First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba.

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

First Report of Tomato yellow leaf curl virus Associated with Beans, Phaseolus vulgaris, in Cuba.

Beans with yellow mosaic and/or leaf crumple symptoms were collected in three fields in the southern area of the province of Havana, Cuba in December 2001 and February 2002. DNA was extracted from the fresh bean leaves of 25 samples (1). Dot blot hybridization was performed at high stringency with a specific probe for Tomato yellow leaf curl virus (TYLCV). The specific probe was prepared by alkaline phosphatase labeling of the polymerase chain reaction (PCR) fragment amplified with primer pair, PTYIRv21/PTYIRc287, containing the intergenic region (IR) of TYLCV, and chemiluminescent hybridization was completed as described by the manufacturer (AlkPhos Direct Labeling and Detection Systems, Amersham Pharmacia Biotech Inc., Piscataway, NJ). Four of the samples had positive hybridization signals. PCR was performed with overlapping primers for TYLCV (2) with the DNA extract from sample 01-44, which gave a positive hybridization signal with the TYLCV probe, and a 2.8-kb fragment was obtained. This fragment was cloned in pGem T-Easy (pBeTY44) and partially sequenced. Greater than 96% nt identity was obtained for the 591 nt of the IR and 504 nt of the N-terminus of the Rep gene with TYLCV (GenBank Accession No. AF260331). Also, PCR was completed on 11 of the 25 samples with the degenerate primer pair PAL1v1978/PAR1c715 for DNA-A (3). Eight samples gave fragment sizes of 1.4 kb and one sample gave a fragment of 1.3 kb. The 1.3-kb fragment from sample number 01-50 was cloned in pGem T-Easy (pBeBG50) and partially sequenced. Pairwise nucleotide comparisons with Bean golden yellow mosaic virus (BGYMV, GenBank Accession No. M91604) were 95% for 719 nt of the N-terminus of the Rep gene. These results are consistent with the association of both TYLCV and BGYMV in beans and have important implications for future disease management strategies. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) M. K. Nakhla et al. Plant Dis. 78:926, 1994. (3) M. Rojas et al. Plant Dis. 77:340, 1993.

Havana tomato virus, a new bipartite geminivirus infecting tomatoes in Cuba.

The cloning and nucleotide sequence of a new bipartite geminivirus found in Cuba is described. DNA A (2620 nt) and DNA B (2586 nt) presented a genomic structure resembling that of other geminiviruses transmitted by Bemisia tabaci. Both components had a common region of 168 nt with a 95% identity. Typical elements involved in replication and transcription were found in this region, though group-characteristic arrangement of iterons was not conserved in this virus. Sequence was compared with geminivirus sequences deposited in the GenBank. Interestingly, when total DNAs or individual ORFs and deduced amino acid sequences were compared, the highest scores were for different viruses. It showed to be most closely related to tomato mottle virus (81.9% and 65.5% similarity with DNAs A and B, respectively) and a member of the abutilon mosaic cluster of New World Begomoviruses. When clones A and B were co-agroinoculated they resulted highly infectious and induced symptoms in Nicotiana benthamiana plants. The A component alone was infectious but induced only mild symptoms, while the B component was not infectious. The presence of viral DNA in N. benthamiana plants was confirmed by dot-blot hybridization using specific probes. These data show that the cuban isolate is a new geminivirus for which the name of Havana tomato virus is proposed.