05). The operation time of inserting a single screw, the times of X-ray fluoroscopy, and the average times of adjustment screw and Kirschner needle in experimental group were significant less than those in control group(P<0.01). CONCLUSION: The personalized guide template assisted the thoracolumbar fixation designed by 3D printing could significantly improve safety, accuracy and efficiency of surgery, especially suitable for thoracolumbar vertebral bodies requiring posterior pedicle screw fixation for fracture or dislocation with AS.

[3D printing technology assisted the preoperative planning and application value in adult kyphoscoliosis deformity].

OBJECTIVE: To explore the application value of 3D printing technology in preoperative surgery plan and intraoperative auxiliary operation for adult kyphoscoliosis deformity. METHODS: The clinical data of 12 adult patients with kyphoscoliosis deformity treated from September 2017 to January 2019 were retrospectively analyzed. There were 3 males and 9 females, aged from 21 to 63 years old with an average of (47.67±13.32) years old. Among them, 4 cases were congenital kyphoscoliosis, 2 cases were old tuberculosis thoracolumbar kyphosis ; 2 cases were idiopathic kyphoscoliosis, 4 cases were degenerative kyphoscoliosis. The CT scan data of the patient's spine was imported into Mimics17.0 software to establish the three dimensional model of the spine, and the spine model was produced by 3D printer. Using the spine model simulated operation, preoperative surgery program planning and formulated a precise surgery, and further analysed postoperative imaging parameters improvement. All the patients were followed up for more than 1 year. Before and after operation and at the last follow-up, the scoliosis Cobb angle, maximum kyphosis Cobb angle, and coronal plane balance (distance between C 7 plumbline and center sacral vertical line, C7PL-CSVL), sagittal plane balance (sagittal vertical axis, SVA), pelvic parameters and other related imaging parameters were measured to further evaluate its orthopedic effect. RESULTS: Twelve patients with spine deformity were treated with different osteotomy and internal fixation fusion methods under the guidance of a 1∶1 spine model (pedicle screw placement of 4 patients with severe deformity were assisted by pedicle screw guide plates), nail placement and osteotomy have good effects, no major tissue damage such as blood vessels, nerves and spinal cord during and after surgery, no complications such as cerebrospinal fluid leakage and infection. Preoperative Cobb angle of scoliosis was (56.5±22.5) °, Cobb angle of kyphosis was (65.2±19.5) °, C7 PL-CSVL was (45.8±16.9) mm, SVA was (48.7±25.4) mm. Postoperative at 4 weeks, Cobb angle of scoliosis was (20.8±11.5) °, and Cobb angle of kyphosis was (22.0±6.6) °, with correction rates of (65.1±9.7)% and (64.6± 10.6)%, respectively ; C7 PL-CSVL was (22.3±8.9) mm, and SVA was (23.3±13.1) mm, all of which were significantly improved compared with preoperative results. The mean follow-up time was (18.5±7.9) months in 12 patients. At the last follow-up, the Cobb angles of scoliosis and kyphosis were (22.2±10.8) ° and (23.6±7.7) °, respectively, C7 PL-CSVL was (23.5±10.8) mm, and SVA was (24.7±12.5) mm. The results were statistically significant compared preoperative (P<0.05). There was no significant difference at the postoperative at 4 weeks and the last follow-up (P>0.05). CONCLUSION: The 3D print model can visually and clearly show the vertebral morphology and structure of adult kyphoscolisis and its spatial relationship with the adjacent vertebrae, blood vessels, and nerves, which provides a good and intuitive stereoscopic anatomical structure observation for the individualization of the surgical plan. Pre-simulation of operations to determine the internal fixation, fusion segment and osteotomy orthopedic way, may to provide a reference for actual clinical surgery, and can improve the accuracy and safety of surgery.

Conformational Preferences of DNA Strands from the Promoter Region of the c-MYC Oncogene.

We characterized the conformational preferences of DNA in an equimolar mixture of complementary G-rich and C-rich strands from the promoter region of the c-MYC oncogene. Our CD-based approach presupposes that the CD spectrum of such a mixture is the spectral sum of the constituent duplex, G-quadruplex, i-motif, and coiled conformations. Spectra were acquired over a range of temperatures at different pHs and concentrations of KCl. Each spectrum was unmixed in terms of the predetermined spectra of the constituent conformational states to obtain the corresponding weighting factors for their fractional contributions to the total population of DNA. The temperature dependences of those contributions then were analyzed in concert according to a model based on a thermodynamic representation of the underlying equilibria. Fitted estimates of the melting enthalpy and temperature obtained for the duplex, G-quadruplex, and i-motif imply that the driving force behind dissociation of the duplex and the concomitant formation of tetrahelical structures is the folding of the G-strand into the G-quadruplex. The liberated C-strand adopts the i-motif conformation at acidic pH and exists in the coiled state at neutral pH. The i-motif alone cannot induce dissociation of the duplex even at pH 5.0, at which it is most stable. Under the physiological conditions of neutral pH, elevated potassium, and room temperature, the duplex and G-quadruplex conformations coexist with the C-strand in the coiled state. Taken together, our results suggest a novel, thermodynamically controlled mechanism for the regulation of gene expression.

On urea and temperature dependences of m-values.

The denaturing or stabilizing influence of a cosolvent on a protein structure is governed by a fine balance of the energetics of the excluded volume effect and the energetics of direct protein-cosolvent interactions. We have previously characterized the energetic contributions of excluded volume and direct interactions with urea for proteins and protein groups. In this work, we examine the molecular origins underlying the relatively weak temperature and urea dependences of the m-values of globular proteins. Our combined experimental and computational results collectively paint a picture in which the relative independence of protein m-values of urea concentration originates from fortuitous compensatory effects of a progressive increase in the solvent-accessible surface area of the unfolded state and a slightly higher urea binding constant of the unfolded state relative to the folded state. Other denaturing cosolvents which lack such a compensation make poor candidates for linear extrapolation model-based protein stability determination studies. The observed diminution in m-values with increasing temperature reflects, in addition to the aforementioned compensatory effects, a decrease in protein-urea binding constants with temperature in accordance with the negative sign of the binding enthalpy.

The impact of pre-existing cancer on survival of prostate cancer patients: A population-based study.

Prostate cancer (PCa) is the second most common malignant tumors for male patients worldwide. However, whether a history of pre-existing cancer cases may affect the survival of prostate cancer patients is still not fully understood.We identified patients diagnosed with PCa between 2000 and 2014 from the Surveillance, Epidemiology, and End Results (SEER) linked database. We further made propensity score matching and then compared all-cause and cancer-specific survival between patients with and those without a pre-existing cancer. Cox proportional hazards models and Kaplan-Meier analysis were used for survival comparison.A total of 153,255 patients with PCa were included for analysis, of whom 5939 had a history of pre-existing cancer, including hematologic and lymph (11%), intestine (19%), urinary system (36%), head and neck (9%), lung (5%), skin (12%), and others (8%). Patients with a pre-existing cancer had a worse prognosis compared with those without a pre-existing cancer [all-cause death: hazard ratio (HR) = 2.74, P < .001; cancer-special death: HR = 3.98, P < .001]. Importantly, cancers in urinary bladder prior to PCa had a most adverse impact on all-cause (HR = 5.00, P < .001) and cancer-specific death risk (HR = 10.45, P < .001). Time between the pre-existing cancer and PCa had a dose-dependent effect on survival of PCa patients, with a decreased death risk as the increase of the interval time.Pre-existing cancer has a negative impact on the prognosis of patients with PCa, which is most evident in the presence of a pre-existing urinary bladder cancer. Our results provide epidemiologic evidence with low between-group bias, large sample size, and long-term follow-up, highlighting the need for site-, and interval-time-based clinical management for patients with PCa who had a pre-existing cancer.

Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study.

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ KS, of 12 ± 7 cm3 mol-1 bar and (73 ± 8) × 10-4 cm3 mol-1 bar-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ Shyd, and configurational, Δ Sconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ Sconf, is nearly compensated by a favorable change in the hydration contribution, Δ Shyd.

Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

Metabolite Kinetics: The Segregated Flow Model for Intestinal and Whole Body Physiologically Based Pharmacokinetic Modeling to Describe Intestinal and Hepatic Glucuronidation of Morphine in Rats In Vivo.

We used the intestinal segregated flow model (SFM) versus the traditional model (TM), nested within physiologically based pharmacokinetic (PBPK) models, to describe the biliary and urinary excretion of morphine 3ß-glucuronide (MG) after intravenous and intraduodenal dosing of morphine in rats in vivo. The SFM model describes a partial (5%-30%) intestinal blood flow perfusing the transporter- and enzyme-rich enterocyte region, whereas the TM describes 100% flow perfusing the intestine as a whole. For the SFM, drugs entering from the circulation are expected to be metabolized to lesser extents by the intestine due to the segregated flow, reflecting the phenomenon of shunting and route-dependent intestinal metabolism. The poor permeability of MG crossing the liver or intestinal basolateral membranes mandates that most of MG that is excreted into bile is hepatically formed, whereas MG that is excreted into urine originates from both intestine and liver metabolism, since MG is effluxed back to blood. The ratio of MG amounts in urine/bile [Formula: see text] for intraduodenal/intravenous dosing is expected to exceed unity for the SFM but approximates unity for the TM. Compartmental analysis of morphine and MG data, without consideration of the permeability of MG and where MG is formed, suggests the ratio to be 1 and failed to describe the kinetics of MG. The observed intraduodenal/intravenous ratio of [Formula: see text] (2.55 at 4 hours) was better predicted by the SFM-PBPK (2.59 at 4 hours) and not the TM-PBPK (1.0), supporting the view that the SFM is superior for the description of intestinal-liver metabolism of morphine to MG. The SFM-PBPK model predicts an appreciable contribution of the intestine to first pass M metabolism.