First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity.

Tomato is an important vegetable in the United States and around the world. Recently, tomato brown rugose fruit virus (ToBRFV), an emerging tobamovirus, has impacted tomato crops worldwide and can result in fruit loss. ToBRFV causes severe symptoms, such as mosaic, puckering, and necrotic lesions on leaves; other symptoms include brown rugose and marbling on fruits. More importantly, ToBRFV can overcome resistance in tomato cultivars carrying the Tm-22 locus. In this study, we recovered ToBRFV sequences from tomato seeds, leaves, and fruits from the U.S., Mexico, and Peru. Samples were pre-screened using a real-time RT-PCR assay prior to high-throughput sequencing. Virus draft genomes from 22 samples were assembled and analyzed against more than 120 publicly available genomes. Overall, most sequenced isolates were similar to each other and did not form a distinct population. Phylogenetic analysis revealed three clades within the ToBRFV population. Most of the isolates (95%) clustered in clade 3. Genetic analysis revealed differentiation between the three clades indicating minor divergence occurring. Overall, pairwise identity showed limited genetic diversity among the isolates in this study with worldwide isolates, with a pairwise identity ranging from 99.36% and 99.97%. The overall population is undergoing high gene flow and population expansion with strong negative selection pressure at all ToBRFV genes. Based on the results of this study, it is likely that the limited ToBRFV diversity is associated with the rapid movement and eradication of ToBRFV-infected material between countries.

First report of the hibiscus strain of citrus leprosis virus C2 infecting passionfruit (Passiflora edulis).

In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Genome Resources of Four Distinct Pathogenic Races Within Fusarium oxysporum f. sp. vasinfectum that Cause Vascular Wilt Disease of Cotton.

Whole genome sequence (WGS) based identifications are being increasingly used by regulatory and public health agencies to facilitate the detection, investigation, and control of pathogens and pests. Fusarium oxysporum f. sp. vasinfectum is a significant vascular wilt pathogen of cultivated cotton and consists of several pathogenic races that are not each other's closest phylogenetic relatives. We have developed WGS assemblies for isolates of F. oxysporum f. sp. vasinfectum race 1 (FOV1), race 4 (FOV4), race 5 (FOV5), and race 8 (FOV8) using a combination of Nanopore (MinION) and Illumina sequencing technology (Mi-Seq). This resulted in assembled contigs with more than 100× coverage for each of the F. oxysporum f. sp. vasinfectum races and estimated genome sizes of FOV1 52 Mb, FOV4 68 Mb, FOV5 68 Mb, and FOV8 55 Mb. The AUGUSTUS gene prediction program predicted 16,263 genes in FOV1, 20,259 genes in FOV4, 20,375 genes in FOV5 and 16,615 genes in FOV8. We were able to identify 525 genes unique to FOV1, 570 unique to FOV4, 1,242 unique to FOV5, and 383 unique to FOV8. We expect that these findings will help in comparative genomics and in the identification of unique genes as candidate targets for diagnostic marker and methods development to permit rapid differentiation of F. oxysporum f. sp. vasinfectum subgroups.

Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in Mexico.

The genus Dichorhavirus contains viruses with bipartite, negative-sense, single-stranded RNA genomes that are transmitted by flat mites to hosts that include orchids, coffee, the genus Clerodendrum, and citrus. A dichorhavirus infecting citrus in Mexico is classified as a citrus strain of orchid fleck virus (OFV-Cit). We previously used RNA sequencing technologies on OFV-Cit samples from Mexico to develop an OFV-Cit-specific reverse transcription PCR (RT-PCR) assay. During assay validation, OFV-Cit-specific RT-PCR failed to produce an amplicon from some samples with clear symptoms of OFV-Cit. Characterization of this virus revealed that dichorhavirus-like particles were found in the nucleus. High-throughput sequencing of small RNAs from these citrus plants revealed a novel citrus strain of OFV, OFV-Cit2. Sequence comparisons with known orchid and citrus strains of OFV showed variation in the protein products encoded by genome segment 1 (RNA1). Strains of OFV clustered together based on host of origin, whether orchid or citrus, and were clearly separated from other dichorhaviruses described from infected citrus in Brazil. The variation in RNA1 between the original (now OFV-Cit1) and the new (OFV-Cit2) strain was not observed with genome segment 2 (RNA2), but instead, a common RNA2 molecule was shared among strains of OFV-Cit1 and -Cit2, a situation strikingly similar to OFV infecting orchids. We also collected mites at the affected groves, identified them as Brevipalpus californicus sensu stricto, and confirmed that they were infected by OFV-Cit1 or with both OFV-Cit1 and -Cit2. OFV-Cit1 and -Cit2 have coexisted at the same site in Toliman, Queretaro, Mexico since 2012. OFV strain-specific diagnostic tests were developed.

Complete Nucleotide Sequence of a Novel Hibiscus-Infecting Cilevirus from Florida and Its Relationship with Closely Associated Cileviruses.

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of hibiscus-infecting cilevirus (HiCV) was determined by Sanger sequencing. The movement and coat protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HI (Hawaii) isolate.

Development and Comparison of TaqMan-Based Real-Time PCR Assays for Detection and Differentiation of Ralstonia solanacearum strains.

Bacterial wilt caused by Ralstonia solanacearum is destructive to many plant species worldwide. The race 3 biovar 2 (r3b2) strains of R. solanacearum infect potatoes in temperate climates and are listed as select agents by the U.S. government. TaqMan-based real-time quantitative PCR (qPCR) is commonly used in federal and state diagnostic laboratories over conventional PCR due to its speed and sensitivity. We developed the Rs16S primers and probe set and compared it with a widely used set (RS) for detecting R. solanacearum species complex strains. We also developed the RsSA3 primers and probe set and compared it with the previously published B2 and RsSA2 sets for specific detection of r3b2 strains. Both comparisons were done under standardized qPCR master mix and cycling conditions. The Rs16S and RS assays detected all 90 R. solanacearum species complex strains and none of the five outgroups, but the former was more sensitive than the latter. For r3b2 strain detection, the RsSA2 and RsSA3 sets specifically detected the 34 r3b2 strains and none of the 56 R. solanacearum non-r3b2 strains or out-group strains. The B2 set, however, detected five non-r3b2 R. solanacearum strains and was less sensitive than the other two sets under the same testing conditions. We conclude that the Rs16S, RsSA2, and RsSA3 sets are best suited under the standardized conditions for the detection of R. solanacearum species complex and r3b2 strains by TaqMan-based qPCR assays.

Real-Time PCR for Detection and Identification of Anguina funesta, A. agrostis, A. tritici, and A. pacificae.

A number of seed, leaf, and stem gall nematodes are of significance to the forage and landscape grass and livestock industries. In North America, the bentgrass nematode, Anguina agrostis, reduces seed production on Agrostis tenuis and several other grass species. Anguina funesta is a seed-gall nematode that is most significant for its association with the toxigenic bacteria Rathayibacter toxicus. The wheat seed gall nematode A. tritici causes significant damage to wheat and other cereals; although it has been found in many countries worldwide, it has not been detected in the United States since 1975. Molecular methods based upon sequence variation in the ribosomal internal spacer region are useful for accurate identification of Anguina spp. Described herein are new species-specific primers and TaqMan probes for real-time polymerase chain reaction (PCR) identification of A. agrostis, A. funesta, A. tritici, and A. pacificae. Primer and probe combinations were each specific for the intended species and were sensitive enough to detect as few as 1.25 copies of nematode ribosomal DNA. PCR was also specific and sensitive in duplex assays that included genus-specific internal control primers as well as species-specific primers and probes. These standardized real-time PCR protocols should facilitate fast and accurate identification of Anguina spp. by diagnostic laboratories.

Identification and Molecular Characterization of Nuclear Citrus leprosis virus, a Member of the Proposed Dichorhavirus Genus Infecting Multiple Citrus Species in Mexico.

Citrus leprosis is one of the most destructive diseases of Citrus spp. and is associated with two unrelated virus groups that produce particles primarily in either the cytoplasm or nucleus of infected plant cells. Symptoms of leprosis, including chlorotic spots surrounded by yellow haloes on leaves and necrotic spots on twigs and fruit, were observed on leprosis-affected mandarin and navel sweet orange trees in the state of Querétaro, Mexico. Serological and molecular assays showed that the cytoplasmic types of Citrus leprosis virus (CiLV-C) often associated with leprosis symptomatic tissues were absent. However, using transmission electron microscopy, bullet-shaped rhabdovirus-like virions were observed in the nuclei and cytoplasm of the citrus leprosis-infected leaf tissues. An analysis of small RNA populations from symptomatic tissue was carried out to determine the genome sequence of the rhabdovirus-like particles observed in the citrus leprosis samples. The complete genome sequence showed that the nuclear type of CiLV (CiLV-N) present in the samples consisted of two negative-sense RNAs: 6,268-nucleotide (nt)-long RNA1 and 5,847-nt-long RNA2, excluding the poly(A) tails. CiLV-N had a genome organization identical to that of Orchid fleck virus (OFV), with the exception of shorter 5' untranslated regions in RNA1 (53 versus 205 nt) and RNA2 (34 versus 182 nt). Phylogenetic trees constructed with the amino acid sequences of the nucleocapsid (N) and glycoproteins (G) and the RNA polymerase (L protein) showed that CiLV-N clusters with OFV. Furthermore, phylogenetic analyses of N protein established CiLV-N as a member of the proposed genus Dichorhavirus. Reverse-transcription polymerase chain reaction primers for the detection of CiLV-N were designed based on the sequence of the N gene and the assay was optimized and tested to detect the presence of CiLV-N in both diseased and symptom-free plants.

Genome assembly of citrus leprosis virus nuclear type reveals a close association with orchid fleck virus.

The complete genome of citrus leprosis virus nuclear type (CiLV-N) was identified by small RNA sequencing utilizing leprosis-affected citrus samples collected from the state of Querétaro, Mexico. The nucleotide identity and phylogenetic analysis indicate that CiLV-N is very closely related to orchid fleck virus, which typically infects Cymbidium species.

Multiplex Real-Time PCR Assays for the Identification of the Potato Cyst and Tobacco Cyst Nematodes.

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCNs) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time polymerase chain reaction (PCR). One tube contained a primer-probe set specific for G. pallida (pale potato cyst nematode) multiplexed with another primer-probe set specific for G. rostochiensis (golden potato cyst nematode). A second tube consisted of the G. pallida-specific primer-probe set multiplexed with a primer-probe set specific for G. tabacum (the morphologically similar tobacco cyst nematode). This internal transcribed spacer rDNA-based system was specific for the Globodera spp. of interest and successfully identified several populations of PCN. This rapid, sensitive, and specific quantitative PCR assay presents a useful tool for PCN regulatory response and management programs.

Immunodiagnosis of Prune dwarf virus using antiserum produced to its recombinant coat protein.

Certification represents the first line of defense against fruit tree viruses. For certification or surveys dealing with large number of samples, ELISA is still considered the technique of choice and requires a continuous supply of good quality antibodies. Prune dwarf virus (PDV) is among the major viruses affecting stone fruits; it belongs to the genus Ilarvirus named so for its isometric labile particles. Recombinant DNA technology was investigated for production of PDV antiserum to avoid labile virus purification and virus maintenance problems. The PDV coat protein gene (CP) was cloned into a protein expression bacterial plasmid vector which allowed a good level of expression of up to 2mg native protein/L culture. The recombinant PDV CP was injected into rabbits and the crude antiserum was successfully used in indirect ELISA at dilutions of up to 1:5000 to detect PDV in infected leaf samples. Similar results were obtained in dot blot immunoassays (DBIA). The antibodies were used in double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and results were comparable to a reference commercial kit. The crude antiserum was efficiently used for coating ELISA plates, thereby reducing test costs.