Nitrile Substituents at the Conjugated Dipyridophenazine Moiety as Infrared Redox Markers in Electrochemically Reduced Heteroleptic Ru(II) Polypyridyl Complexes.

Ruthenium(II) complexes [Ru(tap)2(NN)]2+ (tap = 1,4,5,8-tetraazaphenanthrene, NN = 11-cyano-dipyrido[3,2-a:2',3'-c]phenazine (11-CN-dppz) and 11,12-dicyano-dipyrido[3,2-a:2',3'-c]phenazine (11,12-CN-dppz)) feature the C≡N groups as infrared (IR)-active redox markers. They were studied by cyclic voltammetry, UV-vis, and IR spectroelectrochemistry (SEC), and density functional theory calculations to assign the four 1e- reduction waves R1-R4 observed in dichloromethane. Generally, the NN ligands are reduced first (R1). For [Ru(tap)2(11,12-CN-dppz)]2+, R1 is sufficiently separated from R2 and delocalized over both tap ligands. Accordingly, IR SEC conducted at R1 shows a large red shift of the νs,as(C≡N) modes by -18/-28 cm-1, accompanied by a 4-fold enhancement of the νs(C≡N) intensity, comparably with reference data for free 11,12-CN-dppz. The first tap-based reduction of spin-doublet [Ru(tap)2(11,12-CN-dppz)]+ to spin-triplet [Ru(tap)2(11,12-CN-dppz)] at R2 decreased ν(C≡N) by merely -2 cm-1, while the intensity enhancement reached an overall factor of 8. Comparably, a red shift of ν(C≡N) by -27 cm-1 resulted from the 1e- reduction of [Ru(tap)2(11-CN-dppz)]2+ at R1 (poorly resolved from R2), and the intensity enhancement was roughly 3-fold. Concomitant 1e- reductions of the tap ligands (R2 and R3) caused only minor ν(C≡N) shifts of -3 cm-1 and increased the absorbance by overall factors of 6.5 and 8, respectively.

Probing a Major DNA Weakness: Resolving the Groove and Sequence Selectivity of the Diimine Complex Λ-[Ru(phen)2 phi]2.

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.

Interactions of small molecules with DNA junctions.

The four natural DNA bases (A, T, G and C) associate in base pairs (A=T and G≡C), allowing the attached DNA strands to assemble into the canonical double helix of DNA (or duplex-DNA, also known as B-DNA). The intrinsic supramolecular properties of nucleobases make other associations possible (such as base triplets or quartets), which thus translates into a diversity of DNA structures beyond B-DNA. To date, the alphabet of DNA structures is ripe with approximately 20 letters (from A- to Z-DNA); however, only a few of them are being considered as key players in cell biology and, by extension, valuable targets for chemical biology intervention. In the present review, we summarise what is known about alternative DNA structures (what are they? When, where and how do they fold?) and proceed to discuss further about those considered nowadays as valuable therapeutic targets. We discuss in more detail the molecular tools (ligands) that have been recently developed to target these structures, particularly the three- and four-way DNA junctions, in order to intervene in the biological processes where they are involved. This new and stimulating chemical biology playground allows for devising innovative strategies to fight against genetic diseases.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.