Drought stress-inducible synthetic promoters designed for poplar are functional in rice.

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

Economic and Sustainability Impacts of Yield and Composition Variation in Bioenergy Crops: Switchgrass (Panicum virgatum L.).

Economically viable production of biobased products and fuels requires high-yielding, high-quality, sustainable process-advantaged crops, developed using bioengineering or advanced breeding approaches. Understanding which crop phenotypic traits have the largest impact on biofuel economics and sustainability outcomes is important for the targeted feedstock crop development. Here, we evaluated biomass yield and cell-wall composition traits across a large natural variant population of switchgrass (Panicum virgatum L.) grown across three common garden sites. Samples from 331 switchgrass genotypes were collected and analyzed for carbohydrate and lignin components. Considering plant survival and biomass after multiple years of growth, we found that 84 of the genotypes analyzed may be suited for commercial production in the southeastern U.S. These genotypes show a range of growth and compositional traits across the population that are apparently independent of each other. We used these data to conduct techno-economic analyses and life cycle assessments evaluating the performance of each switchgrass genotype under a standard cellulosic ethanol process model with pretreatment, added enzymes, and fermentation. We find that switchgrass yield per area is the largest economic driver of the minimum fuel selling price (MSFP), ethanol yield per hectare, global warming potential (GWP), and cumulative energy demand (CED). At any yield, the carbohydrate content is significant but of secondary importance. Water use follows similar trends but has more variability due to an increased dependence on the biorefinery model. Analyses presented here highlight the primary importance of plant yield and the secondary importance of carbohydrate content when selecting a feedstock that is both economical and sustainable.

Transgene Bioconfinement: Don't Flow There.

The adoption of genetically engineered (GE) crops has led to economic and environmental benefits. However, there are regulatory and environmental concerns regarding the potential movement of transgenes beyond cultivation. These concerns are greater for GE crops with high outcrossing frequencies to sexually compatible wild relatives and those grown in their native region. Newer GE crops may also confer traits that enhance fitness, and introgression of these traits could negatively impact natural populations. Transgene flow could be lessened or prevented altogether through the addition of a bioconfinement system during transgenic plant production. Several bioconfinement approaches have been designed and tested and a few show promise for transgene flow prevention. However, no system has been widely adopted despite nearly three decades of GE crop cultivation. Nonetheless, it may be necessary to implement a bioconfinement system in new GE crops or in those where the potential of transgene flow is high. Here, we survey such systems that focus on male and seed sterility, transgene excision, delayed flowering, as well as the potential of CRISPR/Cas9 to reduce or eliminate transgene flow. We discuss system utility and efficacy, as well as necessary features for commercial adoption.

Overexpression of soybean trypsin inhibitor genes decreases defoliation by corn earworm (Helicoverpa zea) in soybean (Glycine max) and Arabidopsis thaliana.

Trypsin inhibitors (TIs) are widely distributed in plants and are known to play a protective role against herbivores. TIs reduce the biological activity of trypsin, an enzyme involved in the breakdown of many different proteins, by inhibiting the activation and catalytic reactions of proteins. Soybean (Glycine max) contains two major TI classes: Kunitz trypsin inhibitor (KTI) and Bowman-Birk inhibitor (BBI). Both genes encoding TI inactivate trypsin and chymotrypsin enzymes, which are the main digestive enzymes in the gut fluids of Lepidopteran larvae feeding on soybean. In this study, the possible role of soybean TIs in plant defense against insects and nematodes was investigated. A total of six TIs were tested, including three known soybean trypsin inhibitors (KTI1, KTI2 and KTI3) and three genes encoding novel inhibitors identified in soybean (KTI5, KTI7, and BBI5). Their functional role was further examined by overexpression of the individual TI genes in soybean and Arabidopsis. The endogenous expression patterns of these TI genes varied among soybean tissues, including leaf, stem, seed, and root. In vitro enzyme inhibitory assays showed significant increase in trypsin and chymotrypsin inhibitory activities in both transgenic soybean and Arabidopsis. Detached leaf-punch feeding bioassays detected significant reduction in corn earworm (Helicoverpa zea) larval weight when larvae fed on transgenic soybean and Arabidopsis lines, with the greatest reduction observed in KTI7 and BBI5 overexpressing lines. Whole soybean plant greenhouse feeding bioassays with H. zea on KTI7 and BBI5 overexpressing lines resulted in significantly reduced leaf defoliation compared to non-transgenic plants. However, bioassays of KTI7 and BBI5 overexpressing lines with soybean cyst nematode (SCN, Heterodera glycines) showed no differences in SCN female index between transgenic and non-transgenic control plants. There were no significant differences in growth and productivity between transgenic and non-transgenic plants grown in the absence of herbivores to full maturity under greenhouse conditions. The present study provides further insight into the potential applications of TI genes for insect resistance improvement in plants.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

The Genetic Architecture of Nitrogen Use Efficiency in Switchgrass (Panicum virgatum L.).

Switchgrass (Panicum virgatum L.) has immense potential as a bioenergy crop with the aim of producing biofuel as an end goal. Nitrogen (N)-related sustainability traits, such as nitrogen use efficiency (NUE) and nitrogen remobilization efficiency (NRE), are important factors affecting switchgrass quality and productivity. Hence, it is imperative to develop nitrogen use-efficient switchgrass accessions by exploring the genetic basis of NUE in switchgrass. For that, we used 331 diverse field-grown switchgrass accessions planted under low and moderate N fertility treatments. We performed a genome wide association study (GWAS) in a holistic manner where we not only considered NUE as a single trait but also used its related phenotypic traits, such as total dry biomass at low N and moderate N, and nitrogen use index, such as NRE. We have evaluated the phenotypic characterization of the NUE and the related traits, highlighted their relationship using correlation analysis, and identified the top ten nitrogen use-efficient switchgrass accessions. Our GWAS analysis identified 19 unique single nucleotide polymorphisms (SNPs) and 32 candidate genes. Two promising GWAS candidate genes, caffeoyl-CoA O-methyltransferase (CCoAOMT) and alfin-like 6 (AL6), were further supported by linkage disequilibrium (LD) analysis. Finally, we discussed the potential role of nitrogen in modulating the expression of these two genes. Our findings have opened avenues for the development of improved nitrogen use-efficient switchgrass lines.

Proteinase inhibitors in legume herbivore defense: from natural to genetically engineered protectants.

Proteinase inhibitors (PIs) from legumes have the potential for use as protectants in response to pests and pathogens. Legumes have evolved PIs that inhibit digestive proteinases upon herbivory resulting in delayed development, deformities, and reduced fertility of herbivorous insects. Legume PIs (serine proteinase inhibitors and cysteine proteinase inhibitors) have been overexpressed in plants to confer plant protection against herbivores. Recently, the co-expression of multiple PIs in transgenic plants enhanced host defense over single PI expression, i.e., in an additive fashion. Therefore, a synthetic PI could conceivably be designed using different inhibitory domains that may provide multifunctional protection. Little attention has yet given to expanding PI gene repertoires to improve PI efficacy for targeting multiple proteinases. Also, PIs have been shown to play an important role in response to abiotic stresses. Previously published papers have presented several aspects of strategic deployment of PIs in transgenic plants, which is the focus of this review by providing a comprehensive update of the recent progress of using PIs in transgenic plants. We also emphasize broadening the potential usefulness of PIs and their future direction in research, which will likely result in a more potent defense against herbivores.

Sustainability Trait Modeling of Field-Grown Switchgrass (Panicum virgatum) Using UAV-Based Imagery.

Unmanned aerial vehicles (UAVs) provide an intermediate scale of spatial and spectral data collection that yields increased accuracy and consistency in data collection for morphological and physiological traits than satellites and expanded flexibility and high-throughput compared to ground-based data collection. In this study, we used UAV-based remote sensing for automated phenotyping of field-grown switchgrass (Panicum virgatum), a leading bioenergy feedstock. Using vegetation indices calculated from a UAV-based multispectral camera, statistical models were developed for rust disease caused by Puccinia novopanici, leaf chlorophyll, nitrogen, and lignin contents. For the first time, UAV remote sensing technology was used to explore the potentials for multiple traits associated with sustainable production of switchgrass, and one statistical model was developed for each individual trait based on the statistical correlation between vegetation indices and the corresponding trait. Also, for the first time, lignin content was estimated in switchgrass shoots via UAV-based multispectral image analysis and statistical analysis. The UAV-based models were verified by ground-truthing via correlation analysis between the traits measured manually on the ground-based with UAV-based data. The normalized difference red edge (NDRE) vegetation index outperformed the normalized difference vegetation index (NDVI) for rust disease and nitrogen content, while NDVI performed better than NDRE for chlorophyll and lignin content. Overall, linear models were sufficient for rust disease and chlorophyll analysis, but for nitrogen and lignin contents, nonlinear models achieved better results. As the first comprehensive study to model switchgrass sustainability traits from UAV-based remote sensing, these results suggest that this methodology can be utilized for switchgrass high-throughput phenotyping in the field.

Novel Candidate Genes Differentially Expressed in Glyphosate-Treated Horseweed (Conyza canadensis).

The evolution of herbicide-resistant weed species is a serious threat for weed control. Therefore, we need an improved understanding of how gene regulation confers herbicide resistance in order to slow the evolution of resistance. The present study analyzed differentially expressed genes after glyphosate treatment on a glyphosate-resistant Tennessee ecotype (TNR) of horseweed (Conyza canadensis), compared to a susceptible biotype (TNS). A read size of 100.2 M was sequenced on the Illumina platform and subjected to de novo assembly, resulting in 77,072 gene-level contigs, of which 32,493 were uniquely annotated by a BlastX alignment of protein sequence similarity. The most differentially expressed genes were enriched in the gene ontology (GO) term of the transmembrane transport protein. In addition, fifteen upregulated genes were identified in TNR after glyphosate treatment but were not detected in TNS. Ten of these upregulated genes were transmembrane transporter or kinase receptor proteins. Therefore, a combination of changes in gene expression among transmembrane receptor and kinase receptor proteins may be important for endowing non-target-site glyphosate-resistant C. canadensis.

High-Throughput Switchgrass Phenotyping and Biomass Modeling by UAV.

Unmanned aerial vehicle (UAV) technology is an emerging powerful approach for high-throughput plant phenotyping field-grown crops. Switchgrass (Panicum virgatum L.) is a lignocellulosic bioenergy crop for which studies on yield, sustainability, and biofuel traits are performed. In this study, we exploited UAV-based imagery (LiDAR and multispectral approaches) to measure plant height, perimeter, and biomass yield in field-grown switchgrass in order to make predictions on bioenergy traits. Manual ground truth measurements validated the automated UAV results. We found UAV-based plant height and perimeter measurements were highly correlated and consistent with the manual measurements (r = 0.93, p < 0.001). Furthermore, we found that phenotyping parameters can significantly improve the natural saturation of the spectral index of the optical image for detecting high-density plantings. Combining plant canopy height (CH) and canopy perimeter (CP) parameters with spectral index (SI), we developed a robust and standardized biomass yield model [biomass = (m × SI) × CP × CH] where the m is an SI-sensitive coefficient linearly varying with the plant phenological changing stage. The biomass yield estimates obtained from this model were strongly correlated with manual measurements (r = 0.90, p < 0.001). Taking together, our results provide insights into the capacity of UAV-based remote sensing for switchgrass high-throughput phenotyping in the field, which will be useful for breeding and cultivar development.

Lipofection-mediated genome editing using DNA-free delivery of the Cas9/gRNA ribonucleoprotein into plant cells.

KEY MESSAGE: A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.

Development and validation of a novel and robust cell culture system in soybean (Glycine max (L.) Merr.) for promoter screening.

KEY MESSAGE: A novel soybean cell culture was developed, establishing a reliable and rapid promoter assay to enable high-throughput automated screening in soybean protoplasts relevant to shoot tissues in whole plants. Transient reporter gene assays can be valuable to rapidly estimate expression characteristics of heterologous promoters. The challenge for maximizing the value of such screens is to combine relevant cells or tissues with methods that can be scaled for high-throughput screening, especially for crop-rather than model species. We developed a robust and novel soybean cell suspension culture derived from leaf-derived callus for protoplast production: a platform for promoter screening. The protoplasts were transfected with promoter-reporter constructs, of which were chosen and validated against known promoter expression profiles from tissue-derived protoplasts (leaves, stems, and immature cotyledons) and gene expression data from plants. The cell culture reliably produced 2.82 ± 0.94 × 108 protoplasts/g fresh culture mass with a transfection efficiency of 31.06 ± 7.69% at 48 h post-incubation. The promoter-reporter gene DNA expression levels of transfected cell culture-derived protoplasts were most similar to that of leaf- and stem-derived protoplasts (correlation coefficient of 0.99 and 0.96, respectively) harboring the same constructs. Cell culture expression was also significantly correlated to endogenous promoter-gene expression in leaf tissues as measured by qRT-PCR (correlation coefficient of 0.80). Using the manual protocols that produced these results, we performed early stage experiments to automate protoplast transformation on a robotic system. After optimizing the protocol, we achieved up to 29% transformation efficiency using our robotic system. We conclude that the soybean cell culture-to-protoplast transformation screen is amenable to automate promoter and gene screens in soybean that could be used to accelerate discoveries relevant for crop improvement. Key features of the system include low-cost, facile protoplast isolation, and transformation for soybean shoot tissue-relevant molecular screening.

Transcriptomic Analysis Identifies New Non-Target Site Glyphosate-Resistance Genes in Conyza bonariensis.

Conyza bonariensis (hairy fleabane) is one of the most problematic and widespread glyphosate-resistant weeds in the world. This highly competitive weed species significantly interferes with crop growth and substantially decreases crop yield. Despite its agricultural importance, the molecular mechanisms of glyphosate resistance are still unknown. The present RNA-Seq study was performed with the goal of identifying differentially expressed candidate transcripts (genes) related to metabolism-based non-target site glyphosate resistance in C. bonariensis. The whole-transcriptome was de novo assembled from glyphosate-resistant and -sensitive biotypes of C. bonariensis from Southern Brazil. The RNA was extracted from untreated and glyphosate-treated plants at several timepoints up to 288 h after treatment in both biotypes. The transcriptome assembly produced 90,124 contigs with an average length of 777 bp and N50 of 1118 bp. In response to glyphosate treatment, differential gene expression analysis was performed on glyphosate-resistant and -sensitive biotypes. A total of 9622 genes were differentially expressed as a response to glyphosate treatment in both biotypes, 4297 (44.6%) being up- and 5325 (55.4%) down-regulated. The resistant biotype presented 1770 up- and 2333 down-regulated genes while the sensitive biotype had 2335 and 2800 up- and down-regulated genes, respectively. Among them, 974 up- and 1290 down-regulated genes were co-expressed in both biotypes. In the present work, we identified 41 new candidate target genes from five families related to herbicide transport and metabolism: 19 ABC transporters, 10 CYP450s, one glutathione S-transferase (GST), five glycosyltransferases (GT), and six genes related to antioxidant enzyme catalase (CAT), peroxidase (POD), and superoxide dismutase (SOD). The candidate genes may participate in metabolic-based glyphosate resistance via oxidation, conjugation, transport, and degradation, plus antioxidation. One or more of these genes might 'rescue' resistant plants from irreversible damage after glyphosate treatment. The 41 target genes we report in the present study may inform further functional genomics studies, including gene editing approaches to elucidate glyphosate-resistance mechanisms in C. bonariensis.

Field-grown miR156 transgenic switchgrass reproduction, yield, global gene expression analysis, and bioconfinement.

BACKGROUND: Genetic engineering has been effective in altering cell walls for biofuel production in the bioenergy crop, switchgrass (Panicum virgatum). However, regulatory issues arising from gene flow may prevent commercialization of engineered switchgrass in the eastern United States where the species is native. Depending on its expression level, microRNA156 (miR156) can reduce, delay, or eliminate flowering, which may serve to decrease transgene flow. In this unique field study of transgenic switchgrass that was permitted to flower, two low (T14 and T35) and two medium (T27 and T37) miR156-overexpressing 'Alamo' lines with the transgene under the control of the constitutive maize (Zea mays) ubiquitin 1 promoter, along with nontransgenic control plants, were grown in eastern Tennessee over two seasons. RESULTS: miR156 expression was positively associated with decreased and delayed flowering in switchgrass. Line T27 did not flower during the 2-year study. Line T37 did flower, but not all plants produced panicles. Flowering was delayed in T37, resulting in 70.6% fewer flowers than controls during the second field year with commensurate decreased seed yield: 1205 seeds per plant vs. 18,539 produced by each control. These results are notable given that line T37 produced equivalent vegetative aboveground biomass to the controls. miR156 transcript abundance of field-grown plants was congruent with greenhouse results. The five miR156 SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) target genes had suppressed expression in one or more of the transgenic lines. Line T27, which had the highest miR156 overexpression, showed significant downregulation for all five SPL genes. On the contrary, line T35 had the lowest miR156 overexpression and had no significant change in any of the five SPL genes. CONCLUSIONS: Because of the research field's geographical features, this study was the first instance of any genetically engineered trait in switchgrass, in which experimental plants were allowed to flower in the field in the eastern U.S.; USDA-APHIS-BRS regulators allowed open flowering. We found that medium overexpression of miR156, e.g., line T37, resulted in delayed and reduced flowering accompanied by high biomass production. We propose that induced miR156 expression could be further developed as a transgenic switchgrass bioconfinement tool to enable eventual commercialization.

Pollen-mediated gene flow from transgenic to non-transgenic switchgrass (Panicum virgatum L.) in the field.

BACKGROUND: Switchgrass is C4 perennial grass species that is being developed as a cellulosic bioenergy feedstock. It is wind-pollinated and considered to be an obligate outcrosser. Genetic engineering has been used to alter cell walls for more facile bioprocessing and biofuel yield. Gene flow from transgenic cultivars would likely be of regulatory concern. In this study we investigated pollen-mediated gene flow from transgenic to nontransgenic switchgrass in a 3-year field experiment performed in Oliver Springs, Tennessee, U.S.A. using a modified Nelder wheel design. The planted area (0.6 ha) contained sexually compatible pollen source and pollen receptor switchgrass plants. One hundred clonal switchgrass 'Alamo' plants transgenic for an orange-fluorescent protein (OFP) and hygromycin resistance were used as the pollen source; whole plants, including pollen, were orange-fluorescent. To assess pollen movement, pollen traps were placed at 10 m intervals from the pollen-source plot in the four cardinal directions extending to 20 m, 30 m, 30 m, and 100 m to the north, south, west, and east, respectively. To assess pollination rates, nontransgenic 'Alamo 2' switchgrass clones were planted in pairs adjacent to pollen traps. RESULTS: In the eastward direction there was a 98% decrease in OFP pollen grains from 10 to 100 m from the pollen-source plot (Poisson regression, F1,8 = 288.38, P < 0.0001). At the end of the second and third year, 1,820 F1 seeds were collected from pollen recipient-plots of which 962 (52.9%) germinated and analyzed for their transgenic status. Transgenic progeny production detected in each pollen-recipient plot decreased with increased distance from the edge of the transgenic plot (Poisson regression, F1,15 = 12.98, P < 0.003). The frequency of transgenic progeny detected in the eastward plots (the direction of the prevailing wind) ranged from 79.2% at 10 m to 9.3% at 100 m. CONCLUSIONS: In these experiments we found transgenic pollen movement and hybridization rates to be inversely associated with distance. However, these data suggest pollen-mediated gene flow is likely to occur up to, at least, 100 m. This study gives baseline data useful to determine isolation distances and other management practices should transgenic switchgrass be grown commercially in relevant environments.

Light and temperature effects on miR156 transgenic switchgrass flowering: A simulated latitudinal study.

The control of flowering in perennial grasses is an important trait, especially among biofuel feedstocks. Lignocellulosic biomass may be increased commensurate with decreased or delayed flowering as the plant allocates energy for stems and leaves harvested for bioenergy at the end of the growing season. For transgenic feedstocks, such as switchgrass (Panicum virgatum L.) grown in its geographic center of distribution, it is foreseeable that regulators may require greatly decreased gene flow frequencies to enable commercialization. Transgenic switchgrass with various overexpression levels of a rice microRNA gene, miR156, when grown in field conditions, holds promise for decreased flowering, yielding high biomass, and altered cell wall traits, which renders it as a potential crossing partner for further breeding with switchgrass lines for decreased recalcitrance. In the current research, we simulated a latitudinal cline in controlled growth chamber experiments for various individual sites from the tropics to cool-temperate conditions which included weekly average high and low temperatures and day lengths over the switchgrass growing season for each simulated site: Guayaquil, Ecuador; Laredo, Texas, USA; and Brattleboro, Vermont, USA. Flowering and reproduction among transgenic lines with low (T-14 and T-35)-to-moderate (T-27 and T-37) overexpression of miR156 were assessed. Lower simulated latitudes (higher temperatures with low-variant day length) and long growing seasons promoted flowering of the miR156 transgenic switchgrass lines. Tropical conditions rescued the flowering phenotype in all transgenic lines except T-27. Higher numbers of plants in lines T-35 and T-37 and the controls produced panicles, which also occurred earlier in the study as temperatures increased and day length decreased. Line T-14 was the exception as more clonal replicates flowered in the cool-temperate (Vermont) conditions. Increased biomass was found in transgenic lines T-35 and T-37 in tropical conditions. No difference in biomass was found in subtropical (Texas) chambers, and two lines (T-14 and T-35) produced less biomass than the control in cool-temperate conditions. Our findings suggest that switchgrass plants engineered to overexpress miR156 for delayed flowering to promote bioconfinement and biomass production may be used for plant breeding at tropical sites.

Engineered selective plant male sterility through pollen-specific expression of the EcoRI restriction endonuclease.

Unintended gene flow from transgenic plants via pollen, seed and vegetative propagation is a regulatory concern because of potential admixture in food and crop systems, as well as hybridization and introgression to wild and weedy relatives. Bioconfinement of transgenic pollen would help address some of these concerns and enable transgenic plant production for several crops where gene flow is an issue. Here, we demonstrate the expression of the restriction endonuclease EcoRI under the control of the tomato pollen-specific LAT52 promoter is an effective method for generating selective male sterility in Nicotiana tabacum (tobacco). Of nine transgenic events recovered, four events had very high bioconfinement with tightly controlled EcoRI expression in pollen and negligible-to-no expression other plant tissues. Transgenic plants had normal morphology wherein vegetative growth and reproductivity were similar to nontransgenic controls. In glasshouse experiments, transgenic lines were hand-crossed to both male-sterile and emasculated nontransgenic tobacco varieties. Progeny analysis of 16 000-40 000 seeds per transgenic line demonstrated five lines approached (>99.7%) or attained 100% bioconfinement for one or more generations. Bioconfinement was again demonstrated at or near 100% under field conditions where four transgenic lines were grown in close proximity to male-sterile tobacco, and 900-2100 seeds per male-sterile line were analysed for transgenes. Based upon these results, we conclude EcoRI-driven selective male sterility holds practical potential as a safe and reliable transgene bioconfinement strategy. Given the mechanism of male sterility, this method could be applicable to any plant species.

'Fukusensor:' a genetically engineered plant for reporting DNA damage in response to gamma radiation.

Transgenic plants can be designed to be 'phytosensors' for detection of environmental contaminants and pathogens. In this study, we describe the design and testing of a radiation phytosensor in the form of green fluorescence protein (GFP)-transgenic Arabidopsis plant utilizing a DNA repair deficiency mutant background as a host. Mutant lines of Arabidopsis AtATM (At3g48190), which are hypersensitive to gamma irradiation, were used to generate stable GFP transgenic plants in which a gfp gene was under the control of a strong constitutive CaMV 35S promoter. Mutant and nonmutant genetic background transgenic plants were treated with 0, 1, 5, 10 and 100 Gy radiation doses, respectively, using a Co-60 source. After 1 week, the GFP expression levels were drastically reduced in young leaves of mutant background plants (treated by 10 and 100 Gy), whereas there were scant visible differences in the fluorescence of the nonmutant background plants. These early results indicate that transgenic plants could serve in a relevant sensor system to report radiation dose and the biological effects to organisms in response to radionuclide contamination.

Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters.

Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co-expressed soybean genes that were selected from six reported microarray studies involving a compatible soybean-SCN interaction. A total of 116 overlapping motif regions (OMRs) were discovered bioinformatically that were identified by at least four out of seven bioinformatic tools. Using synthetic promoters, the inducibility of each OMR or motif itself was evaluated by co-localization of gain of function of an orange fluorescent protein reporter and the presence of SCN in transgenic soybean hairy roots. Among 16 OMRs detected from two experimentally confirmed SCN-inducible promoters, 11 OMRs (i.e. 68.75%) were experimentally confirmed to be SCN-inducible, leading to the discovery of 23 core motifs of 5- to 7-bp length, of which 14 are novel in plants. We found that a combination of the three best tools (i.e. SCOPE, W-AlignACE and Weeder) could detect all 23 core motifs. Thus, this strategy is a high-throughput approach for de novo motif discovery in soybean and offers great potential for novel motif discovery and synthetic promoter engineering for any plant and trait in crop biotechnology.

The performance of pathogenic bacterial phytosensing transgenic tobacco in the field.

Phytosensors are useful for rapid-on-the-plant detection of contaminants and agents that cause plant stress. Previously, we produced a series of plant pathogen-inducible synthetic promoters fused to an orange fluorescent protein (OFP) reporter gene and transformed them into tobacco and Arabidopsis thaliana plants; in these transgenic lines, an OFP signal is expressed commensurate with the presence of plant pathogens. We report here the results of 2 years of field experiments using a subset of these bacterial phytosensing tobacco plants. Time-course analysis of field-grown phytosensors showed that a subset of plants responded predictably to treatments with Pseudomonas phytopathogens. There was a twofold induction in the OFP fluorescence driven by two distinct salicylic acid-responsive synthetic promoters, 4 × PR1 and 4 × SARE. Most notably, transgenic plants containing 4 × PR1 displayed the earliest and highest OFP induction at 48 and 72 h postinoculation (h p.i.) upon inoculation with two phytopathogens Pseudomonas syringae pv. tomato and P. syringae pv. tabaci, respectively. These results demonstrate transgenic tobacco harbouring a synthetic inducible promoter-driven OFP could be used to facilitate monitoring and early-warning reporting of phytopathogen infections in agricultural fields.