Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 130
Filtrar
1.
Artigo em Chinês | MEDLINE | ID: mdl-38538237

RESUMO

In January 2021, an acute chemical poisoning incident occurred at a fluorine polymerization plant. Through the analysis of the occupational health situation of the enterprise, combined with the clinical manifestations of the poisoned patients and the laboratory examination results, it was determined that the incident was an acute poisoning incident caused by the inhalation of organic fluorine mixed gas in the fluorine polymerization plant. Subsequently, it was clarified that the accident was caused by the illegal operation of the employees of the fluorine polymerization plant, which caused the discharge of the organic fluorine mixed gas containing high concentration of octafluoroisobutene, resulting in the poisoning of the on-site construction personnel. In order to avoid the occurrence of similar incidents, enterprises should implement the main responsibility of safety production, regularly organize supervision and inspection, eliminate illegal operations, conduct safety education and training for the staff of the unit and outsourced staff, and improve the emergency rescue ability of sudden poisoning incidents.


Assuntos
Saúde Ocupacional , Intoxicação , Humanos , Acidentes de Trabalho , Flúor , Polimerização , Intoxicação/epidemiologia
2.
Artigo em Chinês | MEDLINE | ID: mdl-38369793

RESUMO

Objective: To summarize the imaging presentations of the fallopian canal cerebrospinal fluid leaking (FCCFL). Methods: The high resolution CT (HRCT)and MRI materials of 4 patients (4 ears) with FCCFL confirmed by surgery between August 2016 to November 2023 were retrospectively analyzed. Among these, there were 2 males and 2 females, their ages ranged from 6 to 69 years. Results: All of the FCCFL were unilateral, including 2 on the left and 2 on the right.Clinically, the patients with FCCFL suffered from clear nasal fluid flow, ear tightness, and hearing loss. On CT, all of the affected ears were depicted markedly dilatation of the proximal portion of fallopian canal(FC), the labyrinthine segment and geniculate fossa were involved in 4 cases, and involvement of tympanic segment in 1 case at the same time. The geniculate fossa in the affected side were significantly enlarged, protruding upwards into the tympanic cavity, with one case simultaneously involving the cochlea. On MRI, the hyposignal on T1WI and hypersignal on T2WI or water sequence like cerebrospinal fluid (CSF) were shown in the enlargement FC, without diffusion restriction, and non-enhancing with administration Gadolinium contrast.CSF-like signal effusion was shown in all of the affected tympanum, of which, the CSF-like signal effusion was demonstrated in the area along the superficial petrosal nerve, the right pterygopalatine fossa and the parapharyngeal space. The adjacent intracranial meninges were presented thickening in 3 cases. Conclusion: The imaging appearances of FCCFL present some characteristics:on HRCT, the proximal portions of the affected FC depicts markedly enlargement,especially the geniculate fossa.While they present CSF-like signal, no diffusion restriction, and no enhancement administration, Gadolinium contrast on MRI, accompanying the CSF-like signal effusion in the affected tympanum.


Assuntos
Orelha Interna , Osso Temporal , Masculino , Feminino , Humanos , Criança , Adolescente , Adulto Jovem , Adulto , Pessoa de Meia-Idade , Idoso , Estudos Retrospectivos , Gadolínio , Orelha Interna/diagnóstico por imagem , Orelha Média , Imageamento por Ressonância Magnética , Vazamento de Líquido Cefalorraquidiano/diagnóstico por imagem
3.
Zhonghua Zhong Liu Za Zhi ; 45(11): 955-961, 2023 Nov 23.
Artigo em Chinês | MEDLINE | ID: mdl-37968081

RESUMO

Objective: To analyze the incidence and the related risk factors of retropharyngeal lymph node metastasis in patients with hypopharyngeal squamous cell carcinoma, evaluate the accuracy of preoperative enhanced CT in judging retropharyngeal lymph node metastasis, and investigate the impact of retropharyngeal lymph node metastasis on the prognosis. Methods: Retrospective analyses were made on 398 patients with hypopharyngeal squamous cell carcinoma who underwent surgery as the primary therapy and accepted retropharyngeal lymph node exploration and clearance during surgery in Shandong Provincial ENT Hospital from January 2014 to December 2019. Multivariate logistic regression analysis was used to clarify the related risk factors of retropharyngeal lymph node metastasis. Multivariate Cox regression analysis was used to investigate the impact of retropharyngeal lymph node metastasis on prognosis. The retropharyngeal lymph nodes of 218 cases with available preoperative enhanced CT images were evaluated by two experienced radiologists and compared with postoperative pathological results. Results: Retropharyngeal lymph node metastasis were confirmed in 54 of 398 (13.6%) cases according to postoperative pathology. The sensitivity and specificity of preoperative enhanced CT in the diagnosis of retropharyngeal lymph node metastasis were 34.6% and 91.1%, respectively, and the overall accuracy was 84.4%. Multivariate logistic regression analysis showed that the site of the primary lesion and pathological N stage were independent risk factors for retropharyngeal lymph node metastasis in hypopharyngeal squamous cell carcinoma. Patients with primary lesion located in the posterior wall of hypopharynx (OR=4.83, 95% CI: 1.27-18.40), N2 stage (OR=6.30, 95% CI: 2.25-17.67), and N3 stage (OR=26.89, 95% CI: 5.76-125.58) were prone to retropharyngeal lymph node metastasis. The 5-year overall survival rate of the 398 patients was 50.4%, and the 5-year disease-free survival rate was 48.3%. Multivariate Cox regression analysis showed that T stage, N stage, retropharyngeal lymph node metastasis, and radiotherapy were independent influencing factors for overall survival (T stage: HR=1.28, 95% CI: 1.06-1.54; N stage: HR=1.26, 95% CI: 1.14-1.40; retropharyngeal lymph node metastasis: HR=2.13, 95% CI: 1.47-3.08; radiotherapy: HR=0.54, 95% CI: 0.38-0.76) and disease-free survival of patients with hypopharyngeal squamous cell carcinoma (T stage: HR=1.26, 95% CI: 1.06-1.51; N stage: HR=1.25, 95% CI: 1.13-1.37; retropharyngeal lymph node metastasis: HR=2.24, 95% CI: 1.56-3.21; radiotherapy: HR=0.55, 95% CI: 0.40-0.77). Conclusions: Metastasis of retropharyngeal lymph nodes in hypopharyngeal squamous cell carcinoma is not rare. Enhanced CT is of low accuracy and limited value in diagnosing retropharyngeal lymph node metastasis. Primary lesions located in the posterior wall of the hypopharyngx, N2 stage, and N3 stage are independent high-risk factors for retropharyngeal lymph node metastasis. The prognosis of hypopharyngeal cancer patients with retropharyngeal lymph node metastasis is worse, and active surgical exploration and clearance can effectively reduce the mortality caused by retropharyngeal lymph node metastasis.


Assuntos
Carcinoma de Células Escamosas , Neoplasias de Cabeça e Pescoço , Neoplasias Hipofaríngeas , Humanos , Carcinoma de Células Escamosas de Cabeça e Pescoço/diagnóstico por imagem , Carcinoma de Células Escamosas de Cabeça e Pescoço/cirurgia , Carcinoma de Células Escamosas de Cabeça e Pescoço/patologia , Metástase Linfática/patologia , Estudos Retrospectivos , Carcinoma de Células Escamosas/diagnóstico por imagem , Carcinoma de Células Escamosas/cirurgia , Linfonodos/diagnóstico por imagem , Linfonodos/cirurgia , Linfonodos/patologia , Neoplasias Hipofaríngeas/diagnóstico por imagem , Neoplasias Hipofaríngeas/cirurgia , Prognóstico , Neoplasias de Cabeça e Pescoço/patologia , Estadiamento de Neoplasias
4.
Zhonghua Nei Ke Za Zhi ; 61(3): 298-303, 2022 Mar 01.
Artigo em Chinês | MEDLINE | ID: mdl-35263971

RESUMO

Objective: To analyze the risk factors of intracranial hemorrhage after implanting 125-iodine seeds for brain tumors. Methods: A total of 234 patients with intracranial tumors receiving treatment of 125-iodine seeds from March, 2013 to November, 2020 were retrospectively analyzed. Patients were divided into bleeding group and non-bleeding group according to whether postoperative intracranial hemorrhage was reported. Univariate and multivariate analysis was performed by logistic regression to determine the independent risk factors of intracranial hemorrhage. Result: A total of 22 cases (9.4%) reported postoperative intracranial hemorrhage in 234 patients treated with 125-iodine seeds. Univariate analysis showed that the type of tumor and the history of anti-angiogenic drug within one month were possible risk factors (P<0.1). Multivariate logistic regression analysis showed that anti-angiogenic drug within one month was the independent risk factor for intracranial hemorrhage (P<0.05). Conclusions: The application of anti-angiogenic drugs within one month is the independent risk factor of intracranial hemorrhage with 125-iodine seeds for the treatment of brain tumors.


Assuntos
Neoplasias Encefálicas , Neoplasias Encefálicas/complicações , Humanos , Hemorragias Intracranianas/etiologia , Radioisótopos do Iodo , Estudos Retrospectivos , Fatores de Risco
5.
Phys Rev E ; 102(4-1): 043213, 2020 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-33212587

RESUMO

Ground-state structures of a two-dimensional (2D) system composed of superparamagnetic charged particles are investigated by means of molecular dynamics simulation. The charged particles trapped in a quadratic potential interact with each other via the repulsive, attractive, and magnetic dipole-dipole forces. Simulations are performed within two regimes: a one-component system and a two-component system where the charged particles have the identical charge-to-mass ratio. The effects of magnetic dipole-dipole interaction, mixing ratio of the two species and confinement frequency on the ground-state structures are discussed. It is found that as the strength of the magnetic dipole increases, the charged particles tend to self-organize into chainlike structures. The two species particles exhibit different structural features, depending on the competition of electrostatic repulsive interaction, magnetic dipole-dipole interaction and confinement force. The potential lanes are observed through analyzing the global potential of the magnetic particles, which guide the unmagnetic particles aligning themselves in the direction of the potential lanes.

6.
Eur Rev Med Pharmacol Sci ; 24(18): 9378-9390, 2020 09.
Artigo em Inglês | MEDLINE | ID: mdl-33015779

RESUMO

OBJECTIVE: Gastric cancer is a common malignancy, with high metastasis and poor prognosis. Our purpose was to explore potential molecular mechanisms of gastric cancer. PATIENTS AND METHODS: A total of 10 pairs of gastric cancer tissues and adjacent normal gastric tissues were collected for RNA sequencing (RNA-seq), followed by differential expression analysis. Combining qRT-PCR results, two novel genes were selected for in-depth analysis, including up-regulated ONECUT and down-regulated SST. To investigate the effects of ONECUT and SST on the biological behaviors of gastric cancer cells, gastric cancer cell lines were transfected by ONECUT2 knockdown and SST overexpression. Afterwards, cell migration and invasion were examined using transwell assays, and the expressions of epithelial-mesenchymal transition (EMT)-related proteins were measured by Western blot analysis. Furthermore, cell viability was detected by CCK-8 assay. Finally, tumorigenicity in nude mice was performed. RESULTS: Gastric cancer cell migration and invasion were inhibited in BGC823 cells transfected by shONECUT2. Similar results were observed in SST overexpression in MGC803 cells. Silencing ONECUT2 or overexpressing SST reduced the expressions of mesenchymal markers (N-cadherin and vimentin), STAT3, fibronectin, Wnt2, ß-catenin and increased epithelial marker (E-cadherin), p-STAT3, smad2/3, α-catenin protein levels. In addition, inhibiting ONECUT2 or elevated SST suppressed tumor cell viability in vitro. Moreover, ONECUT2 silencing or elevated SST significantly inhibited tumor growth in vivo. CONCLUSIONS: Up-regulated ONECUT2 and down-regulated SST promote gastric cell migration, invasion, epithelial-mesenchymal transition and tumor growth in gastric cancer.


Assuntos
Regulação para Baixo , Transição Epitelial-Mesenquimal/genética , Proteínas de Homeodomínio/metabolismo , Somatostatina/metabolismo , Neoplasias Gástricas/metabolismo , Fatores de Transcrição/metabolismo , Regulação para Cima , Animais , Movimento Celular , Proliferação de Células , Células Cultivadas , Humanos , Masculino , Camundongos , Camundongos Nus , Neoplasias Experimentais/metabolismo , Neoplasias Experimentais/patologia , Neoplasias Gástricas/patologia
7.
Zhonghua Xin Xue Guan Bing Za Zhi ; 48(6): 507-512, 2020 Jun 24.
Artigo em Chinês | MEDLINE | ID: mdl-32842262

RESUMO

Objective: To develope and validate a reliable and sensitive liquid chromatography-tandem mass spectrometry (LC-MS/MS) method for determination of vardenafil concentration in plasma of rat. Methods: Plasma samples of normal Sprague-Dawley rats were collected. A Phenomenex Synergi Polar-RP 80A column (2.0 mm×50 mm, 4 µm) was used. Column temperature was set at 30 ℃. Mobile phase A was 0.1% formic acid in water; mobile phase B was 0.1% formic acid in acetonitrile. The flow rate was 0.4 ml/minutes. Quantitative determination was performed by electrospray ionization, operating in positive ion multiple reaction monitoring (MRM) mode. Cisapride was used as the internal standard. The feasibility of the method was evaluated by examining its specificity, linearity and quantitative range, precision and accuracy, matrix effects, and stability. Results: Under the selected chromatographic and mass spectrometry conditions, the monitoring ions of vardenafil and internal standard were mass-to-charge ratio(m/z) 489.3/151.2 and 466.4/234.2, the retention times of vardenafil and internal standard were 2.62 and 2.80 minutes, respectively, and the peak shape was satisfactory. The method has good linearity in the concentration range of 0.2-200 ng/ml. The intra-batch precision (%CV) and accuracy (%DEV) of vardenafil were 1.5%-9.7% and -6.8%-6.6%, respectively. The inter-batch precision and accuracy of vardenafil were 3.1% -8.4% and -3.7%-4.6%, respectively. In this sample processing method, the extraction recovery rate of vardenafil was obtained at range of 88.2%-104.6%, which met the requirements for the investigation of extraction recovery rate. In this sample processing method, the normalized matrix factor of each quality control concentration of vardenafil was 1.04, 0.85, and 1.04, and the coefficient of variation (%CV) was in the range of 1.7%-10.7%, which met the requirements for the investigation of matrix effects. Variations of short-term stability, long-term stability, and stability of 4 freeze-thaw cycles of vardenafil was within ±15%, and the coefficient of variation were within 5%. Conclusion: The high performance liquid chromatography-tandem mass spectrometry method established in this study is feasible for the measurement of concentration of vardenafil in rat plasma and this method has good specificity and high accuracy, and can be used to detect the concentration of vardenafil in rat plasma.


Assuntos
Espectrometria de Massas em Tandem , Animais , Cromatografia Líquida , Estudos de Viabilidade , Ratos , Ratos Sprague-Dawley , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Dicloridrato de Vardenafila
8.
Artigo em Chinês | MEDLINE | ID: mdl-31177692

RESUMO

Objective: To analysis the epidemic and spatial characteristics of pesticide poisoning in Quzhou during 2013-2017, and to provide scientific basis for the prevention and control of influenza in Quzhou in the future. Methods: The incidence data of pesticide poisoning from January 1, 2013 to December 31, 2017 in Quzhou collected from China Information System For Disease Control And Prevention. The descriptive analysis conducted by using SPSS18.0 software, and the Sa T Scan 9.2 software was used to complete space-time scan. Finally, ArcMap10.2 software was used to visualize the results. Results: There were 1819 cases of pesticide poisoning in Quzhou from 2007 to 2016, among which 298 cases were reported for productive poisoning, the incidence peak was from August to September, the highest number of patients in productive poisoning was in the age group of 46-60 years old and over 61 years old, with 109 patients in each group, and the number of male patients was significantly higher than that of female (χ(2)=63.857, P<0.01) . 1521 cases of non-productive pesticide poisoning were reported, among which the proportion of suicide poisoning (57.65%) was far higher than that of accidental poisoning (28.97%) , the number of female suicide poisoning was higher than that of male (χ(2)=5.510, P=0.019) , the proportion of accidental poisoning was the highest in the ≤15 years age group (89.00%, 89/100) , furthermore the number of suicide poisoning was the highest in the ≥61 years age group (314) . The incidence of pesticide poisoning could be detected by temporal-spatial scanning statistics, the time clustering is from August to September, the spatial clustering is in Jiangshan city, there are consistent with the descriptive of pesticide poisoning. Conclusion: The pesticide poisoning in Quzhou is mainly caused by non-productive suicide poisoning, and the spatial clustering is in Jiangshan city. Relevant departments should carry out targeted prevention and control measures according to the different characteristics of pesticide poisoning in clustered and non-clustered areas.


Assuntos
Praguicidas , Intoxicação , Suicídio , China/epidemiologia , Cidades , Feminino , Humanos , Incidência , Masculino , Pessoa de Meia-Idade , Praguicidas/intoxicação , Intoxicação/epidemiologia , Suicídio/estatística & dados numéricos
9.
Zhonghua Liu Xing Bing Xue Za Zhi ; 40(1): 70-73, 2019 Jan 10.
Artigo em Chinês | MEDLINE | ID: mdl-30669734

RESUMO

Objective: To understand the characteristics of HIV infected persons without long term disease progress [also known as long term non-progressors (LTNPs)], and related factors in Guangxi Zhuang Autonomous Region (Guangxi). Methods: Data of persons living with HIV and receiving no antiretroviral therapy in Guangxi by the end of 2016 were collected from the national HIV/AIDS comprehensive control and prevention information system of China. Results: By the end of 2016, there were 313 LTNPs in Guangxi, accounting for 2.3% of those being reported for more than 10 years, 5.4% of those being reported for more than 10 years and surviving, and 26.6% of those being reported for more than 10 years, surviving and receiving no antiretroviral therapy. Among the LTNPs, 87.2%(273) were men, 94.9% (297) were aged ≤ 40 years, 32.3% (101) were farmers, 55.6% (174) were single, divorced or widowed, 69.3% (217) were of Han ethnic group, 68.1% (213) were injecting drug users, and 52.1% (163) were from custody facilities. Multiple logistic regression analysis indicated that factors associated with delayed disease progression included age ≤40 years (compared with age >40 years, aOR=1.55, 95%CI: 1.31-3.12) and injection drug use (compared with sexual transmission, aOR=1.23, 95%CI: 1.10-1.74). Conclusions: A number of LTNPs existed in HIV-infected individuals in Guangxi. Further research are needed to identify the related factors, and it is necessary to conduct large sample size studies on host immunology, genetics and the virology of HIV to explore the related mechanism.


Assuntos
Usuários de Drogas/estatística & dados numéricos , Etnicidade/estatística & dados numéricos , Infecções por HIV/epidemiologia , Adolescente , Adulto , Distribuição por Idade , China/epidemiologia , Infecções por HIV/etnologia , Humanos , Masculino , Fatores Socioeconômicos
10.
Int Endod J ; 52(6): 819-828, 2019 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30565714

RESUMO

AIM: To identify the basic characteristics and gene expression profiles of supernumerary teeth derived stem cells (SNTSCs) and compare them with those of normal dental pulp stem cells (DPSCs). METHODOLOGY: Flow cytometry was conducted to identify the protein expression of stem cell markers. Cell proliferation, migration and differentiation abilities of both SNTSCs and DPSCs were determined by CCK8, transwell and differentiation assays, respectively. Gene expression profiles were studied by RNA sequencing analyses. After knocking down the expression of certain differential expression genes (DEGs), the function of DEGs was investigated by CCK8 and transwell assays. Statistical differences were determined using a two-tailed t-test and P values below 0.05 were considered significant. RESULTS: Supernumerary teeth derived stem cells were capable of differentiating into adipocyte, chondrocyte and osteoblast lineage cells, and compared to ordinary DPSCs, SNTSCs had a significantly higher cell proliferation rate (P < 0.01) and significantly lower migration rate (P < 0.01). RNA-seq results revealed the differential expression genes (DEGs) between SNTSCs and DPSCs. A principal component analysis (PCA) and cluster analysis revealed that the gene expression patterns of SNTSCs and DPSCs were different from each other. A total of 12 861 genes were differentially expressed at a significant P value (P ≤ 0.01), and 5292 of these increased in SNTSCs and 7569 decreased. Further study on the selected DEGs revealed that FUT11, FAM155A and BRD2 inhibited the cell proliferation rate of SNTSCs, and FUT11 and GLUD1 inhibited the cell migration rate, whilst FAM155A promoted the migration rate. CONCLUSIONS: The biological characteristics and gene expression profile of SNTSCs was revealed. The stem cell properties of SNTSCs were similar to normal DPSCs but they had a high cell proliferation rate and may have greater potential for cell differentiation.


Assuntos
Dente Supranumerário , Diferenciação Celular , Proliferação de Células , Células Cultivadas , Polpa Dentária , Humanos , Análise de Sequência de RNA , Células-Tronco
11.
Zhonghua Yi Xue Za Zhi ; 98(46): 3778-3783, 2018 Dec 11.
Artigo em Chinês | MEDLINE | ID: mdl-30541221

RESUMO

Objective: To investigate the effects of dexmedetomidine on perioperative stress and postoperative pain in patients with radical resection of esophageal cancer under combined thoracoscope and laparoscope. Methods: In this prospective study, one hundred patients undergoing radical resection of esophageal cancer in Affiliated Cancer Hospital of Zhengzhou University from January 2016 to October 2017, were randomly divided into control group (group C) and dexmedetomidine group (group D), n=50. All patients were anaesthetized (induced and maintained) with intravenous target-controlled infusion(TCl) of propofol and remifentanil, and intermittent intravenous injection of cisatracuriumbesylate. Bispectral index(BIS) was used to monitor the depth of anesthesia and maintained between 45-60 during operation.All patients received sufentanil (0.3 µg/kg) 30 min before the end of the operation and then received intravenous analgesia pump for postoperative patient controlled analgesia(PCA). Patients in group D received intravenous infusion of dexmedetomidine(1 µg/kg) 20 min before anesthesia induction, followed by intravenous pumping of dexmedetomidine(0.2 µg·kg(-1)·h(-1)) intraoperatively.Postoperative intravenous patient-controlled analgesia(PCA) was performed in all patients, with background doses of sufentanil 0.04 µg· kg(-1)·h(-1) for patients in group C, and sufentanil 0.025 µg·kg(-1)·h(-1) plus dexmedetomidine 0.1 µg· kg(-1)·h(-1) for patients in group D. The operation time, liquid input and output during operation, the number of PCA pressings after operation were recorded. At these time points: T(0)(the day before operation), T(1)(immediate before anesthesia induction), T(2)(1 h after emergence), T(3)(24 h after operation), T(4)(3 d after operation), T(5)(7 d after operation), T(6)(one month after operation), T(7)(3 months after operation) and T(8)(6 month after operation) , venous blood samples of patients were collected for detection of epinephrine, norepinephrine and corticosterone. The pain visual analogue scale(VSA) was used to assess pain levels in patients at T(2), T(3), T(4), T(5), T(6), T(7), T(8). Results: The age, sex ratio, body mass index (BMI) and ASA grading ratio in two groups were not significantly different(all P>0.05). There were no Significant differences in operation time, liquid input and blood output between group C and group D(all P>0.05). Within 24 h after operation, the sufentanil consumption in group D[(35.86±8.65)µg]was significantly less than that in group C[(59.53±15.26) µg, t=7.061, P<0.05], and the number of PCA pressing in group D(2.15±1.38) was obviously less than that in group C(5.85±2.16, t=4.971, P<0.05). Compared with group C, serum norepinephrines in group D was significantly less (t=13.276, 16.027, 14.319, 12.771, 12.296, respectively; all P<0.05) at T(1), T(2), T(3), T(4), T(5).And there were no difference between these two groups at T(0), T(6), T(7), T(8)(all P>0.05). Serum epinephrine in group D were significantly lower than them in group C at T(2), T(3), T(4), T(5) (t=6.153, 8.774, 9.127, 8.409, respectively; all P<0.05), but there were no difference between these two groups at T(0), T(1), T(6), T(7), T(8)(all P>0.05). Serum corticosterone in group D were sharply less than them in group C at T(2), T(3), T(4), T(5) (t=16.364, 15.306, 12.153, 12.592, respectively; all P<0.05), but at T(0), T(1), T(6), T(7), T(8), there were no difference between these two groups (all P>0.05). Compared with group C, the number of patients with postoperative pain(VAS score≥4) in group D was obviously less at T(6), T(7), T(8)(10 vs 20, 4 vs 12, 3 vs 10; χ(2)=4.762, 4.762, 4.332, respectively; all P<0.05). Conclusion: Perioperative application of dexmedetomidine can effectively decrease the perioperative stress response, obviously cut down the perioperative opioid consumption, and prevent the transition from postoperative acute pain to chronic pain in patients with radical resection of esophageal cancer under combined thoracoscope and laparoscope.


Assuntos
Dexmedetomidina/uso terapêutico , Neoplasias Esofágicas/cirurgia , Dor Pós-Operatória/tratamento farmacológico , Método Duplo-Cego , Humanos , Laparoscópios , Estudos Prospectivos , Toracoscópios
12.
Zhonghua Wai Ke Za Zhi ; 56(10): 772-775, 2018 Oct 01.
Artigo em Chinês | MEDLINE | ID: mdl-30369160

RESUMO

Objective: To evaluate the effectiveness and safety of intelligent pressure control flexible ureteroscope for management of renal stones ≤2 cm. Methods: The clinical data of 267 cases of renal calculi treated with flexible ureteroscope lithotripsy at Department of Urology, Ganzhou People's Hospital from June 2015 to December 2017 were analyzed retrospectively. There were 129 male and 138 female patients, with a mean age of 51.2 years (ranging from 19 to 76 years). Among them, 145 patients underwent intelligent pressure control flexible ureteroscope (intelligent control group) and 122 patients underwent flexible ureteroscope ordinary (ordinary group). The t test, χ2 test or Fisher exact test were used for statistical analysis. The success rate of stone seeking, the stone free rates, the incidence of complications, the average operation time, the average hospital stay after operation were compared between the two groups. Results: The average mean operative time of the patients with intelligent control group was (26.17 ± 8.64) minutes, significantly shorter than (47.23±18.35) minutes of the ordinary group (t=1.968, P=0.000). The stone free rate of the patients with intelligent control group was 97.2%, it was higher than 86.0% of ordinary group (χ2=0.069, P=0.004). The complication rate of the patients with intelligent control group was 2.7%, which was significantly shorter than 18.0% of the ordinary group (χ2=17.586, P=0.000). However, there was no significant difference between the two groups in the success rate of stone seeking and postoperative hospital stay (P>0.05). Conclusion: Intelligent controlled pressure ureteral flexible ureteroscope has the advantages of short operation time, high stone free rate and less complications in the treatment of renal calculi ≤2 cm compared with flexible ureteroscope ordinary.


Assuntos
Cálculos Renais , Litotripsia , Ureteroscopia , Adulto , Idoso , Feminino , Humanos , Cálculos Renais/diagnóstico , Cálculos Renais/terapia , Litotripsia/métodos , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Resultado do Tratamento , Ureteroscópios , Ureteroscopia/métodos , Adulto Jovem
13.
Fa Yi Xue Za Zhi ; 33(1): 6-10, 2017 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-29231000

RESUMO

OBJECTIVES: To investigate the time-dependent expression of metallothionein (MT) 1A mRNA and MT2A mRNA in contused skeletal muscle of rats. METHODS: A total of 54 Sprague-Dawley rats were used in this study. The rats were divided into two parts: control group (n=6) and contusion groups (0.5, 1, 6, 12, 18, 24, 30, and 36 h after contusion, n=6). Total RNA was extracted from skeletal muscle. The expression levels of MT1A mRNA and MT2A mRNA were detected by SYBR Green I real-time PCR. RESULTS: The expression trends of the two potential marker genes were related to wound age. In addition to 0.5 h, there were significant contrasts between the control group and contused group (P<0.05), about the expression levels of MT1A mRNA and MT2A mRNA in different phases. As the extension of wound age, the relative expression of MT1A mRNA and MT2A mRNA at 1 h, 6 h, 12 h and 18 h after contusion demonstrated upgrade tendency until its expression levels in 18 h peak with 239.41±15.20 and 717.42±50.76, respectively. When time extends to 24 h after injury, the expression of above two marks decreased, respectively. The MT1A mRNA and MT2A mRNA expression levels increased at 30 h and then decreased. CONCLUSIONS: Determination of MT1A mRNA and MT2A mRNA levels by real-time PCR may be useful for the estimation of wound age.


Assuntos
Contusões/genética , Contusões/metabolismo , Músculo Esquelético/metabolismo , RNA Mensageiro/metabolismo , Animais , Contusões/patologia , Regulação da Expressão Gênica , Marcadores Genéticos , Metalotioneína , Músculo Esquelético/lesões , Ratos , Ratos Sprague-Dawley , Reação em Cadeia da Polimerase em Tempo Real , Fatores de Tempo , Cicatrização
14.
Zhonghua Nei Ke Za Zhi ; 56(11): 833-838, 2017 Nov 01.
Artigo em Chinês | MEDLINE | ID: mdl-29136713

RESUMO

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 µmol/L and females with serum uric acid> 359.6 µmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.


Assuntos
Membro 2 da Subfamília G de Transportadores de Cassetes de Ligação de ATP/genética , Trifosfato de Adenosina/sangue , Povo Asiático/genética , Hiperuricemia/genética , Polimorfismo de Nucleotídeo Único , Ácido Úrico/sangue , Adulto , Idoso , Idoso de 80 Anos ou mais , Estudos de Casos e Controles , Estudos de Coortes , Feminino , Frequência do Gene , Predisposição Genética para Doença , Humanos , Hiperuricemia/etnologia , Masculino , Proteínas de Neoplasias , Transportadores de Ânions Orgânicos , Fatores de Risco , Centros de Atenção Terciária
15.
J Thromb Haemost ; 15(11): 2259-2269, 2017 11.
Artigo em Inglês | MEDLINE | ID: mdl-28834165

RESUMO

Essentials Positive family histories suggest the existence of hereditary immune thrombocytopenia (ITP). The predisposing gene for familial ITP was screened in two familial ITP patients. The G76S mutation on TNFRSF13B led to immune dysfunction and induced megakaryocyte apoptosis. The G76S mutation on TNFRSF13B is a gain-of-function mutation and a predisposing variant for ITP. SUMMARY: Background Most immune thrombocytopenia (ITP) is sporadic but a positive family history of ITP in some patients suggests that hereditary forms exist. Because of the rarity of familial ITP families available for study and the heterogeneity of sporadic ITP, family linkage analysis or genome-wide association studies are limited. Objectives Based on one ITP pedigree, we try to identify the predisposing gene in familial or sporadic ITP and reveal the way in which it causes thrombocytopenia. Methods Gene expression profiling analysis and whole-exome sequencing were performed on samples from family members with ITP, sporadic ITP cases and healthy individuals. We also evaluated the influence of potential pathogenic mutation on immune function and megakaryocyte apoptosis. Results Whole-exome sequencing identified a potential pathologic p.G76S heterozygous mutation on the TNFRSF13B gene in familial ITP patients. ITP patients harboring the G76S mutation displayed an upregulated 'cytokine-cytokine receptor interaction' signal, increased serum TNFα, IL-17α, IFNγ and BAFF levels, and enhanced binding capacity of APRIL ligand to B cells. Additionally, Epstein-Barr virus (EBV)-transformed B cells with the G76S mutation could induce human megakaryocyte line (Meg-01) apoptosis significantly. Conclusion p.G76S mutation on the TNFRSF13B gene is responsible for ITP, and is a genetic predisposing factor for familial or sporadic ITP.


Assuntos
Mutação com Ganho de Função , Púrpura Trombocitopênica Idiopática/genética , Proteína Transmembrana Ativadora e Interagente do CAML/genética , Adolescente , Adulto , Apoptose , Linfócitos B/imunologia , Linfócitos B/metabolismo , Estudos de Casos e Controles , Linhagem Celular , Pré-Escolar , Citocinas/sangue , Análise Mutacional de DNA , Feminino , Perfilação da Expressão Gênica , Predisposição Genética para Doença , Hereditariedade , Heterozigoto , Humanos , Megacariócitos/metabolismo , Megacariócitos/patologia , Linhagem , Fenótipo , Púrpura Trombocitopênica Idiopática/sangue , Púrpura Trombocitopênica Idiopática/diagnóstico , Púrpura Trombocitopênica Idiopática/imunologia , Membro 13 da Superfamília de Ligantes de Fatores de Necrose Tumoral/metabolismo , Sequenciamento do Exoma , Adulto Jovem
16.
Zhonghua Yi Xue Za Zhi ; 97(19): 1457-1462, 2017 May 23.
Artigo em Chinês | MEDLINE | ID: mdl-28535635

RESUMO

Objective: To assess the efficacy and safety of CT-guided iodine-125 seeds in the treatment of intracranial malignancies under control of target and dose. Methods: From November 2003 to May 2016, with the clinical data of 412 operations on 310 patients in 12 hospitals in the past 14 years, this study analyzed the method of CT guided iodine-125 particles brachytherapy in the treatment of intracranial malignant tumors and evaluated the efficacy and complications. Stratification analysis of intracranial malignant tumors was performed. Results: Overall survival (OS) of patients with single brain metastases, low-grade glioma, high-grade gliomas, recurrence after surgery, recurrence after radiotherapy and others were 19, 67, 41, 26, 23, 46 months respectively.And the progression free time (PFS) of patients with single brain metastases, low-grade glioma, high-grade gliomas, recurrence after surgery, recurrence after radiotherapy and others were 19, 42, 6, 9, 11, 12 months respectively.Various complications were observed with a relatively low incidence of 10.4%.Three cases deceased at an interval of 7-45 days after treatment. Conclusions: For patients with intracranial malignancies, iodine-125 seeds brachytherapy could achieve a satisfactory treatment efficacy with tolerated complications.Iodine-125 seeds brachytherapy may act as a first-line regimen.


Assuntos
Braquiterapia , Neoplasias Encefálicas/radioterapia , Glioma/radioterapia , Humanos , Radioisótopos do Iodo , Recidiva Local de Neoplasia , Tomografia Computadorizada por Raios X
19.
Genet Mol Res ; 15(2)2016 Jul 14.
Artigo em Inglês | MEDLINE | ID: mdl-27421013

RESUMO

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules of about 22 nucleotides in length. miRNAs are highly conserved in both plants and animals, and function as gene regulators by binding to the 3'-untranslated region of target mRNAs for cleavage and/or translational repression. miRNA biogenesis, stability, and regulation of expression are strongly sequence dependent. Sequence variants, such as single nucleotide polymorphisms (SNPs) in pri-miRNA, pre-miRNA, promoter regions, or miRNA-target sites, can influence miRNA function, thereby contributing to the pathological features of human disease. In this review, we focus on miRNA-related SNPs in gastric cancer and comprehensively analyze some commonly studied SNPs.


Assuntos
MicroRNAs/genética , Neoplasias Gástricas/genética , Regulação da Expressão Gênica , Predisposição Genética para Doença , Humanos , Polimorfismo de Nucleotídeo Único , RNA Mensageiro/genética
20.
Neoplasma ; 63(1): 114-20, 2016.
Artigo em Inglês | MEDLINE | ID: mdl-26639241

RESUMO

Copy number alteration (CNA) of chromosome 16, a frequent genetic event in tumors including hepatocellular carcinoma (HCC), has been associated with HCC etiology of hepatitis B virus (HBV) and with clinical outcomes in multiple types of cancer. This study identified CNAs in chromosome 16 in relation to intrahepatic recurrence of HCC in a population with high HBV prevalence, and further screened for differentially expressed genes in recurrence-related CNAs. Array comparative genomic hybridization and expression arrays were used to detect CNAs and gene expression differences, respectively. The associations between CNAs and intrahepatic recurrence were analyzed on 66 patients, follow-up period of 3-73 months. One hundred and nine cases were further evaluated regarding the differentially expressed genes. Losses at 16q and 16p were detected in 62.1% and 51.5% of the 66 cases, respectively. The most recurrent CNAs (with frequency >20%) were losses at 16p13.3-13.2, 16p13.11, 16q11.2-22.1, 16q22.1, 16q22.2-24.2 and 16q24.2. Of the CNAs, 16q22.1 loss was significantly associated with unfavorable intrahepatic recurrence-free survival (P = 0.025). Multivariate Cox analysis identified 16q22.1 loss as an independent risk factor for intrahepatic recurrence (HR = 2.32, 95% CI = 1.26-4.27). A panel of 21 genes, including TRADD, PSMB10, THAP11, CTCF and ESRP2, were significantly downregulated in HCCs with 16q22.1 loss compared to those without the loss. These results suggest that loss at 16q22.1 was associated with increased risk for intrahepatic recurrence of HCC, at least in the HBV-prevalence population. Multiple downregulated genes correlated with the loss were screened.


Assuntos
Carcinoma Hepatocelular/genética , Genes Neoplásicos/genética , Neoplasias Hepáticas/genética , Carcinoma Hepatocelular/complicações , Carcinoma Hepatocelular/patologia , Cromossomos Humanos Par 16/genética , Hibridização Genômica Comparativa , Variações do Número de Cópias de DNA , Regulação para Baixo , Regulação Neoplásica da Expressão Gênica , Hepatite B/complicações , Humanos , Neoplasias Hepáticas/complicações , Neoplasias Hepáticas/patologia , Recidiva Local de Neoplasia , Fatores de Risco , Análise de Sobrevida
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA