Investigation of the Presence of Toxoplasma gondii, Giardia duodenalis, and Cryptosporidium spp. in Drinking Waters in the Region of Marrakech, Morocco.

The association between the parasitic illnesses and the consumption of contaminated water has been largely reported. However, there is still a lack of studies investigating the extent of parasitic contamination in water in Morocco. This is the first study in Morocco that aimed at assessing the presence of protozoan parasites, namely Cryptosporidium spp., Giardia duodenalis, and Toxoplasma gondii, in drinking water consumed in the region of Marrakech. Samples processing was performed by membrane filtration and qPCR detection. A total of 104 drinking water samples (tap water, well, and spring waters) was collected between 2016 and 2020. The analysis revealed an overall protozoa contamination rate of 67.3% (70/104), of which 35 samples were positive for Giardia duodenalis, 18 for Toxoplasma gondii, and 17 for both parasites, whereas no sample was positive for Cryptosporidium spp. This first study showed that drinking water in the region of Marrakech contained parasites which could represent a risk for consumers. For a better understanding and estimation of the risk encountered by local inhabitants, further studies concerned with (oo)cyst viability, infectivity, and genotype identification need to be performed.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

Valve movement response of the mussel mytilus galloprovincialis to metals (Cu, Hg, Cd and Zn) and phosphate industry effluents from Moroccan Atlantic coast.

Valve activity was measured in the Mediterranean mussel Mytilus galloprovincialis in response to sublethal concentrations of four metals (Hg, Cu, Zn and Cd) and two phosphate industry effluents from the Atlantic coast of Morocco. Valve movements were monitored using a proximity inductive sensor which could display all activity figures from full closure to wide opening of the shell valves. In a 1 h exposure experiments, all metals induced a decrease in the time of normal opening and the appearance of sequences of stress behaviour, including enhanced valve adductions and complete closure at high concentrations. Mercury (tested from 5 to 75 microg Hg l(-1)) was the most toxic to the valve activity, with a threshold effective concentration at 10 microg Hg l(-1) and full valve closure occurring at 50 microg Hg l(-1). Copper (15-150 microg Cu l(-1)) showed a toxic effect starting at threshold concentration of 20 microg Cu l(-1) and induced full valve closure at 150 microg Cu l(-1). Zinc (100-500 microg Zn l(-1)) was effective in reducing the time of normal opening (threshold concentration at 100 microg Zn I(-1)) but no complete closure was recorded in any of the tested concentrations. For cadmium (1000-5000 microg Cd l(-1)), the valve activity was insensitive for exposures under 2000 microg Cd l(-1). Results for the testing of several samplings of the phosphate industry effluents (Safi and Jorf Lasfar) showed that their toxicity varied over the time. The effluent of the Jorf Lasfar plant (2-9.4%) was, however, more toxic than that of Safi (1-25%). In the light of these results, the sensitivity of the valve activity of Mytilus galloprovincialis to pollutants and its usefulness for in situ monitoring of coastal pollution in Morocco are discussed.