RESUMO
A covalent organic framework (COF) was gown on porous silica with 1,3,5-tri(4-aminophenyl)benzene and 2,5-divinyl-1,4-phenyldiformaldehyde as monomers, and two ionic liquids were grafted to COF by a click reaction. The materials before and after the modification of ionic liquids were separately packed into solid-phase extraction columns (10 × 4.6 mm, i.d.), which were coupled with liquid chromatography to construct online analysis systems. The extraction mechanisms of polycyclic aromatic hydrocarbons, bisphenols, diphenylalkanes and benzoic acids were investigated on these materials. There were π-π, hydrogen-bond and electrostatic interactions on ionic liquid-functionalized sorbents. After the comparison among these materials, the best sorbent was used, and the analytical method was established and successfully applied to the detection of some estrogens from actual samples. For the analytical method, the detection limit was as low as 0.005 µg L-1, linear range was as wide as 0.017-10.0 µg L-1, and enrichment ratio was as high as 3635. The recoveries in actual samples were 70 %-129 %.
RESUMO
OBJECTIVE: To evaluate associations of wildfire fine particulate matter (PM2.5) with diabetes across multiple countries and territories. RESEARCH DESIGN AND METHODS: We collected data on 3,612,135 diabetes hospitalizations from 1,008 locations in Australia, Brazil, Canada, Chile, New Zealand, Thailand, and Taiwan during 2000-2019. Daily wildfire-specific PM2.5 levels were estimated through chemical transport models and machine-learning calibration. Quasi-Poisson regression with distributed lag nonlinear models and random-effects meta-analysis were applied to estimate associations between wildfire-specific PM2.5 and diabetes hospitalization. Subgroup analyses were by age, sex, location income level, and country or territory. Diabetes hospitalizations attributable to wildfire-specific PM2.5 and nonwildfire PM2.5 were compared. RESULTS: Each 10 µg/m3 increase in wildfire-specific PM2.5 levels over the current day and previous 3 days was associated with relative risks (95% CI) of 1.017 (1.011-1.022), 1.023 (1.011-1.035), 1.023 (1.015-1.032), 0.962 (0.823-1.032), 1.033 (1.001-1.066), and 1.013 (1.004-1.022) for all-cause, type 1, type 2, malnutrition-related, other specified, and unspecified diabetes hospitalization, respectively. Stronger associations were observed for all-cause, type 1, and type 2 diabetes in Thailand, Australia, and Brazil; unspecified diabetes in New Zealand; and type 2 diabetes in high-income locations. Relative risks (95% CI) of 0.67% (0.16-1.18%) and 1.02% (0.20-1.81%) for all cause and type 2 diabetes hospitalizations were attributable to wildfire-specific PM2.5. Compared with nonwildfire PM2.5, wildfire-specific PM2.5 posed greater risks of all-cause, type 1, and type 2 diabetes and were responsible for 38.7% of PM2.5-related diabetes hospitalizations. CONCLUSIONS: We show the relatively underappreciated links between diabetes and wildfire air pollution, which can lead to a nonnegligible proportion of PM2.5-related diabetes hospitalizations. Precision prevention and mitigation should be developed for those in advantaged communities and in Thailand, Australia, and Brazil.
RESUMO
Nowadays, solar-driven interfacial steam generation (SISG) is a sustainable and green technology for mitigating the water shortage crisis. Nevertheless, SISG is suffering from the enrichment of volatile organic compounds in condensate water and non-volatile organic compounds in feed water in practical applications. Herein, taking inspiration from nature, a dual-functional bifacial-CuCoNi (Bi-CuCoNi) evaporator with a special biomimetic urchin-like microstructure was successfully prepared. The unique design with 2.5-Dimensional bifacial working sides and urchin-like light absorption microstructure provided the Bi-CuCoNi evaporator with remarkable evaporation performance (1.91 kg m-2 h-1 under 1 kW m-2). Significantly, due to the urchin-like microstructure, the adequately exposed catalytic active sites enabled the Bi-CuCoNi/peroxydisulfate (PDS) system to degrade non-volatile organic pollutants (removal rate of 99.3 % in feed water, close to 100 % in condensate water) and the volatile organic pollutants (removal rate of 99.1 % in feed water, 98.2 % in condensate water) simultaneously. Moreover, the Bi-CuCoNi evaporator achieved non-radical pathway degradation at whole-stages. The dual-functional evaporator successfully integrated advanced oxidation processes (AOPs) into SISG, providing a new idea for high-quality freshwater production from polluted wastewater. ENVIRONMENTAL IMPLICATION: Inspired by nature, a dual-functional bifacial CuCoNi evaporator with a special biomimetic urchin-like microstructure formed by CuCoNi oxide nanowires grown on nickel foam by the hydrothermal synthesis method was successfully prepared. The prepared Bi-CuCoNi evaporator can effectively degrade organic pollutants in feed water and condensate water simultaneously during SISG, thus generating high-quality fresh water. Meanwhile, the health risks associated with the accumulation of organic pollutants in water during traditional SISG were reduced via green and sustainable way. The spatial 2.5-Dimensional structural design of Bi-CuCoNi provided new insights for achieving efficient water evaporation and fresh water generation from various polluted wastewater.
RESUMO
Comprehensive m6A epitranscriptome profiling of primary tumors remains largely uncharted. Here, we profiled the m6A epitranscriptome of 10 non-neoplastic lung (NL) tissues and 51 lung adenocarcinoma (LUAD) tumors, integrating the corresponding transcriptome, proteome and extensive clinical annotations. We identified distinct clusters and genes that were exclusively linked to disease progression through m6A modifications. In comparison with NL tissues, we identified 430 transcripts to be hypo-methylated and 222 to be hyper-methylated in tumors. Among these genes, EML4 emerged as a novel metastatic driver, displaying significant hyper-methylation in tumors. m6A modification promoted the translation of EML4, leading to its widespread overexpression in primary tumors. Functionally, EML4 modulated cytoskeleton dynamics through interacting with ARPC1A, enhancing lamellipodia formation, cellular motility, local invasion, and metastasis. Clinically, high EML4 protein abundance correlated with features of metastasis. METTL3 small molecule inhibitor markedly diminished both EML4 m6A and protein abundance, and efficiently suppressed lung metastases in vivo.
RESUMO
Developing highly sensitive and specific on-site tests is imperative to strengthen preparedness against future emerging infectious diseases. Here, we describe the construction of a Cas12a-mediated DNAzyme actuator capable of converting the recognition of a specific DNA sequence into an amplified colorimetric signal. To address viral RNA extraction challenges for on-site applications, we developed a rapid and efficient method capable of lysing the viral particles, preserving the released viral RNA, and concentrating the viral RNA. Integration of the DNAzyme actuator with the viral RNA extraction method and loop-mediated isothermal amplification enables a streamlined colorimetric assay for highly sensitive colorimetric detection of respiratory RNA viruses in gargle and saliva. This assay can detect as few as 83 viral particles/100 µL in gargle and 166 viral particles/100 µL in saliva. The entire assay, from sample processing to visual detection, was completed within 1 h at a single controlled temperature. We validated the assay by detecting SARS-CoV-2 in 207 gargle and saliva samples, achieving a clinical sensitivity of 96.3 % and specificity of 100%. The assay is adaptable for detecting specific nucleic acid sequences in other pathogens and is suitable for resource-limited settings.
Assuntos
Técnicas Biossensoriais , Colorimetria , DNA Catalítico , Técnicas de Amplificação de Ácido Nucleico , RNA Viral , SARS-CoV-2 , Saliva , Colorimetria/métodos , RNA Viral/isolamento & purificação , RNA Viral/genética , SARS-CoV-2/isolamento & purificação , SARS-CoV-2/genética , DNA Catalítico/química , Técnicas Biossensoriais/métodos , Saliva/virologia , Saliva/química , Humanos , Técnicas de Amplificação de Ácido Nucleico/métodos , COVID-19/virologia , COVID-19/diagnóstico , Proteínas Associadas a CRISPR/isolamento & purificação , Proteínas Associadas a CRISPR/química , Endodesoxirribonucleases/química , Limite de Detecção , Fezes/virologia , Fezes/química , Proteínas de Bactérias , Técnicas de Diagnóstico MolecularRESUMO
Acidic H2O2 synthesis through electrocatalytic 2e- oxygen reduction presents a sustainable alternative to the energy-intensive anthraquinone oxidation technology. Nevertheless, acidic H2O2 electrosynthesis suffers from low H2O2 Faradaic efficiencies primarily due to the competing reactions of 4e- oxygen reduction to H2O and hydrogen evolution in environments with high H+ concentrations. Here, we demonstrate the significant effect of alkali metal cations, acting as competing ions with H+, in promoting acidic H2O2 electrosynthesis at industrial-level currents, resulting in an effective current densities of 50-421â mA cm-2 with 84-100 % Faradaic efficiency and a production rate of 856-7842â µmol cm-2 h-1 that far exceeds the performance observed in pure acidic electrolytes or low-current electrolysis. Finite-element simulations indicate that high interfacial pH near the electrode surface formed at high currents is crucial for activating the promotional effect of K+. In situ attenuated total reflection Fourier transform infrared spectroscopy and ab initio molecular dynamics simulations reveal the central role of alkali metal cations in stabilizing the key *OOH intermediate to suppress 4e- oxygen reduction through interacting with coordinated H2O.
RESUMO
Although some studies have found that short-term PM2.5 exposure is associated with lung cancer deaths, its impact on other cancer sites is unclear. To answer this research question, this time-stratified case-crossover study used individual cancer death data between January 1, 2000, and December 31, 2019, extracted from the Brazilian mortality information system to quantify the associations between short-term PM2.5 exposure and cancer mortality from 25 common cancer sites. Daily PM2.5 concentration was aggregated at the municipality level as the key exposure. The study included a total of 34,516,120 individual death records, with the national daily mean PM2.5 exposure 15.3 (SD 4.3) µg/m3. For every 10-µg/m3 increase in three-day average PM2.5 exposure, the odds ratio (OR) for all-cancer mortality was 1.04 (95% CI 1.03-1.04). Apart from all-cancer deaths, PM2.5 exposure may impact cancers of oesophagus (1.04, 1.00-1.08), stomach (1.05, 1.02-1.08), colon-rectum (1.04, 1.01-1.06), lung (1.04, 1.02-1.06), breast (1.03, 1.00-1.06), prostate (1.07, 1.04-1.10), and leukaemia (1.05, 1.01-1.09). During the study period, acute PM2.5 exposure contributed to an estimated 1,917,994 cancer deaths, ranging from 0 to 6,054 cases in each municipality. Though there has been a consistent downward trend in PM2.5-related all-cancer mortality risks from 2000 to 2019, the impact remains significant, indicating the continued importance of cancer patients avoiding PM2.5 exposure. This nationwide study revealed a notable association between acute PM2.5 exposure and heightened overall and site-specific cancer mortality for the first time to our best knowledge. The findings suggest the importance of considering strategies to minimize such exposure in cancer care guidelines. ENVIRONMENTAL IMPLICATION: The 20-year analysis of nationwide death records in Brazil revealed that heightened short-term exposure to PM2.5 is associated with increased cancer mortality at various sites, although this association has gradually decreased over time. Despite the declining impact, the research highlights the persistent adverse effects of PM2.5 on cancer mortality, emphasizing the importance of continued research and preventive measures to address the ongoing public health challenges posed by air pollution.
Assuntos
Poluentes Atmosféricos , Exposição Ambiental , Neoplasias , Material Particulado , Humanos , Material Particulado/toxicidade , Material Particulado/análise , Brasil/epidemiologia , Neoplasias/mortalidade , Exposição Ambiental/efeitos adversos , Poluentes Atmosféricos/toxicidade , Poluentes Atmosféricos/análise , Poluentes Atmosféricos/efeitos adversos , Masculino , Feminino , Estudos Cross-Over , Pessoa de Meia-Idade , Idoso , AdultoRESUMO
BACKGROUND: Under a changing climate, the joint effects of temperature and relative humidity on tuberculosis (TB) are poorly understood. To address this research gap, we conducted a time-series study to explore the joint effects of temperature and relative humidity on TB incidence in China, considering potential modifiers. METHODS: Weekly data on TB cases and meteorological factors in 22 cities across mainland China between 2011 and 2020 were collected. The proxy indicator for the combined exposure levels of temperature and relative humidity, Humidex, was calculated. First, a quasi-Poisson regression with the distributed lag non-linear model (DLNM) was constructed to examine the city-specific associations between humidex and TB incidence. Second, a multivariate meta-regression model was used to pool the city-specific effect estimates, and to explore the potential effect modifiers. RESULTS: A total of 849,676 TB cases occurred in the 22 cities between 2011 and 2020. Overall, a conspicuous J-shaped relationship between humidex and TB incidence was discerned. Specifically, a decrease in humidex was positively correlated with an increased risk of TB incidence, with a maximum relative risk (RR) of 1.40 (95% CI: 1.11-1.76). The elevated RR of TB incidence associated with low humidex (5th humidex) appeared on week 3 and could persist until week 13, with a peak at approximately week 5 (RR: 1.03, 95% CI: 1.01-1.05). The effects of low humidex on TB incidence vary by Natural Growth Rate (NGR) levels. CONCLUSION: A J-shaped exposure-response association existed between humidex and TB incidence in China. Humidex may act as a better predictor to forecast TB incidence compared to temperature and relative humidity alone, especially in regions with higher NGRs.
Assuntos
Umidade , Tuberculose , China/epidemiologia , Humanos , Tuberculose/epidemiologia , Incidência , Temperatura , Cidades/epidemiologia , Mudança ClimáticaRESUMO
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMO
The electro-Fenton with in situ generated 1O2 and â¢OH is a promising method for the degradation of micropollutants. However, its application is hindered by the lack of catalysts that can efficiently generate 1O2 and â¢OH from electrochemical oxygen reduction. Herein, N-doped stacked carbon nanosheets supported Fe single atoms (Fe-NSC) with FeN4 sites were designed for simultaneous generation of 1O2 and â¢OH to enhance electro-Fenton degradation. Due to the synergistic effect of 1O2 and â¢OH, a variety of contaminants (phenol, 2,4-dichlorophenol, sulfamethoxazole, atrazine and bisphenol A) were efficiently degraded with high kinetic constants of 0.037-0.071 min-1 by the electro-Fenton with Fe-NSC as cathode (-0.6 V vs Ag/AgCl, pH 6). Moreover, the superior performance for electro-Fenton degradation was well maintained in a wide pH range from 3 to 10 even with interference of various inorganic salt ions. It was found that FeN4 sites with pyridinic N coordination were responsible for its good performance for electro-Fenton degradation. Its 1O2 yield was higher than â¢OH yield, and the contribution of 1O2 was more significant than â¢OH for pollutant degradation.
RESUMO
Infection with severe acute respiratory syndrome coronavirus 2 Omicron variants still causes neurological complications in elderly individuals. However, whether and how aging brains are affected by Omicron variants in terms of neuroinvasiveness and neurovirulence are unknown. Here, we utilize resected paracarcinoma brain tissue from elderly individuals to generate primary brain spheroids (BSs) for investigating the replication capability of live wild-type (WT) strain and Omicron (BA.1/BA.2), as well as the mechanisms underlying their neurobiological effects. We find that both WT and Omicron BA.1/BA.2 are able to enter BSs but weakly replicate. There is no difference between Omicron BA.1/BA.2 and WT strains in neurotropism in aging BSs. However, Omicron BA.1/BA.2 exhibits ameliorating neurological damage. Transcriptional profiling indicates that Omicron BA.1/BA.2 induces a lower neuroinflammatory response than WT strain in elderly BSs, suggesting a mechanistic explanation for their attenuated neuropathogenicity. Moreover, we find that both Omicron BA.1/BA.2 and WT strain infections disrupt neural network activity associated with neurodegenerative disorders by causing neuron degeneration and amyloid-ß deposition in elderly BSs. These results uncover Omicron-specific mechanisms and cellular immune responses associated with severe acute respiratory syndrome coronavirus 2-induced neurological complications.
RESUMO
A highly efficient ratiometric electrochemiluminescence (ECL) immunoassay was explored by bidirectionally regulating the ECL intensity of two luminophors. The immunoassay was conducted in a split-type mode consisting of an ECL detection procedure and a sandwich immunoreaction. The ECL detection was executed using a dual-disk glassy carbon electrode modified with two potential-resolved luminophors (g-C3N4-Ag and Ru-MOF-Ag nanocomposites), and the sandwich immunoreaction using glucose oxidase (GOx)-modified SiO2 nanospheres as labels was carried out in a 96-well plate. The Ag nanoparticles (NPs) acted as bifunctional units both for triggering the resonance energy transfer (RET) with g-C3N4 and for accelerating the electron transfer rate of the Ru-MOF-Ag ECL reaction. When the H2O2 catalyzed by GOx in the 96-well plate was transferred to the dual-disk glass carbon electrode, the doped Ag NPs in the two luminophors could be etched, thus destroying the RET between C3N4 and the accelerated reaction to Ru-MOF, resulting in an opposite trend in the ECL signal outputted from the dual disks. Using the ratio of the two signals for quantification, the constructed immunosensor for a model target, i.e. myoglobin, exhibited a low detection limit of 4.7 × 10-14 g/mL. The ingenious combination of ECL ratiometry, bifunctional Ag NPs, and a split-type strategy effectively reduces environmental and human errors, offering a more precise and sensitive analysis for complex samples.
Assuntos
Técnicas Eletroquímicas , Glucose Oxidase , Limite de Detecção , Medições Luminescentes , Nanopartículas Metálicas , Prata , Prata/química , Imunoensaio/métodos , Nanopartículas Metálicas/química , Técnicas Eletroquímicas/métodos , Medições Luminescentes/métodos , Glucose Oxidase/química , Glucose Oxidase/metabolismo , Técnicas Biossensoriais/métodos , Mioglobina/análise , Dióxido de Silício/químicaRESUMO
PURPOSE: To identify subgroups of patients with early-stage (pT1-2N0M0) oral tongue squamous cell carcinoma (OTSCC) who may benefit from postoperative radiotherapy (PORT). PATIENTS AND METHODS: This retrospective cohort study included 528 patients diagnosed between October 2009 and December 2021. Clinicopathological characteristics and treatments with or without PORT were analyzed for their impact on outcomes. RESULTS: Among 528 patients who underwent radical surgery (median age, 62 years [IQR, 52-69]), 145 (27.5%) also underwent PORT. Multivariate analyses revealed that PORT was associated with improved survival outcomes, whereas moderate-to-poor differentiation, perineural infiltration (PNI), lymphovascular invasion (LVI), and increasing depth of invasion (DOI) were associated with poorer survival outcomes. For patients with moderate-to-poor differentiation, the surgery + PORT group showed improved outcomes compared with the surgery-alone group. After propensity score matching, the results were as follows: overall survival (OS), 97% versus 69%, P = .003; disease-free survival (DFS), 88% versus 50%, P = .001. After excluding cases with PNI/LVI, the differences persisted: OS, 97% versus 82%, P = .040; DFS, 87% versus 64%, P = .012. Similar survival benefits were observed in 104 patients with PNI and/or LVI (OS, 81% v 58%; P = .022; DFS, 76% v 47%; P = .002). In subgroups with DOI >5 mm or close margins, PORT contributed to improved DFS (80% v 64%; P = .006; 92% v 66%; P = .049) but did not significantly affect OS. CONCLUSION: Patients with moderately-to-poorly differentiated pT1-2N0M0 OTSCC benefited from PORT. Our study provided evidence that patients with PNI and/or LVI who underwent PORT had improved survival. PORT also offered DFS benefit among patients with DOI >5 mm.
Assuntos
Estadiamento de Neoplasias , Neoplasias da Língua , Humanos , Pessoa de Meia-Idade , Masculino , Feminino , Neoplasias da Língua/patologia , Neoplasias da Língua/radioterapia , Neoplasias da Língua/cirurgia , Neoplasias da Língua/mortalidade , Idoso , Estudos Retrospectivos , Prognóstico , Radioterapia Adjuvante , Carcinoma de Células Escamosas de Cabeça e Pescoço/cirurgia , Carcinoma de Células Escamosas de Cabeça e Pescoço/patologia , Carcinoma de Células Escamosas de Cabeça e Pescoço/mortalidade , Carcinoma de Células Escamosas de Cabeça e Pescoço/radioterapia , Carcinoma de Células Escamosas/cirurgia , Carcinoma de Células Escamosas/patologia , Carcinoma de Células Escamosas/mortalidade , Carcinoma de Células Escamosas/radioterapiaRESUMO
Electrochemical reduction of CO2 to value-added products provides a feasible pathway for mitigating net carbon emissions and storing renewable energy. However, the low dimerization efficiency of the absorbed CO intermediate (*CO) and the competitive hydrogen evolution reaction hinder the selective electroreduction of CO2 to ethane (C2H6) with a high energy density. Here, we designed hydrophobic iodide-derived copper electrodes (I-Cu/Nafion) for reducing CO2 to C2H6. The Faradaic efficiency of C2H6 reached 23.37% at -0.7 V vs RHE over the I-Cu/Nafion electrode in an H-type cell, which was about 1.7 times higher than that of the I-Cu electrode. The hydrophobic properties of the I-Cu/Nafion electrodes led to an increase in the local CO2 concentration and stabilized the Cu+ species. In situ Raman characterizations and density functional theory calculations indicate that the enhanced performances could be ascribed to the strong *CO adsorption and decreased the formation energy of *COOH and *COCOH intermediates. This study highlights the effect of the hydrophobic surface on Cu-based catalysts in the electroreduction of CO2 and provides a promising way to adjust the selectivity of C2 products.
RESUMO
The moisture with salt ions adsorbed on the mineral soil surface is crucial to the cohesion process when the media is exposed to marine or coastal environments. However, the impact of salinity on the cohesion of soils is not well studied at the nanoscale. In this study, the salinity effect was investigated by studying the wettability and capillary force of NaCl solutions on quartz substrates via a molecular dynamics-based approach. Besides, a new visualization method was proposed to measure the contact angle of liquid droplets from the aspect of nanoscale. The results indicated that salt ions can weaken the wettability of the liquid on the quartz surface and inhibit the capillary force. Compared with water, the liquid with a 10% NaCl solution can achieve a capillary force reduction of around 70%, resulting in a detrimental effect on the cohesion of soils. Overall, this study enhanced the understanding of the nanoscale salinity effect on the cohesion process and provided insights into the modification of the mechanical properties of soils from the aspect of nanoscale.
RESUMO
As one of the interesting signaling mechanisms, the in situ growth reaction on a photoelectrode has proven its powerful potential in photoelectrochemical (PEC) bioanalysis. However, the specific interaction between the signaling species with the photoactive materials limits the general application of the signal mechanism. Herein, on the basis of an in situ growth reaction on a photoelectrode of single-atom-based photoactive material, a general PEC immunoassay was developed in a split-type mode consisting of the immunoreaction and PEC detection procedure. Specifically, a single-atom photoactive material that incorporates Fe atoms into layered Bi4O5I2 (Bi4O5I2-Fe SAs) was used as a photoelectrode for PEC detection. The sandwich immunoreaction was performed in a well of a 96-well plate using Ag nanoparticles (Ag NPs) as signal tracers. In the PEC detection procedure, the Ag+ converted from Ag NPs were transferred onto the surface of the Bi4O5I2-Fe SAs photoelectrode and thereafter AgI was generated on the Bi4O5I2-Fe SAs in situ to form a heterojunction through the reaction of Ag+ with Bi4O5I2-Fe SAs. The formation of heterojunction greatly promoted the electro-hole separation, boosting the photocurrent response. Exemplified by myoglobin (Myo) as the analyte, the immunosensor achieved a wide linear range from 1.0 × 10-11 to 5.0 × 10-8 g mL-1 with a detection limit of 3.5 × 10-12 g mL-1. This strategy provides a general PEC immunoassay for disease-related proteins, as well as extends the application scope of in situ growth reaction in PEC analysis.
Assuntos
Técnicas Biossensoriais , Nanopartículas Metálicas , Técnicas Biossensoriais/métodos , Imunoensaio/métodos , Prata , Mioglobina , Técnicas Eletroquímicas/métodos , Limite de DetecçãoRESUMO
Parkinson's disease (PD) is a highly prevalent and severe neurodegenerative disease that affects more than 10 million individuals worldwide. Pathogenic mutations in LRP10 have been associated with autosomal dominant PD. Here, we report an induced pluripotent stem cell (iPSC) line generated from a PD patient harboring the LRP10 c.688C > T (p.Arg230Trp) variant. Skin fibroblasts from the PD patient were successfully reprogrammed into iPSCs that expressed pluripotency markers, a normal karyotype, and the capacity to differentiate into the three germ layers in vivo. This iPSC line is a potential resource for studying the pathogenic mechanisms of PD.
Assuntos
Células-Tronco Pluripotentes Induzidas , Mutação , Doença de Parkinson , Células-Tronco Pluripotentes Induzidas/metabolismo , Humanos , Doença de Parkinson/genética , Doença de Parkinson/patologia , Proteínas Relacionadas a Receptor de LDL/genética , Proteínas Relacionadas a Receptor de LDL/metabolismo , Linhagem Celular , Diferenciação Celular , MasculinoRESUMO
Although Alzheimer's disease (AD) characterized with senile plaques and neurofibrillary tangles has been found for over 100 years, its molecular mechanisms are ambiguous. More worsely, the developed medicines targeting amyloid-beta (Aß) and/or tau hyperphosphorylation did not approach the clinical expectations in patients with moderate or severe AD until now. This review unveils the role of a vicious cycle between Aß-derived formaldehyde (FA) and FA-induced Aß aggregation in the onset course of AD. Document evidence has shown that Aß can bind with alcohol dehydrogenase (ADH) to form the complex of Aß/ADH (ABAD) and result in the generation of reactive oxygen species (ROS) and aldehydes including malondialdehyde, hydroxynonenal and FA; in turn, ROS-derived H2O2 and FA promotes Aß self-aggregation; subsequently, this vicious cycle accelerates neuron death and AD occurrence. Especially, FA can directly induce neuron death by stimulating ROS generation and tau hyper hyperphosphorylation, and impair memory by inhibiting NMDA-receptor. Recently, some new therapeutical methods including inhibition of ABAD activity by small molecules/synthetic polypeptides, degradation of FA by phototherapy or FA scavengers, have been developed and achieved positive effects in AD transgenic models. Thus, breaking the vicious loop may be promising interventions for halting AD progression.
Assuntos
Doença de Alzheimer , Humanos , Doença de Alzheimer/tratamento farmacológico , Álcool Desidrogenase , Espécies Reativas de Oxigênio/metabolismo , Peróxido de Hidrogênio , Peptídeos beta-Amiloides/metabolismo , FormaldeídoRESUMO
The crossmodal interaction of different senses, which is an important basis for learning and memory in the human brain, is highly desired to be mimicked at the device level for developing neuromorphic crossmodal perception, but related researches are scarce. Here, we demonstrate an optoelectronic synapse for vision-olfactory crossmodal perception based on MXene/violet phosphorus (VP) van der Waals heterojunctions. Benefiting from the efficient separation and transport of photogenerated carriers facilitated by conductive MXene, the photoelectric responsivity of VP is dramatically enhanced by 7 orders of magnitude, reaching up to 7.7 A W-1. Excited by ultraviolet light, multiple synaptic functions, including excitatory postsynaptic currents, paired-pulse facilitation, short/long-term plasticity and "learning-experience" behavior, were demonstrated with a low power consumption. Furthermore, the proposed optoelectronic synapse exhibits distinct synaptic behaviors in different gas environments, enabling it to simulate the interaction of visual and olfactory information for crossmodal perception. This work demonstrates the great potential of VP in optoelectronics and provides a promising platform for applications such as virtual reality and neurorobotics.
RESUMO
Co-presence of enveloped and non-enveloped viruses is common both in community circulation and in wastewater. Community surveillance of infections requires robust methods enabling simultaneous quantification of multiple viruses in wastewater. Using enveloped SARS-CoV-2 Omicron subvariants and non-enveloped norovirus (NoV) as examples, this study reports a robust method that integrates electronegative membrane (EM) concentration, viral inactivation, and RNA preservation (VIP) with efficient capture and enrichment of the viral RNA on magnetic (Mag) beads, and direct detection of RNA on the beads. This method provided improved viral recoveries of 80 ± 4 % for SARS-CoV-2 and 72 ± 5 % for Murine NoV. Duplex reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays with newly designed degenerate primer-probe sets offered high PCR efficiencies (90-91 %) for NoV (GI and GII) targets and were able to detect as few as 15 copies of the viral RNA per PCR reaction. This technique, combined with duplex detection of NoV and multiplex detection of Omicron, successfully quantified NoV (GI and GII) and Omicron variants in the same sets of 94 influent wastewater samples collected from two large wastewater systems between July 2022 and June 2023. The wastewater viral RNA results showed temporal changes of both NoV and Omicron variants in the same wastewater systems and revealed an inverse relationship of their emergence. This study demonstrated the importance of a robust analytical platform for simultaneous surveillance of enveloped and non-enveloped viruses in wastewater. The ability to sensitively determine multiple viral pathogens in wastewater will advance applications of wastewater surveillance as a complementary public health tool.