Use of an intraoperative wound protector to prevent surgical-site infection after pancreatoduodenectomy: randomized clinical trial.

BACKGROUND: Surgical-site infection (SSI) increases treatment costs, duration of hospital stay and readmission rate after pancreatic surgery. This study aimed to assess whether a wound protector could reduce the risk of superficial incisional SSI after pancreatoduodenectomy. METHODS: This RCT included patients undergoing pancreatoduodenectomy at Verona University Hospital, between 2017 and 2018. The experimental group had a dual-ring wound protector, whereas the control group had standard surgical drapes. The groups were stratified by preoperative biliary stent placement. The primary outcome was the overall rate of superficial SSI. RESULTS: An interim analysis was conducted after 212 patients had been enrolled; 22 patients (10·4 per cent) were excluded owing to inability to complete the pancreatoduodenectomy, or the need for postoperative reintervention. Some 94 patients (49·5 per cent) had a wound protector and 96 (50·5 per cent) had standard drapes. There were no differences between groups in demographics, or in intraoperative findings, pathological data or surgical outcomes. The overall superficial SSI rate was 7·4 per cent, which did not differ between groups (7 per cent in each group; P = 0·585). Subanalysis of patients with a preoperative biliary stent showed a similar outcome (superficial SSI rate 9 versus 8 per cent with wound protector versus surgical drapes respectively; P = 0·536). The trial was stopped prematurely on the grounds of futility. CONCLUSION: Use of a wound protector did not reduce the rate of superficial SSI after pancreatoduodenectomy. Registration number: NCT03820648 (http://www.clinicaltrials.gov).

ANTECEDENTES: La infección de la herida quirúrgica (surgical-site infection, SSI), especialmente de la incisión, aumenta sobremanera los costes del tratamiento, la duración de la estancia y la tasa de reingresos en la cirugía de páncreas. En los últimos años se han introducido los protectores de las heridas (wound protectors, WP) con la intención de reducir la tasa de SSI. Este estudio tuvo como objetivo evaluar si un WP podría reducir la incidencia de la SSI superficial de la incisión (superficial incisional surgical-site infection, SI-SSI) en pacientes sometidos a duodenopancreatectomía cefálica (pancreaticoduodenectomy, PD). MÉTODOS: Ensayo aleatorizado controlado en el que se incluyeron los pacientes a los que se realizó una PD en la Universidad de Verona entre 2017 y 2018. En el grupo experimental se utilizó un WP de doble anillo, mientras que el grupo control se utilizaron tallas quirúrgicas convencionales (standard drape, SD). Los grupos se estratificaron también según la colocación preoperatoria de una prótesis biliar. RESULTADOS: Se incluyeron 212 pacientes, de los que 22 (10%) abandonaron el estudio debido a la imposibilidad de realizar la DP o a la necesidad de una reintervención durante el curso postoperatorio. Los pacientes se dividieron en 94 (49%) en el grupo WP y 96 (51%) en el grupo SD. No se detectaron diferencias entre grupos en cuanto a las variables demográficas y a los resultados intraoperatorios, patológicos o quirúrgicos. La tasa global de SI-SSI fue del 7,4%, que no difirió entre los grupos (WP 7,5% versus SD 7,3%, P = 0,585). Teniendo en cuenta los resultados descritos, se cumplieron los criterios de futilidad del análisis y el ensayo se interrumpió prematuramente. CONCLUSIÓN: En el entorno de un centro de alto volumen, la WP por si sola no redujo la tasa de SI-SSI. Cabría plantear su utilización dentro de un programa multimodal, que debería incluir un replanteamiento interno de la institución encaminado a la reducción de complicaciones infecciosas.

Evaluation of pain, swelling and trismus after extraction of impacted third molars relative to the use of betamethasone in submucusal infiltration.

The aim of this study was to evaluate the anti-inflammatory effect of a single 4 mg injection of submucosal betamethasone after extraction of impacted third molars. Single-centre, single-blinded, parallel group study; Forty-three patients were submitted to impacted third molar extraction. In this study, 4 mg single-dose submucosal betamethasone was injected in the interventional group, while in the control group nothing was injected. Postoperative measurement included pain via the VAS scale, swelling and trismus with facial measurements and maximum mouth openings, and finally nerve sensitivity. There was a significant difference between the two groups regarding trismic pain and edema. The use of a single 4 mg submucosal betamethasone injection leads to a reduction of oedema, trismus and pain in patients undergoing impacted third molar extraction. .

Enterothorax After Hepatic Surgery: A Single-Center Experience.

BACKGROUND: Enterothorax (ET) is a rare complication after hepatic surgery. The literature in this field is limited and mainly based on case reports. The aim of this study was to review our department's experience. PATIENTS AND METHODS: We retrospectively analyzed 602 patients who underwent hepatic resection between November 2008 and December 2016. Major hepatic surgery (n = 321) was defined as right or extended right hepatectomy (n = 227), left or extended left hepatectomy (n = 63), trisegmentectomy (n = 13), and living donor liver transplantation (n = 18). ET cases were identified by analyzing clinical courses and radiological imaging. RESULTS: ET was observed in five out of 602 patients (0.8%). All patients developed the complication after major hepatic surgery (five out of 321, 1.6%). ET exclusively occurred after right (n = 3) or extended right hepatectomy (n = 2). Median time to diagnosis was 22 months. Radiological imaging showed herniation of small (n = 2), large bowel (n = 2), or omental fat (n = 1) with a median diaphragmatic defect of 3.9 cm. Two patients presented with acute incarceration and underwent emergency surgery, one patient reported recurrent pain and underwent elective repair, and two patients refused surgery. Follow-up imaging in two operated patients showed no recurrence of ET after 36 and 8 months. CONCLUSIONS: Patients after right hepatectomy have a substantial risk of ET. Acute right upper quadrant pain and/or dyspnea after hepatectomy should be investigated with adequate radiological imaging. Elective surgical repair of ET is recommended to avoid emergency surgery in case of incarceration.

Advantages of a multi-state approach in surgical research: how intermediate events and risk factor profile affect the prognosis of a patient with locally advanced rectal cancer.

BACKGROUND: Standard survival analysis fails to give insight into what happens to a patient after a first outcome event (like first relapse of a disease). Multi-state models are a useful tool for analyzing survival data when different treatments and results (intermediate events) can occur. Aim of this study was to implement a multi-state model on data of patients with rectal cancer to illustrate the advantages of multi-state analysis in comparison to standard survival analysis. METHODS: We re-analyzed data from the RCT FOGT-2 study by using a multi-state model. Based on the results we defined a high and low risk reference patient. Using dynamic prediction, we estimated how the survival probability changes as more information about the clinical history of the patient becomes available. RESULTS: A patient with stage UICC IIIc (vs UICC II) has a higher risk to develop distant metastasis (DM) or both DM and local recurrence (LR) if he/she discontinues chemotherapy within 6 months or between 6 and 12 months, as well as after the completion of 12 months CTx with HR 3.55 (p = 0.026), 5.33 (p = 0.001) and 3.37 (p < 0.001), respectively. He/she also has a higher risk to die after the development of DM (HR 1.72, p = 0.023). Anterior resection vs. abdominoperineal amputation means 63% risk reduction to develop DM or both DM and LR (HR 0.37, p = 0.003) after discontinuation of chemotherapy between 6 and 12 months. After development of LR, a woman has a 4.62 times higher risk to die (p = 0.006). A high risk reference patient has an estimated 43% 5-year survival probability at start of CTx, whereas for a low risk patient this is 79%. After the development of DM 1 year later, the high risk patient has an estimated 5-year survival probability of 11% and the low risk patient one of 21%. CONCLUSIONS: Multi-state models help to gain additional insight into the complex events after start of treatment. Dynamic prediction shows how survival probabilities change by progression of the clinical history.

Comparison of two different transection techniques in liver surgery-an experimental study in a porcine model.

AIMS: Postoperative morbidity and mortality after liver resection is closely related to the degree of intraoperative blood loss; the majority of which occurs during transection of the liver parenchyma. Many approaches and devices have therefore been developed to limit bleeding, but none has yet achieved perfect results up to now. The aim of this standardized chronic animal study was to compare the safety and efficacy of the LigaSure™ Vessel Sealing System (LVSS) with the stapler technique, which is one of the modern techniques for transecting the parenchyma in liver surgery. METHODS: Sixteen pigs underwent a left liver resection (LLR). Eight pigs received a LLR by means of an Endo GIA, whereas the other eight pigs underwent liver parenchymal transection followed by simultaneous sealing by the LVSS. The operating time, transection time, blood loss during transection, and time of hemostasis were measured on the day of LLR (postoperative day 0/POD 0). Animals were re-explored on postoperative day 7 (POD 7) and the transection surface of remnant liver was observed for fluid collection (hematoma, biloma, and abscess), necrosis, and other pathologies. A biopsy was taken from the area of transection for histopathological examination. RESULTS: All animals survived until POD 7. Operating time and transection time of the liver parenchyma on POD 0 was significantly shorter in the stapler group. There was no significant difference between the two groups in terms of blood loss during transection, time of hemostasis and number of sutures for hemostasis on POD 0, morbidity rate, as well as the histopathological examination on POD 7. Furthermore, the material costs were significantly higher in the stapler group than in the LVSS group. CONCLUSION: In this standardized chronic animal study concerning transection of the parenchyma in liver surgery, LVSS seems not only to be safe, but also comparable with the stapler technique in terms of morbidity and mortality. Additionally, LVSS significantly reduces material costs. However, the transection time is significantly longer for LVSS than for the stapler resection technique.

APE/Ref-1 is controlled by both redox and cAMP-dependent mechanisms in rat thyroid cells.

APE/Ref-1 is a multifunctional protein possessing both redox and DNA repair functions. Through its redox activity, APE/Ref-1 controls the DNA-binding function of several transcriptional regulators (AP1, NF-kappaB, p53, Pax proteins). We have previously shown that APE/Ref-1 upregulates the transcriptional activity of the thyroid-specific transcription factor Pax8. In thyroid cells, APE/Ref-1 can be detected both in the nuclear and cytoplasmatic compartments. In this study regulatory mechanisms acting on APE/Ref-1 were revealed using the FRTL-5 cell line. TSH induces both cytoplasm-to-nucleus translocation and neosynthesis of APE/Ref-1 protein. Interestingly, only neosynthesis is dependent on cAMP signalling. In contrast, the cytoplasm-to-nucleus translocation is dependent on redox-mediated mechanisms. Based upon the data shown in this study and in others, a bimodal control of APE/Ref-1 by TSH can be delineated.

ApeI/Ref-I expression and cellular localization in human thyroid carcinoma cell lines.

For its DNA repair, transcription factor regulation and anti-apoptotic activity, the apurinic/apirimidinic ApeI/Ref-I endonuclease is thought to play a relevant role in human tumorigenesis. In human thyroid tumors, we demonstrated an altered nuclear/cytoplasmic ratio in all the carcinomas examined but not in follicular adenomas. In this study, Ref-I expression and cellular localization were analyzed in a series of human thyroid carcinoma cell lines. We found a reduced nuclear/cytoplasmic ratio in BCPAP, TPC I and ARO cells and not in WRO cells. Such a pattern of expression corresponds to that observed in thyroid tumoral tissues except for the WRO cells which behave as the follicular adenomas rather than carcinomas. Thus, these cell lines represent an excellent in vitro model to analyze the molecular mechanisms involved in Ref-I regulation and activity and clarify its role in thyroid tumorigenesis.

Targeting neighbouring poly(purine.pyrimidine) sequences located in the human bcr promoter by triplex-forming oligonucleotides.

Most poly(purine.pyrimidine) [poly(R.Y)] sequences in eukaryotic genomes are interrupted by one or more base pair inversions. When the inversions are centrally located, the poly(R.Y) sequences can be regarded as the sum of two abutting sites, each potentially capable of forming a triple helix. Employing band-shift, footprinting and modeling methods we examined the formation of triple helices at a critical 27 bp poly(R.Y) sequence interrupted by two adjacent CG inversions, and located in the promoter of the human bcr gene at transcription initiation. We designed several 13-mer and 14-mer triplex-forming oligonucleotides (TFOs) capable of binding the bcr abutting sites, thereby generating different base juxtapositions at the triple helical junction, to examine whether triplex formation occurs in a cooperative manner. It is found that in 50 mM Tris/HCl, pH 7.4, 10 mM MgCl2, 2 mM spermine, 37 degrees C, the 13-and the 14-mer TFOs bind to one half of the bcr site with Delta G between -30 and -35 kJ x mol-1. However, when different 13-mer/14-mer combinations of TFOs were directed against the abutting poly(R x Y) sites, triplex formation has been found to be enhanced only for the triple helical junction formed by the 5'-A-T-3' base juxtaposition, in keeping with a partial stacking suggested from modeling analysis. On the other hand, a longer 24-mer TFO, binding noncooperatively to the same abutting sites, forms a much more stable triplex (Delta G = -51 kJ x mol-1), notwithstanding the two T x CG triads in the middle. Modeling investigations reveal that there is no continuity or propagation of base stacking involving adjacent bases of the third strand at the site of base inversion as well as on the 5' side. The data indicate that the entropy penalty of forming a triplex with two oligonucleotides is much higher than the energy gained from base stacking interactions at the triplex junction formed between the two TFOs.

Mitochondrial localization of APE/Ref-1 in thyroid cells.

Mutations of mitochondrial DNA (mtDNA) are associated with different human diseases, including cancer and aging. Reactive oxygen species produced during oxidative phosphorylation are a major source of mtDNA damage. It is not clear, however, whether DNA repair mechanisms, able to abolish effects due to oxidative damage, are present in mitochondria. APE/Ref-1 is a nuclear protein possessing both redox activity (by which activates, "in vitro", the DNA-binding functions of several transcription factors) and DNA repair activity over apurinic/apyrimidinic sites. Immunohistochemical evidences indicate that in follicular thyroid cells, APE/Ref-1 is located in both nucleus and cytoplasm. Electronmicroscopy immunocytochemistry performed in the rat thyroid FRTL-5 cell line, indicates that part of the cytoplasmatic APE/Ref-1 is located in mitochondria. The presence of APE/Ref-1 inside mitochondria is further demonstrated by western blot analysis after cell fractionation. In the Kimol cell line (which is derived from FRTL-5, transformed by the Ki-ras oncogene) the amount of mitochondrial APE/Ref-1 is reduced by three to fourfold with respect to the normal FRTL-5 cells. These results suggest that: (i) a machinery capable of repairing DNA damaged by oxidative stress is present in mitochondria and (ii) mtDNA repair mechanisms may be impaired during cell transformation.

A chicken hnRNP of the A/B family recognizes the single-stranded d(CCCTAA)(n) telomeric repeated motif.

With the aim of identifying proteins able to interact with the C-rich single-stranded telomeric repeated motif, three nuclear polypeptides, CBNP alpha, CBNP beta and CBNP gamma, with apparent mobilities in SDS/PAGE of 38, 44 and 55 kDa, respectively, were isolated from mature chicken erythrocytes by affinity chromatography. In situ UV-cross-linking experiments demonstrated that CBNP alpha and CBNP gamma interact directly with the telomeric d(CCCTAA)n repeat, whereas CBNP beta does not. Moreover, they provided information on the protein components responsible for each electrophoretic mobility-shift assay signal. Ion spray and matrix-assisted laser desorption ionization MS allowed us to identify CBNP alpha with single-stranded D-box-binding factor (ssDBF), a protein previously characterized as a transcription factor belonging to the A/B family of heterogeneous nuclear ribonucleoproteins, and CBNP beta with an isoform of this protein containing an extra exon. Similarly, CBNP gamma was shown to be probably the chicken homolog of hnRNP K, a ribonuclear protein able to bind to polyC oligonucleotides. The relation of CBNP alpha (i.e. ssDBF), CBNP beta and CBNP gamma to a number of similar proteins in the protein and nucleotide sequence databank is discussed. A rather diversified spectrum of functional roles has been assigned to some of these proteins despite the strong sequence homology among them.

Formation of triple helices at irregular poly (R.Y) sites located in critical positions in the human bcr promoter.

Two polypurine sequences interrupted respectively by one and two adjacent pyrimidines have been identified in the promoter of the human bcr gene. Although these targets are irregular they are recognised and tightly bound by AG and GT motif triplex-forming oligonucleotides. Thermodynamic and kinetic data are presented.

Effect of cations on purine.purine.pyrimidine triple helix formation in mixed-valence salt solutions.

The effect of various monovalent, divalent and oligovalent cations on the reaction of triplex formation by GT and AG motif triplex-forming oligonucleotides, designed to bind to biologically relevant polypurine-polypyrimidine sequences occurring in the promoters of the murine Ki-ras and human bcr genes, has been investigated by means of electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments. We found that in the presence of 10 mm MgCl2 the triple helices were progressively destabilized by adding increasing amounts of NaCl, from 20 to 140 mm, to the solution. We also observed that, while the total monovalent-ion concentration was constant at 100 mm, the exchange of sodium with potassium, but not lithium, results in a further destabilization of the triple helices, due to self-association equilibria involving the G-rich triplex-forming oligonucleotides. Potassium was found to destabilize triplex DNA even when the triple helices are preformed in the absence of K+. However, footprinting experiments also showed that the inhibitory effect of K+ on triplex DNA is partially compensated for by millimolar amounts of divalent transition metal ions such as Mn2+ and Ni2+, which upon coordinating to N7 of guanine are expected to enhance hydrogen-bond formation between the target and the third strand, and to reduce the assembly in quadruple structures of G-rich triplex-forming oligonucleotides. Triplex enhancement in the presence of potassium was also observed, but to a lesser extent, when spermine was added to the reaction mixture. Here, the ion effect on triplex DNA is rationalized in terms of competition among the different valence cations to bind to triplex DNA, and differential cation stabilization of unusual quadruplex structures formed by the triplex-forming oligonucleotides.

Widespread presence in mammals and high binding specificity of a nuclear protein that recognises the single-stranded telomeric motif (CCCTAA)n.

We have recently identified a protein in HeLa nuclear extracts which recognises the single-stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029-4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross-linking, and gel permeation chromatography techniques, that: (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC-block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki-ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG-motif-containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/ PAGE and non-denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions.

Formation of stable DNA triple helices within the human bcr promoter at a critical oligopurine target interrupted in the middle by two adjacent pyrimidines.

Antigene strategies based on the use of triplex-forming oligonucleotides (TFO) as artificial repressors are constrained by the need for genomic targets with a polypurine-polypyrimidine [poly (R.Y)] DNA motif. In this study, we demonstrate that both A/G and G/T motif oligonucleotides recognize and bind strongly to a critical polypurine sequence interrupted in the middle by two adjacent cytosines and located in the promoter of the human bcr gene at the transcription initiation. The interaction between the designed TFO and this irregular poly (R.Y) target has been studied using a number of techniques, including electrophoretic mobility shift assay (EMSA), circular dichroism (CD), DNase I, and dimethyl sulfate (DMS) footprinting. Although CD shows that the 24-mer TFO self-aggregate in solution, they bind to the bcr target at 37 degrees C, forming stable triplexes that do not dissociate during electrophoretic runs performed up to 50 degrees C in 50 mM Tris-acetate, pH 7.4, 10 mM MgCl2, 50 mM NaCl (buffer A). We used EMSA to determine the equilibrium dissociation constants (Kd) for the reaction T <==> D + TFO at 37 degrees C, either in buffer A or in 50 mM Tris-acetate, pH 7.4, 10 mM MgCl2, 5 mM NaCl (buffer B). The triplexes were found to be more stable in buffer B, a behavior that can be rationalized in terms of monovalent and divalent cation competition for binding to DNA. Footprinting experiments showed that the TFO interact with the irregular poly (R.Y) target in a highly sequence-specific way and that the A/G motif oligonucleotide, juxtaposing T to the double CG inversions of the target, formed the most stable triplex (e.g., 1 microM TFO promoted strong footprints at 37 degrees C). These triplexes, except the one containing two A.C.G mismatched triads, are not destabilized under near physiologic conditions, that is, in 50 mM Tris-acetate, pH 7.4, 80 mM KCl, 20 mM NaCl, 2 mM spermidine. Moreover, we found that guanine N7 in T.C.G and guanine N7 in A.C.G are both accessible to DMS and that the first is less reactive than the second. In conclusion, the results of this study indicate that a critical sequence in the human ber promoter may be used as a potential binding site for TFO designed to repress artificially the transcription of the fused bcr/abl gene expressed in leukemia cells.

(A,G)-oligonucleotides form extraordinary stable triple helices with a critical R.Y sequence of the murine c-Ki-ras promoter and inhibit transcription in transfected NIH 3T3 cells.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.

Guanine-rich oligonucleotides targeted to a critical R . Y site located in the Ki-ras promoter. The effect of competing self-structures on triplex formation.

The promoter of the murine Ki-ras proto-oncogene contains a (C+G)-rich homopurine . homopyrimidine (R . Y) sequence that is essential for transcription activity. We have designed two G-rich oligonucleotides, d(TGGGTGGGTGGTTGGGTGGG) (20GT) and d(AGGGAGGGAGGAAGGGAGGG) (20AG), that have the potential to bind the critical Ki-ras sequence via triplex-helix formation. Band-shift experiments have shown that 20GT binds the Ki-ras R . Y duplex with a delta G value of -40 +/- 5 kJ/mol, while 20AG appeared to have a lower affinity under the experimental conditions adopted: 50 mM Tris/HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2, 25 degrees C. In the absence of Mg2+, 20GT did not bind to the Ki-ras R . Y target, while 20AG exhibited the same affinity observed in the magnesium-containing buffer. To gain insight into the solution properties of 20GT and 20AG, we have performed several experiments including polyacrylamide gel electrophoresis (PAGE), hydroxyapatite chromatography, ultraviolet absorption melting and circular dichroism (CD). We found that 20AG rapidly self-associates into presumably a duplex, even at low concentration (< 1 microM), while 20GT forms aggregates slowly, a process favoured by high oligonucleotide concentrations (> 25 microM). The critical Ki-ras sequence was inserted in Bluescript KS+, downstream from the T7 promoter, to investigate to what extent 20AG and 20GT, which are directed against the R . Y target, are able to inhibit T7 RNA polymerase transcription, under near-physiological conditions. Transcription experiments conducted in vitro at pH 7.4 have shown that oligonucleotide 20GT produced a remarkable repression of T7 RNA polymerase activity in the concentration range (10-25 microM), whereas 20AG had little effect on transcription. In conclusion, the results of this work together with other data reported in the literature [Olivas, W. M. & Maher, L. J. III (1995) Biochemistry 34, 278-284; Noonberg, S. B., François, J.-C., Garestier, T. & Hélène, C. (1995) Nucleic Acids Res. 23, 1956-1963], demonstrate that G-rich oligonucleotides, in particular (G,A)-sequences, may raise problems for in vivo application due to self-aggregation.

Inhibition of T7 RNA polymerase transcription by phosphate and phosphorothioate triplex-forming oligonucleotides targeted to a R.Y site downstream from the promoter.

The effect of triplex-forming oligonucleotides (TFO) on the transcription activity of T7 RNA polymerase has been investigated by an in vitro assay. The TFOs, either containing only phosphate (PO2) or phosphate and phosphorothioate (POS) internucleotide linkages, were targeted to a 30-bp homopurine. homopyrimidine (R.Y) site cloned in plasmid Bluescript KS+ about four helical turns downstream from the T7 RNA promoter. Band-shift and ultraviolet absorption melting experiments showed that the designed pyrimidine PO2 and POS TFOs form stable triple-helical complexes with the R.Y target duplex (the delta GTFO values of triplex formation vary from -42 to -63 kJ/mol). The triple-helical complexes resulting from POS oligonucleotides were less stable (by 4-12 kJ/mol) than those obtained with PO2 analogues, the magnitude of destabilization being dependent on the number of POS groups present in the third strand. The designed TFOs were shown to efficiently repress bacteriophage T7 RNA polymerase transcription under different experimental conditions. The repression depended on pH, TFO concentration and temperature. When the TFO/template ratio was fixed to 100, a strong repressive effect was observed with normal and phosphorothioate pyrimidine TFOs, also under physiological conditions. In contrast, a purine-rich oligonucleotide containing 44% of guanine residues promoted only a weak transcription inhibition, even at a TFO/template ratio as high as 750. Both PO2- and POS-containing pyrimidine TFOs produced their strong repressive effect on T7 RNA polymerase transcription even when they were added to the reaction mixture simultaneously with the polymerase. A mechanism of transcription repression is discussed. The data reported in this paper are useful for designing oligonucleotides acting as artificial repressors in the antigene strategy and indicate that the R.Y target need not to be precisely confined to the promoter.

Evidence for intramolecularly folded i-DNA structures in biologically relevant CCC-repeat sequences.

The structural behaviour of repetitive cytosine DNA is examined in the oligodeoxynucleotide sequences of (CCCTAA)3CCCT (HTC4), GC(TCCC)3TCCT(TCCC)3 (KRC6) and the methylated (CCCT)3TCCT(CCCT)3C (KRM6) by circular dichroism (CD), gel electrophoresis (PAGE), and ultra violet (UV) absorbance studies. All the three sequences exhibit a pH-induced cooperative structural transition as monitored by CD. An intense positive CD band around 285 nm develops on lowering the pH from 8 to slightly acidic condition, indicative of the formation of base pairs between protonated cytosines. The oligomers are found to melt in a fully reversible and cooperative fashion, with a melting temperature (Tm) of around 50 degrees C at pH 5.5. The melting temperatures are independent from DNA concentration, indicative of an intramolecular process involved in the structural formation. PAGE experiments performed with 32P-labeled samples as well as with normal staining procedures show a predominantly single band migration for all the three oligomers suggestive of a unimolecular structure. From pH titrations the number of protons required for generating the structures formed by HTC4, KRC6 and KRM6 results to be around six. These findings strongly suggest that all the three sequences adopt an intramolecular i-motif structure. The demonstration of i-motif structure for KRC6, a critical functional stretch of the c-ki-ras promoter proto-oncogene, besides the human telomeric sequence HTC4, may be suggestive of larger significance in the functioning of DNA.

Pyrimidine phosphorothioate oligonucleotides form triple-stranded helices and promote transcription inhibition.

The ability of phosphorothioate (POS) oligonucleotides to recognise and bind to homopurine-homopyrimidine DNA double-stranded sites via triple helix formation has been investigated. It has been found that the homologous pyrimidine POS sequences Y11-Si (i = 0, 1,2,3,4,10), which have been obtained by an increasing sulphur substitution in the sugar-phosphate backbone of d(CTTCCTCCTCT) (Y11), and the target hairpin duplex d(GAAGGAGGAGA-T4-TCTCCTCCTTC) (h26) can form stable triple helices, as indicated by PAGE, CD and UV melting experiments. The thermal stability of the triple helices depends on the number of POS linkages in the third Y11 strand, varying from 48 degrees C (Y11, with only phosphate groups, PO2) to 31 degrees C (Y11-S10 containing exclusively thioate groups). On average, a Tm depression of about 2 degrees C per POS linkage introduced in Y11 was observed. CD data indicate that the sulphurization of the third strand results in minimal changes of triple-stranded structures. The energetics of the triplex-to-hairpin plus single-strand transition has been determined by van't Hoff analyses of the melting curves. In free energy terms, the POS triplexes h26.Y11-Si are less stable than the normal PO2 h26.Y11 triplex by values between 2.7 and 5.4 kcal/mol, depending on the number of POS linkages contained in the third strand. Phosphorothioate oligonucleotides being resistant towards several nucleases offer an interesting choice as gene blockers in antisense strategy. Thus, their ability to inhibit transcription via triple helix formation has been examined in vitro. We found that triplex-forming POS oligonucleotides of 20 bases in length (with a cytosine contents of 45%), containing either 10% or 26% thioate groups, strongly repress the transcription activity of the bacteriophage T7 RNA polymerase at pH 6.9, when used in excess compared to the target (mol oligo/mol template = 125). The here reported data are useful for designing phosphorothioate oligonucleotides targeted to genomic DNA in antigene strategy.