[Primary central nervous system lymphoma: clinical experience in a neurological center]. / Linfoma primario del sistema nervioso central: experiencia clinica en un centro neurologico.

INTRODUCTION: Primary lymphoma of the central nervous system is a variety of non-Hodgkin's lymphoma that accounts for 4-5% of intracranial tumours and 5% of all lymphomas. It has its origin in the brain, the eyes, the leptomeninges and the spinal cord with no systemic evidence of lymphomatoid activity; the subtype of lymphoma is predominantly of B-type cells. PATIENTS AND METHODS: We conducted a descriptive study of the patients diagnosed with primary brain lymphoma who were attended to at third-level centres in Mexico between the years 1980 and 2016. Patients who had been screened for systemic lymphoma were included. The results were analysed by means of simple frequencies, and disease-free and overall survival time was analysed by Kaplan-Meier curves; the differences among curves were analysed by means of log rank. RESULTS: Of a total of 215 patients, there were only 74 cases. By sex, 45% were females and 55% were males. Regarding age, 36.7% were over 60 years old. The most frequent clinical manifestations were motor loss (60%) and cognitive disorders (52%). Most patients received some form of chemotherapy (89%). The only significant factor for radiological response and clinical prognosis was the combined use of radiochemotherapy (p = 0.04493). CONCLUSION: Lymphoma is a tumorous condition with a high clinicoradiological response to treatment, although the response is not long-lasting. Its early identification and multidisciplinary management are essential for a more favourable prognosis in these patients.

TITLE: Linfoma primario del sistema nervioso central: experiencia clinica en un centro neurologico.Introduccion. El linfoma primario del sistema nervioso central es una variedad de linfoma no Hodgkin que representa el 4-5% de los tumores intracraneales y el 5% de todos los linfomas. Se origina en el encefalo, los ojos, la leptomeninge y la medula espinal sin evidencia sistemica de actividad linfomatoide; el subtipo de linfoma mayoritariamente es de celulas de tipo B. Pacientes y metodos. Estudio descriptivo de los pacientes diagnosticados con linfoma cerebral primario que fueron atendidos en centros de tercer nivel en Mexico entre los años 1980 y 2016. Se incluyo a los pacientes que contaran con cribado para busqueda de linfoma sistemico. Los resultados se analizaron mediante frecuencias simples; en el caso del tiempo libre de enfermedad y supervivencia global, mediante curvas de Kaplan-Meier, y las diferencias entre curvas, mediante log rank. Resultados. En un total de 215 pacientes solo hubo 74 casos. El 45% fueron mujeres y el 55%, hombres. El 36,7% eran mayores de 60 años. Las manifestaciones clinicas mas frecuentes fueron deficit motor (60%) y alteraciones cognitivas (52%). La mayoria recibio alguna forma de quimioterapia (89%). El unico factor significativo para respuesta radiologica y pronostico clinico era el uso combinado de radioquimioterapia (p = 0,04493). Conclusion. El linfoma representa una patologia tumoral con alta respuesta clinicorradiologica al tratamiento, aunque la respuesta no es duradera. Es fundamental su identificacion temprana y el tratamiento multidisciplinario para el mejor pronostico de estos pacientes.

Radiotherapy plus temozolomide or PCV in patients with anaplastic oligodendroglioma 1p19q codeleted. / Radioterapia mas temozolomida o PCV en pacientes con oligodendroglioma anaplasico con codelecion 1p19q.

INTRODUCTION: Radiotherapy with procarbazine, lomustine, and vincristine (PCV) improves overall survival in patients with anaplastic oligodendroglioma 1p19q codeleted. PATIENTS AND METHODS: This retrospective analysis investigated outcomes in patients with anaplastic oligodendroglioma 1p19q codeleted compared two different protocols (radiotherapy plus temozolomide or PCV). The primary end points were overall survival and progression-free survival. Secondary endpoint was the radiological response. RESULTS: A total of 48 patients were included. Mean age was 43 years (range: 19-66 years), 26 were male (54.1%). Twenty-one patients received PCV and 27 temozolomide. The baseline characteristics were not difference between the groups. The progression-free survival and overall survival in the PCV group were 7.2 and 10.6 years respectively and temozolomide were 6.1 and 9.2 years, both statistically significant. The radiological response was present in 80.9% in PCV arm and 70.2% in temozolomide arm there was not statistical differences. The multivariate Cox model showed only the significant parameters the use of PCV protocol. The toxicity grade 3 or 4 was present in 42.8% in PCV arm and 11.1% in temozolomide arm. CONCLUSIONS: The most common strategy in the Latin America community is the substitution of the PCV for temozolomide. This retrospective study showed superior efficacy of PCV than temozolomide. The Latin American community effort must be made to be able to have the drugs to available for using as a first line of treatment.

TITLE: Radioterapia mas temozolomida o PCV en pacientes con oligodendroglioma anaplasico con codelecion 1p19q.Introduccion. La radioterapia con procarbacina, lomustina y vincristina (PCV) mejora la supervivencia global en pacientes con oligodendroglioma anaplasico con codelecion 1p19q, pero no esta disponible en America Latina. Pacientes y metodos. Analisis retrospectivo comparando dos protocolos diferentes, radioterapia mas temozolomida o PCV, en pacientes con oligodendroglioma anaplasico con codelecion 1p19q. Los objetivos primarios fueron la supervivencia global y la supervivencia libre de progresion, y el objetivo secundario, la respuesta radiologica. Resultados. Se incluyo a 48 pacientes, 26 de ellos varones (54,1%), con una edad media de 43 años (rango: 19-66 años). Veintiun pacientes recibieron PCV, y 27, temozolomida. Las caracteristicas iniciales no tuvieron diferencias entre los grupos. La supervivencia libre de progresion y la supervivencia global en el grupo con PCV fueron de 7,2 y 10,6 años, y en el grupo de temozolomida, de 6,1 y 9,2 años, respectivamente, unos resultados estadisticamente significativos. Hubo respuesta radiologica en el 80,9% en el brazo de PCV y el 70,2% en el brazo de temozolomida. El analisis multivariado de Cox mostro como unico parametro significativo el uso del protocolo PCV. El grado de toxicidad 3-4 estuvo presente en el 42,8% en el brazo de PCV y en el 11,1% en el brazo de temozolomida. Conclusiones. La estrategia mas comun en America Latina es la sustitucion de PCV por temozolomida. Este estudio retrospectivo mostro una eficacia superior de PCV que de la temozolomida. La diferencia obliga a la comunidad latinoamericana a hacer un esfuerzo colectivo para poder tener acceso a los medicamentos para su uso como primera linea de tratamiento.

Automated speech analysis tools for children's speech production: A systematic literature review.

PURPOSE: A systematic search and review of published studies was conducted on the use of automated speech analysis (ASA) tools for analysing and modifying speech of typically-developing children learning a foreign language and children with speech sound disorders to determine (i) types, attributes, and purposes of ASA tools being used; (ii) accuracy against human judgment; and (iii) performance as therapeutic tools. METHOD: Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were applied. Across nine databases, 32 articles published between January 2007 and December 2016 met inclusion criteria: (i) focussed on children's speech; (ii) tools used for speech analysis or modification; and (iii) reporting quantitative data on accuracy. RESULT: Eighteen ASA tools were identified. These met the clinical threshold of 80% agreement with human judgment when used as predictors of intelligibility, impairment severity, or error category. Tool accuracy was typically <80% accuracy for words containing mispronunciations. ASA tools have been used effectively to improve to children's foreign language pronunciation. CONCLUSION: ASA tools show promise for automated analysis and modification of children's speech production within assessment and therapeutic applications. Further work is needed to train automated systems with larger samples of speech to increase accuracy for assessment and therapeutic feedback.

Determinants of renal and patient outcomes in a Spanish cohort of patients with ANCA-associated vasculitis and renal involvement.

The classification of anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) remains controversial. The main objective of this study was to define the respective values of ANCA serotype-based classification, clinicopathological classification, and histopathological classification in predicting patient and renal outcomes in a Spanish cohort of patients with ANCA with specificity for myeloperoxidase, MPO-ANCA, versus ANCA with specificity for proteinase 3, PR3-ANCA. Two hundred and forty-five patients with ANCA-AAV and biopsy-proven renal involvement diagnosed between 2000 and 2104 were recruited in 12 nephrology services. Clinical and histologic data, renal outcomes, and mortality were analyzed. We applied the Chapel Hill Consensus Conference definition with categories for granulomatosis with the polyangiitis (GPA) and microscopic polyangiitis (MPA), the classification based on ANCA specificity, and the histopathological classification proposed in 2010. Eighty-two percent were MPO-ANCA positive and 18.0% PR3-ANCA positive. Altogether, 82.9% had MPA and 17.1% GPA. The median follow-up was 43.2 months (0.1-169.3). Neither ANCA-based serological nor clinical classification was predictive of renal outcomes or patient survival on bivariate or multivariate Cox regression analysis. Histopathological classification was found to predict development of end-stage renal disease (p = 0.005) in Kaplan-Meier analysis. ANCA specificity was more predictive of relapse than clinicopathological classification in multivariate analysis (HR 2.086; 95% CI 1.046-4.158; p = 0.037). In our Spanish cohort, a majority of patients had an MPO-ANCA-AAV. A classification based on ANCA specificity has a higher predictive value for relapse occurrence and could be used for decision-making with respect to induction treatment and maintenance therapies.

Calpain-10 gene polymorphisms and risk of type 2 diabetes mellitus in Mexican mestizos.

The calpain-10 gene is expressed primarily in tissues important in glucose metabolism; thus, some of its polymorphisms have been associated with type 2 diabetes. In this study, we examined the association between the calpain-10 single-nucleotide polymorphism (SNP)-43, SNP-19, and SNP-63 and type 2 diabetes in Mexican mestizos. We included 211 patients and 152 non-diabetic subjects. Polymerase chain reaction was used to identify alleles. We compared allele, genotype, haplotype, and diplotype frequencies between both groups and used the chi-square test to calculate the risk. The allele frequency of SNP-43 allele 1 was 70% in controls and 72% in patients; the GG, GA, and AA genotype frequencies were 48.7, 42.8, and 8.5% in controls and 51.2, 41.7, and 7.1% in patients, respectively. For SNP- 19, the prevalence of allele 1 (2R) was 32% in controls and 39% in patients. In controls, homozygosity (2R/2R) was 10.5%, heterozygosity was 42.8%, and 3R/3R was 46.7%; in cases, these values were 13.3, 50.7, and 36.0%, respectively. For SNP-63, the frequency of allele 1 was 87% in controls and 83% in patients; genotype frequencies in controls were 75.7% (CC), 23% (CT), and 1.3% (TT), and were 69.7, 27.5, and 2.8%, respectively for the cases. Genotype distributions were consistent with Hardy-Weinberg equilibrium. No significant intergroup differences for allele, genotype, haplotype, or diplotype frequencies were observed. We found no association between these polymorphisms and diabetes. However, our sample size was small, so the role of calpain-10 risk alleles should be further examined.

[Midfemoral nerve block for foot surgery: is there an anatomical-clinical correlation between motor response and latency?]. / Bloqueo mediofemoral para cirugía de pie: existe relación entre la respuesta motora y la latencia? Correlación anatomoclínica.

BACKGROUND AND OBJECTIVE: The latency times of midfemoral sciatic nerve blocks vary greatly. This study investigated the correlation between the type of motor response to nerve stimulation on the one hand and latency and block efficacy on the other. PATIENTS AND METHODS: We enrolled 215 consecutive patients (184 women) undergoing orthopedic foot surgery. A tourniquet was applied above the malleolus. The puncture location was found by palpating to locate the groove between the vastus lateralis and biceps femoris muscles, at the mid-point of the line between the posterior edge of the greater trochanter muscle and the insertion of the biceps femoris muscle in the popliteal fossa. A solution of equal proportions (1:1) of 1.5% mepivacaine (with bicarbonate 1:10) and 0.75% levobupivacaine was injected at a dose of 0.45 mL x kg(-1) (maximum 40 mL) using a 10-cm needle. Nerve stimulation was applied at 100-300 ms, 02-0.4 mA, and 2 Hz. Latency was classified as response in less than 15 minutes, in 15 to 30 minutes, or later than 30 minutes. RESULTS: The evoked motor response was inversion in 30 patients, flexion or extension in 38, plantar flexion in 101, dorsiflexion in 37, and eversion in 9. Shorter latencies (15 minutes) were observed in all patients with inversion or flexion/extension and in 84 (83%) of the 101 patients with plantar flexion. Mid-range latencies were observed in 13% of those with a plantar flexion response and in 29.7% of those with dorsiflexion. All 9 patients with eversion and 17 (45.9%) of the 37 patients with dorsiflexion had the longest latencies. The surgical block was complete for all patients. CONCLUSIONS: This approach provides an effective block with minimum latency in patients who have a flexion or extension motor response in the foot and/or fingers, inversion, or plantar flexion, which assumes that the injection has reached the common trunk of the sciatic or tibial nerve. However, a longer latency is associated with a peroneal motor response, particularly eversion.

[Acetate-free on-line PHF: how to improve hyperacetatemia and haemodynamic tolerance]. / PHF on-line sin acetato: cómo mejorar la hiperacetatemia y la tolerancia hemodinámica.

SUMMARY BACKGROUND: The small quantity of acetate present in the dialysis fluid exposes patient's blood to an acetate concentration 30-40 times the physiological levels. This amount is even greater in hemodiafiltration on-line. Our purpose was to evaluate the clinical-analytical effects using three different dialysis techniques in the same patient. METHODS: 35 patients on hemodialysis were included. All patients were treated with conventional bicarbonate dialysate for 3 months, after randomization were switched to first be treated with PHF online with standard bicarbonate dialysate for 6 months and then switched to PHF on-line acetate-free dialysate for the other 6 months or to invert the two last periods. Blood samples were drawn monthly throughout the study and clinical data were obtained. RESULTS: Postdialysis blood acetate levels were higher in patients treated with conventional bicarbonate dialysate with respect to the period of PHF with free-acetate dialysate. Moreover, the percentage of patients with postdialysis blood acetate levels in the pathologic range was higher in patients treated with conventional bicarbonate dialysate respect to PHF on-line acetate-free dialysate period (61% vs. 30%). Serum concentrations of chloride postdialysis were higher and serum concentrations of bicarbonate pre and posthemodialysis were lower in the PHF free-acetate period. The incidence of hypotensive episodes was significantly lower in the PHF on-line with conventional dialysate. CONCLUSIONS: PHF on-line with free-acetate dialysate allows that most of patients finished hemodialysis with blood acetate levels in the physiologic ranges. PHF on-line is a predilutional hemodiafiltration treatment with better tolerance than hemodialysis with standard bicarbonate dialysate.

Radiation doses in the surroundings of patients undergoing nuclear medicine diagnostic studies.

Dose rate measurements were performed at 0, 0.5, and 1 m from the external surface of 79 patients corresponding to the most frequent studies: 99mTc-cardiac with reinjection, 99mTc-cardiac single injection, 99mTc-bone scan, 99mTc-lung studies, and cardiac studies using 201Tl. Doses to staff, nearby patients, and the collective effective doses were estimated for the different working shifts and hospital areas. The estimated dose for nurses for 1 y was 518 microSv in the cardiology section and 338 microSv in the short stay section. For patients, the mean dose per stay was calculated to be 8.5 microSv in the cardiology section. The maximum dose that a patient could receive from a radioactive patient is 499 microSv for a double injection cardiac patient study. The maximum collective effective dose for the whole hospital was calculated to be 0.063 person-Sv. The probability of staff receiving doses higher than the limits for a working day is negligible. Maximum doses for staff and patients are far below dose limits for the public and therefore no additional radiological protection is needed.

Pattern completion through phase coding in population neurodynamics.

This article presents an alternative phase coding mechanism for Freeman's KIII model of population neurodynamics. Motivated by experimental evidence that supports the existence of a neural code based on synchronous oscillations, we propose an analogy between synchronization in neural populations and phase locking in KIII channels. An efficient method is proposed to extract phase differences across granule channels from their state-space trajectories. First, the scale invariance of the KIII model with respect to phase information is established. The phase code is then compared against the conventional amplitude code in terms of their bit-wise and across-fiber pattern recovery capabilities using decision-theoretic principles and a Hamming-distance classifier. Graph isomorphism in the Hebbian connections is exploited to perform an exhaustive evaluation of patterns on an 8-channel KIII model. Simulation results show that phase information outperforms amplitude information in the recovery of incomplete or corrupted stimuli.

Habituation in the KIII olfactory model with chemical sensor arrays.

This paper presents a novel combination of chemical sensors and the KIII model for simulating mixture perception with a habituation process triggered by local activity. Stimuli are generated by partitioning feature space with labeled lines. Pattern completion is demonstrated through coherent oscillations across granule populations using experimental odor mixtures.

Functional determinants of the Escherichia coli fis promoter: roles of -35, -10, and transcription initiation regions in the response to stringent control and growth phase-dependent regulation.

Escherichia coli Fis is a small DNA binding and bending protein that has been implicated in a variety of biological processes. A minimal promoter sequence consisting of 43 bp is sufficient to generate its characteristic growth phase-dependent expression pattern and is also subject to negative regulation by stringent control. However, information about the precise identification of nucleotides contributing to basal promoter activity and its regulation has been scant. In this work, 72 independent mutations were generated in the fis promoter (fis P) region from -108 to +78 using both random and site-directed PCR mutagenesis. beta-Galactosidase activities from mutant promoters fused to the (trp-lac)W200 fusion on a plasmid were used to conclusively identify the sequences TTTCAT and TAATAT as the -35 and -10 regions, respectively, which are optimally separated by 17 bp. We found that four consecutive substitutions within the GC-rich sequence just upstream of +1 and mutations in the -35 region, but not in the -10 region, significantly reduced the response to stringent control. Analysis of the effects of mutations on growth phase-dependent regulation showed that replacing the predominant transcription initiation nucleotide +1C with a preferred nucleotide (A or G) profoundly altered expression such that high levels of fis P mRNA were detected during late logarithmic and early stationary phases. A less dramatic effect was seen with improvements in the -10 and -35 consensus sequences. These results suggest that the acute growth phase-dependent regulation pattern observed with this promoter requires an inefficient transcription initiation process that is achieved with promoter sequences deviating from the -10 and -35 consensus sequences and, more importantly, a dependence upon the availability of the least favored transcription initiation nucleotide, CTP.

A method for evaluating data-preprocessing techniques for odour classification with an array of gas sensors.

The performance of a pattern recognition system is dependent on, among other things, an appropriate data-preprocessing technique, In this paper, we describe a method to evaluate the performance of a variety of these techniques for the problem of odour classification using an array of gas sensors, also referred to as an electronic nose. Four experimental odour databases with different complexities are used to score the data-preprocessing techniques. The performance measure used is the cross-validation estimate of the classification rate of a K nearest neighbor voting rule operating on Fisher's linear discriminant projection subspace.

Identification and characterization of the fis operon in enteric bacteria.

The small DNA binding protein Fis is involved in several different biological processes in Escherichia coli. It has been shown to stimulate DNA inversion reactions mediated by the Hin family of recombinases, stimulate integration and excision of phage lambda genome, regulate the transcription of several different genes including those of stable RNA operons, and regulate the initiation of DNA replication at oriC. fis has also been isolated from Salmonella typhimurium, and the genomic sequence of Haemophilus influenzae reveals its presence in this bacteria. This work extends the characterization of fis to other organisms. Very similar fis operon structures were identified in the enteric bacteria Klebsiella pneumoniae, Serratia marcescens, Erwinia carotovora, and Proteus vulgaris but not in several nonenteric bacteria. We found that the deduced amino acid sequences for Fis are 100% identical in K. pneumoniae, S. marcescens, E. coli, and S. typhimurium and 96 to 98% identical when E. carotovora and P. vulgaris Fis are considered. The deduced amino acid sequence for H. influenzae Fis is about 80% identical and 90% similar to Fis in enteric bacteria. However, in spite of these similarities, the E. carotovora, P. vulgaris, and H. influenzae Fis proteins are not functionally identical. An open reading frame (ORF1) preceding fis in E. coli is also found in all these bacteria, and their deduced amino acid sequences are also very similar. The sequence preceding ORF1 in the enteric bacteria showed a very strong similarity to the E. coli fis P region from -53 to +27 and the region around -116 containing an ihf binding site. Both beta-galactosidase assays and primer extension assays showed that these regions function as promoters in vivo and are subject to growth phase-dependent regulation. However, their promoter strengths vary, as do their responses to Fis autoregulation and integration host factor stimulation.

Deletion analysis of the fis promoter region in Escherichia coli: antagonistic effects of integration host factor and Fis.

Fis is a small DNA-binding and -bending protein in Escherichia coli that is involved in several different biological processes, including stimulation of specialized DNA recombination events and regulation of gene expression. fis protein and mRNA levels rapidly increase during early logarithmic growth phase in response to a nutritional upshift but become virtually undetectable during late logarithmic and stationary phases. We present evidence that the growth phase-dependent fis expression pattern is not determined by changes in mRNA stability, arguing in favor of regulation at the level of transcription. DNA deletion analysis of the fis promoter (fis P) region indicated that DNA sequences from -166 to -81, -36 to -26, and +107 to +366 relative to the transcription start site are required for maximum expression. A DNA sequence resembling the integration host factor (IHF) binding site centered approximately at -114 showed DNase I cleavage protection by IHF. In ihf cells, maximum cellular levels of fis mRNA were decreased more than 3-fold and transcription from fis P on a plasmid was decreased about 3.8-fold compared to those in cells expressing wild-type IHF. In addition, a mutation in the ihf binding site resulted in a 76 and 61% reduction in transcription from fis P on a plasmid in the presence or absence of Fis, respectively. Insertions of 5 or 10 bp between this ihf site and fis P suggest that IHF functions in a position-dependent manner. We conclude that IHF plays a role in stimulating transcription from fis P by interacting with a site centered approximately at -114 relative to the start of transcription. We also showed that although the fis P region contains six Fis binding sites, Fis site II (centered at -42) played a predominant role in autoregulation, Fis sites I and III (centered at +26 and -83, respectively) seemingly played smaller roles, and no role in negative autoregulation could be attributed to Fis sites IV, V, and VI (located upstream of site III). The fis P region from -36 to +7, which is not directly regulated by either IHF or Fis, retained the characteristic fis regulation pattern in response to a nutritional upshift.

[Therapeutic immunoadsorption in Goodpasture disease]. / Inmunoadsorción terapéutica en la enfermedad de Goodpasture.

The extraction of circulating antiglomerular basement membrane (GBM) antibodies by plasmapheresis (PP) has allowed the prognosis of Goodpasture's disease to markedly improve. Immunoabsorption (IA) may improve the results of PP upon allowing more effective immunoglobulin extraction. Two patients with Goodpasture disease were treated with IA. A rapid decrease was observed in the serum levels of anti GBM antibodies and improvement in respiratory failure. In one of the patients this regimen was administered following the observation of a lack of clinical response of pulmonary hemorrhage in three PP sessions (9 liters of treated plasma). In this patient, the IA processed 39 liters of plasma and the method was found to be equally effective on reinstatement (29 liters) on the occasion of a relapse in the pulmonary symptoms presented at three weeks after the first treatment. Both cases showed renal involvement. In one case this was incipient and the treatment was associated with non progression of the kidney disease, normalization of the urine sediment and preservation of renal function. In the second case treatment was initiated at an advanced disease state with no changes in dialysis needs. Immunoadsorption has shown to be effective in the treatment of pulmonary hemorrhage in Goodpasture's disease. Onset of treatment at an early stage of the kidney disease may avoid progression to renal failure.

Sequence, regulation, and functions of fis in Salmonella typhimurium.

The fis operon from Salmonella typhimurium has been cloned and sequenced, and the properties of Fis-deficient and Fis-constitutive strains were examined. The overall fis operon organization in S. typhimurium is the same as that in Escherichia coli, with the deduced Fis amino acid sequences being identical between both species. While the open reading frames upstream of fis have diverged slightly, the promoter regions between the two species are also identical between -49 and +94. Fis protein and mRNA levels fluctuated dramatically during the course of growth in batch cultures, peaking at approximately 40,000 dimers per cell in early exponential phase, and were undetectable after growth in stationary phase. fis autoregulation was less effective in S. typhimurium than that in E. coli, which can be correlated with the absence or reduced affinity of several Fis-binding sites in the S. typhimurium fis promoter region. Phenotypes of fis mutants include loss of Hin-mediated DNA inversion, cell filamentation, reduced growth rates in rich medium, and increased lag times when the mutants are subcultured after prolonged growth in stationary phase. On the other hand, cells constitutively expressing Fis exhibited normal logarithmic growth but showed a sharp reduction in survival during stationary phase. During the course of these studies, the sigma 28-dependent promoter within the hin-invertible segment that is responsible for fljB (H2) flagellin synthesis was precisely located.

Roles of catabolite activator protein sites centered at -81.5 and -41.5 in the activation of the Klebsiella aerogenes histidine utilization operon hutUH.

The Klebsiella aerogenes hutUH operon is preceded by a promoter region, hut(P), that contains two divergent promoters (hutUp and Pc) which overlap and are alternately expressed. In the absence of the catabolite gene activator protein-cyclic AMP (CAP-cAMP) complex, Pc is predominantly expressed while hutUp is largely repressed. CAP-cAMP has the dual effect of repressing transcription from Pc while simultaneously activating transcription from hutUp. DNA deletion mutations in this region were used to identify DNA sequences required for transcription of these two promoters. We showed that inactivation of Pc by DNA deletion did not result in activation of hutUp in vitro or in vivo. In addition, Escherichia coli CAP mutants that are known to bind and bend DNA normally but are unable to activate various CAP-dependent promoters were also unable to activate hutUp in vivo. These results invalidate an indirect activation model by which CAP-mediated repression of Pc in itself would led to activation of hutUp. Gel retardation asays with various deletion mutations of hut(P) and DNase I protection analyses revealed a high-affinity CAP binding site (CAP site 1) centered at -81.5 relative to the hutUp start of transcription and a second low-affinity CAP site (CAP site 2) centered at about -41.5. CAP site 1 is essential for activation of hutUp. Although CAP site 2 by itself is unable to activate hutUp in vivo under catabolite-activating conditions, it appears to be required for maximal transcription from a site centered at -41.5, does not activate hutUp suggests that the role of CAP-cAMP at the weaker CAP site may be different from that of other promoters containing a similarly positioned site. We propose that CAP directly stimulates the activity of RNA polymerase at hutUp and that this reaction is completely dependent on a naturally occurring CAP site centered at -81.5 and also involves a second CAP site centered at about -41.5 for maximal activation.

Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.