Vagal Nerve Stimulation in the Pediatric Population and Correlation Between Family and Treatment Team Perspectives: Single-center Experience.

BACKGROUND: Vagal nerve stimulation (VNS) is an adjunctive therapy to pharmacological treatment in patients with drug-resistant epilepsy. This study aimed to assess the efficacy of VNS therapy for seizure frequency reduction and improving quality of life (QOL) measures in children with refractory epilepsy and to evaluate the correlation between the perspectives of families and those of the treating team. METHODS: This was a prospective cohort study conducted at Abha Maternity and Children's Hospital, Saudi Arabia, from 2018 to 2022. A total of 21 pediatric patients who completed one year of follow-up after VNS implantation were included. Patients were aged between 2 and 14 years, with a mean age of 8.14 ± 3.92; 11 (52.4%) patients were female. Family and physician assessments were collected blinded to each other using Clinical Global Impression of Improvement (CGI-I) scores and QOL assessments to evaluate the correlation between the families' and treating team's perspectives on VNS outcomes. RESULTS: In this study involving 21 patients with intractable epilepsy, VNS showed significant efficacy in reducing the frequency of seizures. VNS significantly reduced the number of seizures per week from a baseline median of 35 to a median of 0.25 at the end of the follow-up period, representing a dramatic reduction of 99.3% (p < 0.001). The number of emergency department visits per year decreased from a baseline median of 12 to a median of 2, a reduction of 83.3% (p < 0.001), whereas the number of hospital admissions per year decreased from a baseline median of 3 to a median of 1, a 66.7% decrease (p < 0.001). The number of antiepileptic medications taken decreased from a median of 4 to 3 (p < 0.001). Notably, 28.57% of the patients achieved complete seizure freedom, and 38% exhibited significant improvement, with at least 50% reduction in seizure frequency. Importantly, none of the patients experienced an escalation in seizure frequency following VNS treatment. The family and physician assessments showed varying degrees of alignment in perceptions, with "concentration" exhibiting a significant positive correlation (r = 0.498, p = 0.022), indicating noteworthy agreement, whereas verbal communication did not show a substantial correlation (r = -0.062, p = 0.791), indicating a divergence of views. CONCLUSION: VNS is a promising and well-tolerated therapy for individuals with intractable seizures, offering clinical benefits and potential enhancements in various aspects of QOL. The varying perceptions between family and physician assessments highlight the importance of considering multiple perspectives when evaluating treatment outcomes.

Lunapark deficiency leads to an autosomal recessive neurodevelopmental phenotype with a degenerative course, epilepsy and distinct brain anomalies.

LNPK encodes a conserved membrane protein that stabilizes the junctions of the tubular endoplasmic reticulum network playing crucial roles in diverse biological functions. Recently, homozygous variants in LNPK were shown to cause a neurodevelopmental disorder (OMIM#618090) in four patients displaying developmental delay, epilepsy and nonspecific brain malformations including corpus callosum hypoplasia and variable impairment of cerebellum. We sought to delineate the molecular and phenotypic spectrum of LNPK-related disorder. Exome or genome sequencing was carried out in 11 families. Thorough clinical and neuroradiological evaluation was performed for all the affected individuals, including review of previously reported patients. We identified 12 distinct homozygous loss-of-function variants in 16 individuals presenting with moderate to profound developmental delay, cognitive impairment, regression, refractory epilepsy and a recognizable neuroimaging pattern consisting of corpus callosum hypoplasia and signal alterations of the forceps minor ('ear-of-the-lynx' sign), variably associated with substantia nigra signal alterations, mild brain atrophy, short midbrain and cerebellar hypoplasia/atrophy. In summary, we define the core phenotype of LNPK-related disorder and expand the list of neurological disorders presenting with the 'ear-of-the-lynx' sign suggesting a possible common underlying mechanism related to endoplasmic reticulum-phagy dysfunction.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Vanishing white matter in Saudi Arabia.

Vanishing white matter disease (VWMD) is an under-diagnosed condition that affects the brains white matter at all ages, especially in the pediatric age group. It belongs to a clinically and genetically heterogeneous group of disorders, collectively known as eukaryotic initiation factor 2B-related disorders. The disorder has been described in different ethnic groups. Here, we describe a case of VWMD from Saudi Arabia.