BAR502/fibrate conjugates: synthesis, biological evaluation and metabolic profile.

BAR502, a bile acid analogue, is active as dual FXR/GPBAR1 agonist and represents a promising lead for the treatment of cholestasis and NASH. In this paper we report the synthesis and the biological evaluation of a library of hybrid compounds prepared by combining, through high-yield condensation reaction, some fibrates with BAR502.The activity of the new conjugates was evaluated towards FXR, GPBAR1 and PPARα receptors, employing transactivation or cofactor recruitment assays. Compound 1 resulted as the most promising of the series and was subjected to further pharmacological investigation, together with stability evaluation and cell permeation assessment. We have proved by LCMS analysis that compound 1 is hydrolyzed in mice releasing clofibric acid and BAR505, the oxidized metabolite of BAR502, endowed with retained dual FXR/GPBAR1 activity.

Transcriptome Analysis in Patients With Muscle-invasive Bladder Cancer.

BACKGROUND/AIM: Bladder cancer (BC) is the most prevalent malignant tumor in the urinary tract, classified mainly into muscle-invasive BC (MIBC) and non-MIBC (NMIBC). Recent studies highlight the important role of changes in transcriptome activity in carcinogenesis, aiding in the identification of additional differentially regulated candidate genes, improving our understanding of the molecular basis of gene regulation in BC. This study aimed to evaluate the transcriptome of MIBC patients compared with normal subjects. MATERIALS AND METHODS: mRNA sequencing was conducted using the Illumina NovaSeq 6000 Dx system in a case series comprising 11 subjects with MIBC and 19 healthy controls matched for age and sex. For functional analysis, the pathfindR package was utilized to comprehensively identify pathways enriched in omics data within active subnetworks. RESULTS: Our results demonstrated the presence of differentiated pathways, including spliceosome activity, oxidative phosphorylation, and chemical carcinogenesis due to reactive oxygen species, in MIBC patients compared with controls. CONCLUSION: The identification of novel molecular pathways in MIBC patients could prove useful in defining cancer predisposition factors and exploring potential therapeutic options.

PYRIDOXINE-dependent epilepsy (PDE): An observational study of neonatal cases on the role of pyridoxine in patients treated with standard anti-seizure medications.

BACKGROUND: The main objective of this study was to evaluate the neurological consequences of delayed pyridoxine administration in patients diagnosed with Pyridoxin Dependent Epilepsies (PDE). MATERIALS AND METHODS: We reviewed 29 articles, comprising 52 genetically diagnosed PDE cases, ensuring data homogeneity. Three additional cases were included from the General Pediatric Operative Unit of San Marco Hospital. Data collection considered factors like age at the first seizure's onset, EEG reports, genetic analyses, and more. Based on the response to first-line antiseizure medications, patients were categorized into four distinct groups. Follow-up evaluations employed various scales to ascertain neurological, cognitive, and psychomotor developments. RESULTS: Our study includes 55 patients (28 males and 27 females), among whom 15 were excluded for the lack of follow-up data. 21 patients were categorized as "Responder with Relapse", 11 as "Resistant", 6 as "Pyridoxine First Approach", and 2 as "Responders". The neurological outcome revealed 37,5 % with no neurological effects, 37,5 % showed complications in two developmental areas, 15 % in one, and 10 % in all areas. The statistical analysis highlighted a positive correlation between the time elapsed from the administration of pyridoxine after the first seizure and worse neurological outcomes. On the other hand, a significant association was found between an extended latency period (that is, the time that elapsed between the onset of the first seizure and its recurrence) and worse neurological outcomes in patients who received an unfavorable score on the neurological evaluation noted in a subsequent follow-up. CONCLUSIONS: The study highlights the importance of early recognition and intervention in PDE. Existing medical protocols frequently overlook the timely diagnosis of PDE. Immediate administration of pyridoxine, guided by a swift diagnosis in the presence of typical symptoms, might improve long-term neurological outcomes, and further studies should evaluate the outcome of PDE neonates promptly treated with Pyridoxine.

Molecular Dynamic Simulations to Determine Individualized Therapy: Tetrabenazine for the GNAO1 Encephalopathy E246K Variant.

INTRODUCTION: GNAO1 encephalopathy is characterized by severe hypotonia, psychomotor retardation, epilepsy, and movement disorders. Genetic variations in GNAO1 have been linked to neurological symptoms including movement disorders like dystonia. The correlation between the E246K mutation in the Gα subunit and aberrant signal transduction of G proteins has been established but no data are reported regarding the efficacy of medical treatment with tetrabenazine. METHODS: Molecular modeling studies were performed to elucidate the molecular mechanisms underlying this mutation. We developed drug efficacy models using molecular dynamic simulations that replicated the behavior of wild-type and mutated proteins in the presence or absence of ligands. RESULTS AND DISCUSSION: We demonstrated that the absence of the mutation leads to normal signal transduction upon receptor activation by the endogenous ligand, but not in the presence of tetrabenazine. In contrast, the presence of the mutation resulted in abnormal signal transduction in the presence of the endogenous ligand, which was corrected by the drug tetrabenazine. Tetrabenazine was identified as a promising therapeutic option for pediatric patients suffering from encephalopathy due to an E246K mutation in the GNAO1 gene validated through molecular dynamics. This is a potential first example of the use of this technique in a rare neurological pediatric disease.

Drug resistant epilepsies: A multicentre case series of steroid therapy.

PURPOSE: Our study aimed to evaluate the effectiveness of corticosteroids on seizure control in drug-resistant epilepsies (DREs). Our primary goal was to assess the response to steroids for various underlying etiologies, interictal electroencephalographic (EEG) patterns and electroclinical seizure descriptions. Our second goal was to compare steroid responsiveness to different treatment protocols. METHODS: This is a retrospective multicentre cohort study conducted according to the STROBE guidelines (Strengthening the Reporting of Observational Studies in Epidemiology). The following data were collected for each patient: epilepsy etiology, interictal EEG pattern, seizure types and type of steroid treatment protocol administered. RESULTS: Thirty patients with DRE were included in the study. After 6 months of therapy, 62.7 % of patients experienced reduced seizure frequency by 50 %, and 6.6 % of patients experienced complete seizure cessation. Findings associated with favourable response to steroids included structural/lesional etiology of epilepsy, immune/infectious etiology and focal interictal abnormalities on EEG. Comparing four different steroid treatment protocols, the most effective for seizure control was treatment with methylprednisolone at the dose of 30 mg/kg/day administered for 3 days, leading to greater than 50 % seizure reduction at 6 months in 85.7 % of patients. Treatment with dexamethasone 6 mg/day for 5 days decreased seizure frequency in 71.4 % of patients. Hydrocortisone 10 mg/kg administered for 3 months showed a good response to treatment in 71 %. CONCLUSIONS: In our study, two-thirds of patients with DRE experienced a significant seizure reduction following treatment with steroids. We suggest considering steroids as a potential therapeutic option in children with epilepsy not responding to conventional antiseizure medicines (ASM).

Case report: Structural brain abnormalities in TUBA1A-tubulinopathies: a narrative review.

Introduction: Tubulin genes have been related to severe neurological complications and the term "tubulinopathy" now refers to a heterogeneous group of disorders involving an extensive family of tubulin genes with TUBA1A being the most common. A review was carried out on the complex and severe brain abnormalities associated with this genetic anomaly. Methods: A literature review of the cases of TUBA1A-tubulopathy was performed to investigate the molecular findings linked with cerebral anomalies and to describe the clinical and neuroradiological features related to this genetic disorder. Results: Clinical manifestations of TUBA1A-tubulinopathy patients are heterogeneous and severe ranging from craniofacial dysmorphism, notable developmental delay, and intellectual delay to early-onset seizures, neuroradiologically associated with complex abnormalities. TUBA1A-tubulinopathy may display various and complex cortical and subcortical malformations. Discussion: A range of clinical manifestations related to different cerebral structures involved may be observed in patients with TUBA1A-tubulinopathy. Genotype-phenotype correlations are discussed here. Individuals with cortical and subcortical anomalies should be screened also for pathogenic variants in TUBA1A.

A Young Boy with 21q21.1 Microdeletion Showing Speech Delay, Spastic Diplegia, and MRI Abnormalities: Original Case Report.

Chromosome 21q deletion syndrome is a rare disorder affecting the long arm of chromosome 21 and manifesting with wide phenotypic features depending on the size and position of the deleted region. In the syndrome, three distinct deleted regions have been distinguished: region 1, from the centromere to approximately 31.2 Mb (21q11.2-q22.11); region 2, from 31.2 to 36 Mb (21q22.11-q22.12); and region 3, from 36 to 37.5 Mb to the telomere (21q22.12-q22.3). The clinical features are highly variable manifesting with mild, poorly recognizable signs or with severe symptoms including craniofacial dysmorphism, growth failure, developmental delay, behavioral/affective abnormalities, and systemic malformations. We report here the case of a young boy with speech delay, mild spastic diplegia, and brain anomalies on magnetic resonance imaging (MRI). The genetic analysis displayed a microdeletion of the long arm of chromosome 21 approximately extending up to 1.08 Mb. Clinical presentation of the patient and cases of 21q21 deletion reported by the literature are discussed.

The Use of Midazolam as an Antiseizure Medication in Neonatal Seizures: Single Center Experience and Literature Review.

BACKGROUND: Existing therapeutic alternatives for neonatal crises have expanded in recent decades, but no consensus has been reached on protocols based on neonatal seizures. In particular, little is known about the use of midazolam in newborns. AIM: The aim of our study is to evaluate the response to midazolam, the appearance of side effects, and their impact on therapeutic decisions. METHODS: This is a STROBE-conformed retrospective observational study of 10 patients with neonatal seizures unresponsive to common antiseizure drugs, admitted to San Marco University Hospital's neonatal intensive care (Catania, Italy) from September 2015 to October 2022. In our database search, 36 newborns were treated with midazolam, but only ten children met the selection criteria for this study. RESULTS: Response was assessed both clinically and electrographic. Only 4 patients at the end of the treatment showed a complete electroclinical response; they were full-term infants with a postnatal age greater than 7 days. Non-responders and partial responders are all premature (4/10) or full-term neonates who started therapy in the first days of life (<7th day) (2/10). CONCLUSION: Neonatal seizures in preterm show a lower response rate to midazolam than seizures in full-term infants, with poorer prognosis. Liver and renal function and central nervous system development are incomplete in premature infants and the first days of life. In this study, we show that midazolam, a short-acting benzodiazepine, appears to be most effective in full-term infants and after 7 days of life.

Need for palliative care from birth to infancy in pediatric patients with neurological diseases.

BACKGROUND: Palliative care is a comprehensive treatment approach that guarantees comfort for pediatric patients and their families from diagnosis to death. The techniques used for neurological patients in the field of palliative care can enhance the quality of care provided to patients with neurological disorders and support their families. PURPOSE: This study aimed to analyze the palliative care protocols in use in our department, describe the palliative course in the clinical setting, and propose the implementation of hospital palliative care for long-term prognosis of patients with neurological diseases. METHODS: This retrospective observational study examined the application of palliative care from birth to early infancy in neurological patients. We studied 34 newborns with diseases affecting the nervous system impairing prognosis. The study was conducted from 2016 to 2020 at the Neonatology Intensive Care Unit and the Pediatric Unit of the San Marco University Hospital in Catania, Sicily, Italy. RESULTS: Despite current legislation in Italy, no palliative care network has been activated to meet the needs of the population. In our center, given the vast number of patients with neurological conditions requiring palliative care, we should activate a straightforward departmental unit for neurologic pediatric palliative care. CONCLUSION: The establishment of specialized reference centers that manage significant neurological illnesses is due to neuroscience research progress in recent decades. Integration with specialized palliative care is sparse but now seems essential.

Theonella: A Treasure Trove of Structurally Unique and Biologically Active Sterols.

The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge Theonella spp. represents an arsenal of novel compounds ranging from peptides, alkaloids, terpenes, macrolides, and sterols. In this review, we summarize the recent reports on sterols isolated from this amazing sponge, describing their structural features and peculiar biological activities. We also discuss the total syntheses of solomonsterols A and B and the medicinal chemistry modifications on theonellasterol and conicasterol, focusing on the effect of chemical transformations on the biological activity of this class of metabolites. The promising compounds identified from Theonella spp. possess pronounced biological activity on nuclear receptors or cytotoxicity and result in promising candidates for extended preclinical evaluations. The identification of naturally occurring and semisynthetic marine bioactive sterols reaffirms the utility of examining natural product libraries for the discovery of new therapeutical approach to human diseases.

Impressive efficacy of the ketogenic diet in a KCNQ2 encephalopathy infant: a case report and exhaustive literature review.

Background: KCNQ2 encephalopathy is characterized by neonatal-onset epilepsy and developmental impairment, due to "de novo" KCNQ2 pathogenic variants. According to literature data, sodium channel blocking agents appear to be the best treatment options for the disease. Reports describing the use of ketogenic diet (KD) in the KCNQ2 pediatric population are limited. The non-conservative amino acid substitution p.Ser122Leu in KCNQ2 is associated with a broad spectrum of inheritance modalities, clinical phenotypes and outcomes; no previous reports of the same variant treated with KD are available in literature. Case Description: We described a 22-month-old female with seizure onset on day 2 of life. At three months of age, she presented refractory status epilepticus (SE) that did not respond to midazolam and carbamazepine, which was added once a "de novo" p.Ser122Leu KCNQ2 variant was demonstrated. KD was the only treatment that led to cessation of seizures. The baby maintained seizures remission and achieved neurodevelopmental milestones. Conclusions: To define an overt genotype-phenotype correlation for KCNQ2 pathogenic variants is a challenge; we propose the KD as a valuable treatment for refractory seizures and impaired neurodevelopment in infants harboring "de novo" mutations in the KCNQ2 gene.

Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists.

Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds 5 and 11 as the first examples of nonsteroidal dual FXR/Pregnane X receptor (PXR) modulators. In HepG2 cells, these compounds modulated PXR- and FXR-regulated genes, resulting in interesting leads in the treatment of inflammatory disorders. Moreover, molecular docking studies supported the experimental results, disclosing the ligand binding mode and allowing rationalization of the activities of compounds 5 and 11.

Simple febrile seizures: new cut off for the duration of the crises.

BACKGROUND: Our study aimed to identify a new cut-off for febrile seizure (FS) with a good prognosis, thereby replacing the 15 min described in the standard definition of simple febrile seizure (SFS). METHODS: Our study was a retrospective observational study (from January 2018 to December 2018) on children admitted to the Pediatric emergency room of the Santobono-Pausilipon Hospital, Naples, Italy, Pediatric Unit of Latina, Rome, Italy, and Policlinico-Vittorio-Emanuele University Hospital, Catania, Italy, for fever, which developed SFS during the hospitalization. All included patients had their seizures classified as SFS according to the international criteria for epilepsy. We assumed a duration cut-off, and we analyzed the EEG results, neurological follow-up at 12 months, and the recurrence of the febrile seizures the following year. Then, with another calculation, we identify an optimal cut-off of 6 min. Finally, we divided the population into two groups: children with seizures having a duration greater than or less than 6 min. RESULTS: We found that the population with FS with a duration greater than 6 min presented EEG alteration at follow-up visits, neurological disorders, and a recurrence of FS during the following year. CONCLUSIONS: We suggest to introduce a new cut-off for the duration of FS that better represents the benign nature of a simple febrile event.

Phytochemical Analysis of the Methanolic Extract and Essential Oil from Leaves of Industrial Hemp Futura 75 Cultivar: Isolation of a New Cannabinoid Derivative and Biological Profile Using Computational Approaches.

Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ9-THC) concentration or for its fiber and nutrient content in industrial use. Industrial hemp shows a low Δ9-THC level and is a valuable source of phytochemicals, mainly represented by cannabinoids, flavones, terpenes, and alkaloids, with health-promoting effects. In the present study, we investigated the phytochemical composition of leaves of the industrial hemp cultivar Futura 75, a monoecious cultivar commercially used for food preparations or cosmetic purposes. Leaves are generally discarded, and represent waste products. We analyzed the methanol extract of Futura 75 leaves by HPLC and NMR spectroscopy and the essential oil by GC-MS. In addition, in order to compare the chemical constituents, we prepared the water infusion. One new cannabinoid derivative (1) and seven known components, namely, cannabidiol (2), cannabidiolic acid (3), ß-cannabispirol (4), ß-cannabispirol (5), canniprene (6), cannabiripsol (7), and cannflavin B (8) were identified. The content of CBD was highest in all preparations. In addition, we present the outcomes of a computational study focused on elucidating the role of 2α-hydroxy-Δ3,7-cannabitriol (1), CBD (2), and CBDA (3) in inflammation and thrombogenesis.

Pathogenic correlation between mosaic variegated aneuploidy 1 (MVA1) and a novel BUB1B variant: a reappraisal of a severe syndrome.

BACKGROUND: The BUB 1 mitotic checkpoint serine/threonine kinase B (BUB1B) gene encodes a key protein in the mitotic spindle checkpoint, which acts as a surveillance mechanism, crucial for the maintenance of the correct chromosome number during cell deviation. Mutations of BUB1B gene are linked to mosaic variegated aneuploidy 1 (MVA1) syndrome, a rare autosomal recessive disorder characterized by widespread mosaic aneuploidies, involving different chromosomes and tissues. MVA1 is clinically characterized by intrauterine growth restriction, post-natal growth retardation, and severe neurologic impairment including microcephaly, developmental delay/intellectual disability, epileptic seizures, and generalized hypotonia. Malignancies are also serious sequelae associated with the disorder. We reported on a case of two-year-old Italian girl with MVA1 who shows severe neurologic impairment, microcephaly and epileptic seizures. MATERIALS AND METHODS: Clinical data collection and genetic diagnosis of the patient were assessed. Mutational analysis covers the chromosomal microarray analysis, the gene methylation pattern studied using the methylation-specific multiplex ligation-dependent probe amplification, and the family-based Whole Exome Sequencing (WES). A literature research based on reported cases of MVA and premature chromatid separation was also included. RESULTS: Karyotyping has revealed 12% of mosaics in the patient who carries a novel variant in BUB1B gene (c.2679A > T, p.Arg893Ser) detected by WES. Thirty-one cases of MVA1 including the present report, and four prenatally diagnosed cases with MVA1 were selected and inspected. CONCLUSION: Clinical and genetic findings reported in the girl strongly suggest a new MVA1 genotype-phenotype correlation and lead to a reappraisal of a severe syndrome. Diagnosis and in-depth follow-up provided worthwhile data.

Neonatal neurologic emergencies requiring access to paediatric emergency units: a retrospective observational study.

Herein, authors present a retrospective, multi-center study to determine the number of accesses to Pediatric Emergency Unit (PEU) of patients within 28 days of life, admitted to (1) the Acute and Emergency Pediatric Unit, San Marco University Hospital, Catania, Italy; (2) Garibaldi Hospital for Emergency Care, Catania, Italy; (3) Cannizzaro Hospital for Emergency Care, Catania, Italy. We included neonates admitted for neurologic problems, from January 2015 to December 2020, to the 1-Acute and Emergency Access of the San Marco University Hospital, Catania, Italy [observation center 1 (OC1)]; 2-Garibaldi Hospital for Emergency Care, Catania, Italy (Observation Center 2-OC2); 3-Cannizzaro Hospital for Emergency Care, Catania, Italy (Observation Center 3-OC3). For each patient, we evaluated the severity of urgency, by studying the admission triage-coloured codes, the clinical data at admission and the discharge diagnosis. Neonates who had access to PEU were 812 in the OC1, 3720 in the OC2, and 748 in the OC3 respectively; 69 (8.4%), 138 (3.7%), and 55 (7.4%) was the proportion of neonatal accesses for neurological conditions. We observed that in the study period, the three hospitals had an important decrease of pediatric accesses to their PEU, but the proportion of neonates who had access to the OC1 for neurologic diseases, with respect to the total neonatal accesses, remained stable. We found that the most frequent neurologic disease for which newborns had access to PEU was Cyanosis, (46.1% of all neonatal accesses). Apnea was the second most frequent cause, with a number of 76 accesses (29%). In the literature there are numerous studies on the assessment of diseases that most frequently concern the pediatric patient in an emergency room, but there are very few references on neonatal accesses for urgent neurologic diseases. Therefore, appropriate training is required to avoid unnecessary tests without overlooking potentially serious conditions.

Fever-Associated Seizures or Epilepsy: An Overview of Old and Recent Literature Acquisitions.

In addition to central nervous system infections, seizures and fever may occur together in several neurological disorders. Formerly, based on the clinical features and prognostic evolution, the co-association of seizure and fever included classical febrile seizures (FS) divided into simple, complex, and prolonged FS (also called febrile status epilepticus). Later, this group of disorders has been progressively indicated, with a more inclusive term, as "fever-associated seizures or epilepsy" (FASE) that encompasses: (a) FS divided into simple, complex, and prolonged FS; (b) FS plus; (c) severe myoclonic epilepsy in infancy (Dravet syndrome); (d) genetic epilepsy with FS plus; and (e) febrile infection-related epilepsy syndrome (FIRES). Among the FASE disorders, simple FS, the most common and benign condition, is rarely associated with subsequent epileptic seizures. The correlation of FS with epilepsy and other neurological disorders is highly variable. The pathogenesis of FASE is unclear but immunological and genetic factors play a relevant role and the disorders belonging to the FASE group show to have an underlying common clinical, immunological, and genetic pathway. In this study, we have reviewed and analyzed the clinical data of each of the heterogeneous group of disorders belonging to FASE.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Alternating Hemiplegia of Childhood: neurological comorbidities and intrafamilial variability.

BACKGROUND: Alternating of Childhood (AHC) is an uncommon and complex disorder characterized by age of onset before 18 months with recurrent hemiplegia of one or either sides of the body or quadriplegia. The disorder is mainly caused by mutations in ATP1A3 gene, and to a lesser extent in ATP1A2 gene. In AHC neurological co-morbidities are various and frequently reported including developmental delay, epilepsy, tonic or dystonic spells, nystagmus,autonomic manifestations with intrafamilial variability. CASE PRESENTATION: Clinical and genetic findings of a couple of twins (Family 1: Case 1 and Case 2) and a couple of siblings (Family 2: Case 3 and Case 4) coming from two different Italian families affected by AHC were deeply examined. In twins of Family 1, a pathogenic variant in ATP1A3 gene (c.2318A>G) was detected. In siblings of Family 2, the younger brother showed a novel GRIN2A variant (c.3175 T > A), while the older carried the same GRIN2A variant, and two missense mutations in SCNIB (c.632 > A) and KCNQ2 (1870 G > A) genes. Clinical manifestations of the four affected children were reported along with cases of AHC drawn from the literature. CONCLUSIONS: Hemiplegic episode is only a sign even if the most remarkable of several and various neurological comorbidities in AHC affected individuals. Molecular analysis of the families here reported showed that clinical features of AHC may be also the result of an unexpected genetic heterogeneity.

Biological Profile of Two Gentiana lutea L. Metabolites Using Computational Approaches and In Vitro Tests.

Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted from Gentiana lutea L. by means of computational techniques and in vitro assays. The two molecules (loganic acid and gentiopicroside) were tested in silico using an innovative technique, named Inverse Virtual Screening (IVS), to highlight putative partners among a panel of proteins involved in inflammation and cancer events. A positive binding with cyclooxygenase-2 (COX-2), alpha-1-antichymotrypsin, and alpha-1-acid glycoprotein emerged from the computational experiments and the outcomes from the promising interaction with COX-2 were confirmed by Western blot, highlighting the reliability of IVS in the field of the natural products.