Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 6 de 6
Filtrar
Mais filtros








Base de dados
Intervalo de ano de publicação
1.
Angew Chem Int Ed Engl ; 61(34): e202207300, 2022 Aug 22.
Artigo em Inglês | MEDLINE | ID: mdl-35761506

RESUMO

To enhance the fluorescence efficiency of semiconductor nanocrystal quantum dots (QDs), strategies via enhancing photo-absorption and eliminating non-radiative relaxation have been proposed. In this study, we demonstrate that fluorescence efficiency of molybdenum disulfide quantum dots (MoS2 QDs) can be enhanced by single-atom metal (Au, Ag, Pt, Cu) modification. Four-fold enhancement of the fluorescence emission of MoS2 QDs is observed with single-atom Au modification. The underlying mechanism is ascribed to the passivation of non-radiative surface states owing to the new defect energy level of Au in the forbidden band that can trap excess electrons in n-type MoS2 , increasing the recombination probability of conduction band electrons with valence band holes of MoS2 . Our results open an avenue for enhancing the fluorescence efficiency of QDs via the modification of atomically dispersed metals, and extend their scopes and potentials in a fundamental way for economic efficiency and stability of single-atom metals.

2.
Sci Total Environ ; 797: 149113, 2021 Nov 25.
Artigo em Inglês | MEDLINE | ID: mdl-34303976

RESUMO

Lead (Pb) as a hazardous air pollutant has raised widespread concerns due to its adverse and toxic effects on the ecological environment and human health. Here we integrated the multi-regional input-output (MRIO) model and an atmospheric transport model to examine regional environmental inequality (REI) index induced by Pb emission transfers, and to evaluate the impacts of interprovincial trade on regional atmospheric Pb concentrations and dry deposition fluxes in China in 2012. In 2012, approximately 57.4% ~ 72.6% of Pb emissions in well-developed eastern regions (Beijing-Tianjin, Yangtze River Delta (YRD)) and the southern seaboard of China were embodied in other regions in China subject to the demands from these well-developed regions to industrial products and services. Our results, based on the net virtual flows of Pb emission and value-added, indicate that most provinces in the eastern seaboard of China outsource Pb emission and benefit from the interprovincial trade by reducing their Pb emissions. REI indexes show that the well-developed Guangdong province outsources its Pb emission but has low economic gains. Many less-developed provinces in central China enhance virtual Pb emission inflow but have high economic gains. Whereas, inland provinces in western China not only experience Pb emission increase, but also suffer from indirect economic loss due to trade with well-developed provinces to meet their increasing demands to Pb emission abundant industrial products from these provinces in eastern China which are mostly provided by less-developed but energy and mineral product abundant provinces in western China. For example, the province pair with highest REI index was Jiangsu-Inner Mongolia (REI = 2.47), which revealed that Jiangsu was the largest beneficiary which exported 37.2 t of net Pb emission and gained value-added of 521.4 billion RMB through trade with Inner Mongolia which suffered from both virtual Pb inflow and economic loss in 2012. As a result of interprovincial trade, Pb dry deposition in central and eastern China was decreased but increased in western China. Overall, interprovincial trade reduced 17.6% of atmospheric Pb dry deposition in China.


Assuntos
Poluentes Atmosféricos , Chumbo , Poluentes Atmosféricos/análise , Pequim , China , Humanos , Rios
3.
Anal Chem ; 92(1): 1268-1275, 2020 01 07.
Artigo em Inglês | MEDLINE | ID: mdl-31789019

RESUMO

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.


Assuntos
Complexos de Coordenação/química , Técnicas Eletroquímicas , Irídio/química , Luminescência , MicroRNAs/análise , Complexos de Coordenação/síntese química , Cristalografia por Raios X , Teoria da Densidade Funcional , Modelos Moleculares , Estrutura Molecular
4.
Sci Bull (Beijing) ; 64(16): 1158-1166, 2019 Aug 30.
Artigo em Inglês | MEDLINE | ID: mdl-36659687

RESUMO

In an effort to provide visualization and understanding to the electronic "push effect" of axial ligands on the catalytic activity of cobalt macrocyclic molecules, we design a simple model system involving an [5,10,15,20-tetrakis(4-methoxyphenyl)porphyrin]cobalt(II) (TMMPCo) monolayer axially-coordinated on thiol ligand modified Au electrode and explore the activity of the axial-ligand coordinated TMPPCo toward oxygen reduction reaction (ORR) in acidic medium. Three different ligands, with a decreasing order of coordinating ability as: 4-mercaptopyridine (MPy) > 4-aminothiolphenol (APT) > 4-mercaptobenzonitrile (MBN) are used and a maximum difference in ORR onset potential of 80 mV is observed between the MPy (highest onset potential) and MBN systems (lowest onset potential). The ORR activity of TMPPCo increases with the increase in binding strength of the axial ligand. A detailed mechanism study reveals that ORR on the three ligand coordinated TMPPCo systems shares the same 2-electron mechanism with H2O2 as the terminal product. Theoretical calculation into the structure of the ligand coordinated cobalt porphyrins uncovers the variation in atomic charge of the Co(II) center and altered frontier molecular orbital distribution among the three ligand systems. Both properties have great influence on the back-bonding formation between the Co(II) center and O2 molecules, which has been suggested to be critical toward the O2 adsorption and subsequent activation process.

5.
Inorg Chem ; 51(13): 7066-74, 2012 Jul 02.
Artigo em Inglês | MEDLINE | ID: mdl-22708831

RESUMO

Three porous supramolecular isomers (IZE-1, IZE-2, and IZE-3) with the same framework component [Zn(2)(EBTC)(H(2)O)(2)] (EBTC = 1,1'-ethynebenzene-3,3',5,5'-tetracarboxylate) were successfully constructed by finely tuning the reaction condition. Although both IZE-1 and IZE-2 are constructed from the linear EBTC subunits and one kind of regular [Zn(2)(CO(2))(4)] paddlewheels, their frameworks exhibit two different (3,4)-c net of fof (sqc1575) and sqc1572, respectively, resulting in cavities with different size and shape. However, as for isomer IZE-3, the EBTC ligands are bent and one-half of the [Zn(2)(CO(2))(4)] paddlewheels are distorted, leading to a novel (3,4,4)-c hyx net with point symbol (6.7(2))(4)(6(2).8(2).10(2))(7(2).8(2).11(2)) and vertex symbol (6.7.7)(4)(7(2).7(2).8.8.12.12)(6.6.8.8.10(2).10(2)). Quantum chemical calculations by DFT indicate that the three isomers have very close thermodynamic stabilities, which may explain that subtle condition change leads to variation of the frameworks. Further theoretical semiempirical investigation on the interactions between solvent molecules and compounds shows different hydrogen binding patterns in good agreement with the experimental observations. Furthermore, they exhibit good solid-state luminescence properties with long lifetime.


Assuntos
Compostos Organometálicos/química , Zinco/química , Cristalografia por Raios X , Modelos Moleculares , Estrutura Molecular , Compostos Organometálicos/síntese química , Porosidade , Teoria Quântica , Estereoisomerismo
6.
Yao Xue Xue Bao ; 41(7): 675-9, 2006 Jul.
Artigo em Chinês | MEDLINE | ID: mdl-17007364

RESUMO

AIM: To study the four diastereomers of leucogen and structure of the related substances. METHODS: LC-DAD, LC-MS/MS and LC- 1H NMR were used. LC was carried out with a Phenomnex Luna C18 (250 mm x 4.60 mm ID, 5 microm) column and a mobile phase of water-acetonitrile-glacial acetic acid (58:42: 0.3). RESULTS: The structures of leucogen and its related substances were identified. Leucogen and the related substances were found to have four diastereomers in solution state separately. The stability and transformation of the four diastereomers were analyzed and 3R4S5R was found to be more stable than the others according to quantum calculations. CONCLUSION: Leucogen have four diastereomers in solution state and it can transform from one diastereomer to the others, and the 3R4S5R is more stable than the others.


Assuntos
Teoria Quântica , Tiazolidinas/química , Cromatografia Líquida , Espectroscopia de Ressonância Magnética , Estrutura Molecular , Soluções , Espectrometria de Massas por Ionização por Electrospray , Estereoisomerismo , Tiazolidinas/análise
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA