[Interpretation of expert consensus for progressive collapsing foot deformity].

Adult flatfoot is a common foot deformity, mainly manifested as medial arch collapsing, hindfoot valgus and forefoot abduction. People have a more thorough understanding of the pathological changes and pathogenesis of flatfoot with further research. There is a new expert consensus for adult flatfoot published in Foot & Ankle Inter. in 2020. The expert panel reviewed the latest literature to develop consensus recommendations for flatfoot, including its nomenclature, diagnosis, classification and operative treatment. The consensus represents a new understanding of the disease and a new concept because of the authority of its authors and the comprehensiveness of its content, and it is also a phased summary of the theoretical and clinical progress of adult flatfoot. This article gives a detailed interpretation of the content in the consensus.

Robust Topological Nodal-Line Semimetals from Periodic Vacancies in Two-Dimensional Materials.

A nodal-line semimetal (NLSM) is suppressed in the presence of spin-orbit coupling unless it is protected by a nonsymmorphic symmetry. We show that two-dimensional (2D) materials can realize robust NLSMs when vacancies are introduced on the lattice. As a case study we investigate borophene, a boron honeycomb-like sheet. While the Dirac cones of pristine borophene are shown to be gapped out by spin-orbit coupling and by magnetic exchange, robust nodal lines (NLs) emerge in the spectrum when selected atoms are removed. We propose an effective 2D model and a symmetry analysis to demonstrate that these NLs are topological and protected by a nonsymmorphic glide plane. Our findings offer a paradigm shift to the design of NLSMs: instead of searching for nonsymmorphic materials, robust NLSMs may be realized simply by removing atoms from ordinary symmorphic crystals.

Clinical significance of miR-492 in peripheral blood of acute myocardial infarction.

OBJECTIVE: To detect the potential of microRNA-492 (miR-492) as a diagnostic biomarker of acute myocardial infarction (AMI) in the acute phase. PATIENTS AND METHODS: A total of 100 AMI patients and 100 controls (non-AMI patients with chest pain) were retrospectively analyzed. Blood samples were collected at 0, 6, 12, and 24 h after admission, followed by detection of the serum miR-492 level. Serum levels of cTnI and creatine kinase-MB (CK-MB) in AMI patients were examined by enzyme-linked immunosorbent assay (ELISA). The potential relationship between miR-492 level with cTnI and CK-MB levels was analyzed by Pearson correlation test. Moreover, diagnostic value of miR-492 was assessed by depicting receiver operating characteristic (ROC) curves. RESULTS: Serum level of miR-492 achieved the peak at 6 h after admission, which was time-dependently reduced at 12 h and 24 h.  Serum levels of cTnI and CK-MB were higher in AMI patients than those of controls. However, miR-492 level achieved the peak before cTnI and CK-MB increased to the highest levels. MiR-492 level was positively correlated to cTnI and CK-MB levels. ROC curves verified the diagnostic value of miR-492 in AMI (AUC=0.8621, 95% CI=0.8129-0.9112, sensitivity=80%, specificity=75%). CONCLUSIONS: Serum level of miR-492 remarkably increases in the acute phase of AMI, which may be used as an effective biomarker for diagnosing AMI.

[Investigation into the timely return visit rates after first interview in adolescent clients to the psychiatric outpatient clinic of a general hospital].

Objective: To investigate the timely return visit rates after first visits of adolescent clients to the psychiatric outpatient clinic in a general hospital and analyze the relevant factors. Methods: All adolescent clients firstly visited psychiatric outpatient clinic of the Third Affiliated Hospital of Sun Yat-sen University from May to October 2018 were surveyed. The timely return visit was defined as the return visit within one month after the first visit and the timely return visit rate (RVR) was calculated. Chi-square test and binary Logistic regression were used to compare the RVR subgroup differences and relevant factors. Reasons for non-attendance at the return visit were acquired by the telephone follow-up. Results: A total of 1 121 cases were enrolled, with an age of (16.0±1.6) years, 85.8% of them were students, and the overall RVR was 62.7% (703/1 121). The highest RVR was found in those who hoped for drug treatment (69.8%) and the lowest in those who did not accept drug treatment (55.8%) (χ(2)=9.028, P=0.029). The highest RVR was found in hospitalized patients (97.6%), followed by outpatient pharmacotherapy group (61.2%) and keeping observation and self-adjustment group (45.3%) (χ(2)=82.269, P<0.001). The RVR of patients prescribed mood stabilizers was significantly higher than that of non-users (χ(2)=9.498, P=0.002). Logistic regression analysis showed the main factors that affect the timely return visit included treatment regimens and prescribing of mood stabilizers. Results of telephone follow-up of clients with non-attendance showed that the main reasons were symptoms alleviation (68.4%) and various visiting barriers (14.3%). Conclusions: Clients with active attitude towards pharmacotherapy, hospitalization and using mood stabilizers in outpatient have higher RVR rates. Insufficient understanding of systemic therapy remains the main reason why the clients fail to attend the return visit in time.

KCNMA1-AS1 attenuates apoptosis of epithelial ovarian cancer cells and serves as a risk factor for poor prognosis of epithelial ovarian cancer.

OBJECTIVE: To explore the role of KCNMA1-AS1 in epithelial ovarian cancer (EOC) and its underlying mechanism. PATIENTS AND METHODS: We first screened out the differentially expressed lncRNAs (KCNMA1-AS1) in the GEO (gene expression omnibus) database. The relationship between KCNMA1-AS1 expression and prognosis of EOC with different pathological types was analyzed by meta-analysis. Subsequently, KCNMA1-AS1 expressions in EOC tissues and normal ovarian tissues were detected by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). The correlation between KCNMA1-AS1 level with progression-free survival (PFS) and overall survival (OS) of EOC was analyzed. Furthermore, proliferation and migration of EOC cells transfected with the corresponding plasmids were analyzed by Cell Counting Kit-8 (CCK-8) and transwell assay, respectively. Apoptosis-related genes in EOC cells were detected by Western blot. RESULTS: KCNMA1-AS1 was a risk factor for prognosis in high-grade, advanced and serous EOC. Upregulated KCNMA1-AS1 was found in EOC tissues than that of normal tissues, showing the diagnostic potential of KCNMA1-AS1 in EOC. Statistical analysis indicated that KCNMA1-AS1 was not correlated with the DFS, OS, age, histological type, lymph node metastasis and recurrence, but related to FIGO stage of EOC patients. For in vitro experiments, the proliferation and migration of were enhanced, and apoptosis of HO8910 cells overexpressing KCNMA1-AS1 was inhibited. Furthermore, elevated expressions of Caspase-3 and Caspase-9, as well as reduced expression of Bcl-xL, were observed after KCNMA1-AS1 knockdown in EOC cells. CONCLUSIONS: KCNMA1-AS1 is overexpressed in EOC and negatively correlated with its prognosis. KCNMA1-AS1 participates in the occurrence and development of EOC by promoting proliferation, migration and inhibiting apoptosis of ovarian cancer cells via apoptosis pathway.

Pharmacologic therapy to induce weight loss in women who have obesity/overweight with polycystic ovary syndrome: a systematic review and network meta-analysis.

BACKGROUND: Women with polycystic ovary syndrome (PCOS) are almost three times more likely to be obese than those without PCOS. However, we have no specific interventions to induce weight loss so far and rely on drugs used to treat other symptoms of the syndrome or obesity in the general population. OBJECTIVE: The objective of this study is to compare the effectiveness of metformin, inositol, liraglutide and orlistat to induce weight loss in women with PCOS and overweight/obesity. METHODS: A search was conducted using the MEDLINE, EMBASE, PubMed and CENTRAL databases. Individually randomized, parallel group trials that evaluated the effects of these pharmacological treatments among adults or adolescents with PCOS and overweight/obesity, compared with a placebo or metformin group, were considered eligible. Registration number: PROSPERO CRD 42017076625. RESULTS: Twenty-three trials reporting on 941 women were included in the network meta-analysis. The amount of weight lost differed significantly among the drugs (in descending order): liraglutide, orlistat and metformin. Liraglutide alone, liraglutide/metformin and metformin alone significantly reduced waist circumference, but no change was found with orlistat. Data for waist-to-hip ratio were only available for metformin, which had no significant effect. CONCLUSION: Liraglutide appears superior to the other drugs in reducing weight and waist circumference.

Comparison between a novel human cortical bone screw and bioabsorbable interference screw for graft fixation of ACL reconstruction.

OBJECTIVE: To compare the mechanical behavior of a novel bioabsorbable cortical interference screw (BCIS) with bioabsorbable interference screw (BIS; Polylactate hydroxyapatite) used for anterior cruciate ligament (ACL) reconstruction in femoral and tibial fixation with doubled Achilles tendon graft in vitro. PATIENTS AND METHODS: 30 paired goat knee specimens were harvested from 15 male sheep aged 18 months. All soft tissues were stripped from the bones of 20 paired specimens, and the last 10 paired specimens were stripped all soft tissues besides ACL (femur-ACL-tibia complex). The Achilles tendon was harvested as graft for ACL reconstruction. The specimens were divided into several groups: BCIS femoral fixation (group A, n=10), BIS femoral fixation (group B, n=10), BCIS tibial fixation (group C, n=10), BIS tibial fixation (group D, n=10), Group E is femur-ACL-tibia complex (n=10). Cyclic loading test was performed from 50 to 250 N at 1 Hz for 1000 cycles and followed by a load-to-failure test at 25 mm/sec. A paired t-test was used to compare the biomechanical properties of group A, B, E and group C, D, E. RESULTS: No fixation structures failed during the cyclic phase. Cyclic displacement for group B was superior to group A, and showed statistically significant difference after 30, 100, 500, 1000 cycles. Group E got minimum cyclic displacements compared with group A and group B, and showed statistically significant difference after 500, 1000 cycles compared with group A. Cyclic displacement for group D was superior to group C, and showed statistically significant difference after 100, 500, 1000 cycles. Group E got minimum cyclic displacements compared with group C and group D, and showed statistically significant difference after 500,1000 cycles compared with group C. Regarding MFL, group A was superior to group B (572.10±111.12 N vs. 413.96±34.56 N, p=0.118), group E was superior to group A (599.74±85.45N vs. 572.10±111.12 N, p=0.992), and group C was superior to group D (802.88±240.07 N vs. 415.63±51.9 N, p<0.001), group C was superior to group E (802.88±240.07 N vs. 599.74±85.45 N, p=0.024). Regarding YL, group A was superior to group B (521.57±93.96 N vs. 366.99±44.66 N, p=0.109), group E was superior to group A (565.37±66.05 N vs. 521.57±93.96 N, p=0.952), and group C was superior to group D (735.63±242.91 N vs. 394.49±31.90 N, p<0.001), group C was superior to group E (735.63±242.91 N vs. 565.37±66.05 N, p=0.063). Regarding stiffness, group A was superior to group B (157.36±34.31 N/mm vs. 91.98±25.57 N/mm, p=0.001), group E was superior to group A (181.35±25.42 N vs. 157.36±34.31 N/mm, p=0.529), and group C was superior to group D (175.28±43.19 N/mm vs. 128.24±18.92 N/mm, p=0.032), group E was superior to group C (181.35±25.42 N/mm vs. 175.28±43.19 N/mm, p=0.995). CONCLUSIONS: In vitro, this experimental study suggested the biomechanical properties of novel bioabsorbable cortical interference screw (BCIS) were superior to bioabsorbable interference screw (BIS) used for femoral and tibial anterior cruciate ligament (ACL) reconstruction in a goat knee model.

Improved apple latent spherical virus-induced gene silencing in multiple soybean genotypes through direct inoculation of agro-infiltrated Nicotiana benthamiana extract.

BACKGROUND: Virus induced gene silencing (VIGS) is a powerful genomics tool for interrogating the function of plant genes. Unfortunately, VIGS vectors often produce disease symptoms that interfere with the silencing phenotypes of target genes, or are frequently ineffective in certain plant genotypes or tissue types. This is especially true in crop plants like soybean [Glycine max (L.) Merr]. To address these shortcomings, we modified the inoculation procedure of a VIGS vector based on Apple latent spherical virus (ALSV). The efficacy of this new procedure was assessed in 19 soybean genotypes using a soybean Phytoene desaturase (GmPDS1) gene as the VIGS target. Silencing of GmPDS1 was easily scored as photo-bleached leaves and/or stems. RESULTS: In this report, the ALSV VIGS vector was modified by mobilizing ALSV cDNAs into a binary vector compatible with Agrobacterium tumefaciens-mediated delivery, so that VIGS-triggering ALSV variants could be propagated in agro-infiltrated Nicotiana benthamiana leaves. Homogenate of these N. benthamiana leaves was then applied directly onto the unifoliate of young soybean seedlings to initiate systemic gene silencing. This rapid inoculation method bypassed the need for a particle bombardment apparatus. Among the 19 soybean genotypes evaluated with this new method, photo-bleaching indicative of GmPDS1 silencing was observed in nine, with two exhibiting photo-bleaching in 100% of the inoculated individuals. ALSV RNA was detected in pods, embryos, stems, leaves, and roots in symptomatic plants of four genotypes. CONCLUSIONS: This modified protocol allowed for inoculation of soybean plants via simple mechanical rubbing with the homogenate of N. benthamiana leaves agro-infiltrated with ALSV VIGS constructs. More importantly, inoculated plants showed no apparent virus disease symptoms which could otherwise interfere with VIGS phenotypes. This streamlined procedure expanded this functional genomics tool to nine soybean genotypes.

Revealing the nature of low-temperature photoluminescence peaks by laser treatment in van der Waals epitaxially grown WS2 monolayers.

Monolayers of transition metal dichalcogenides (TMD) are promising materials for optoelectronics devices. However, one of the challenges is to fabricate large-scale growth of high quality TMD monolayers with the desired properties in order to expand their use in potential applications. Here, we demonstrate large-scale tungsten disulfide (WS2) monolayers grown by van der Waals Epitaxy (VdWE). We show that, in addition to the large structural uniformity and homogeneity of these samples, their optical properties are very sensitive to laser irradiation. We observe a time instability in the photoluminescence (PL) emission at low temperatures in the scale of seconds to minutes. Interestingly, this change of the PL spectra with time, which is due to laser induced carrier doping, is employed to successfully distinguish the emission of two negatively charged bright excitons. Furthermore, we also detect blinking sharp bound exciton emissions which are usually attractive for single photon sources. Our findings contribute to a deeper understanding of this complex carrier dynamics induced by laser irradiation which is very important for future optoelectronic devices based on large scale TMD monolayers.

An exploration of the hypothesis that testosterone is implicated in the psychological functioning of women with polycystic ovary syndrome (PCOS).

One of the diagnostic features of polycystic ovary syndrome (PCOS) is elevation of the androgen, testosterone. It is known that women with PCOS are more likely to suffer from psychological problems, especially anxiety and depression, than other women. However, little is known of how much of this is due to testosterone, and if so, what the mechanism(s) might be. This study explores the hypothesis that testosterone impacts women with PCOS both directly and indirectly, via testosterone currently in the bloodstream and through prenatal exposure. It is hypothesised that direct effects occur when testosterone acts directly upon receptors; indirect effects occur where the impact of testosterone is mediated via another variable; activational effects are ephemeral and are caused by testosterone in the bloodstream; organizational effects occur prenatally and cause permanent changes. Four pathways are hypothesised in this paper: 1/ a direct and activational pathway which improves mental rotation ability; 2/ an indirect and activational pathway, whereby distress is caused when the physiological symptoms of testosterone are experienced as embarrassing or otherwise disturbing; 3/ an indirect and organizational effect on mood, where elevated prenatal testosterone predisposes women with PCOS to low blood sugar levels and thus low mood; 4/ and finally, it is suggested that the pathway from biology to psychology can be travelled in reverse, with a direct activational effect of relaxation training on the reduction of adrenal androgens. Testing these hypotheses has important implications for our understanding of PCOS, and our ability to treat this condition more effectively.

The use and discontinuation of hormone replacement therapy in women in South China.

OBJECTIVE: The use of hormone replacement therapy (HRT) started later in China than in European countries. The purpose of the present study was to investigate HRT patterns and reasons for the initiation and discontinuation of HRT among women in South China. METHODS: A telephone survey about menopausal status, the use of HRT, reasons for HRT discontinuation and duration of HRT treatment was conducted in 2014. RESULTS: A total of 825 telephone surveys were carried out, and 217 previous HRT users and 390 current users were recruited for this study. Among these 607 subjects, 50.7% of the women sought out HRT for hot flushes, 41.6% for fatigue and 41.5% for sleeplessness. Approximately one-third (35.9%) of the patients abandoned HRT during the following year. The reasons for stopping HRT were mainly fear of breast and uterine cancer (28.4%), reduced menopausal symptoms (22.9%) and the inconvenience of taking pills or seeing a doctor (17.9%). The factors related to HRT discontinuation were the age when HRT was initiated (odds ratio 1.59, 95% confidence interval 1.19-2.13) and education level (odds ratio 0.78, 95% confidence interval 0.62-0.98). CONCLUSIONS: The duration of HRT use in women in south China was short, and a high proportion of the women discontinued HRT. Given the high discontinuation rate and the low medical compliance, Chinese health-care providers still have much to do to let women know about the advantages and disadvantages of HRT and to encourage the use of HRT appropriately.

Correlation of insulin-like growth factor 1 and osteoarthritic cartilage degradation: a spontaneous osteoarthritis in guinea-pig.

OBJECTIVE: The pathogenesis of osteoarthritis centers on the imbalance between catabolic and anabolic processes in cartilage metabolism. Insulin growth factor 1 (IGF-1) has been shown to have anabolic effects in cartilage in vitro. This study aim to determine whether IGF-1 on cartilage is associated with loss of chondrocyte and extracellular matrix breakdown using the Hartley guinea pig model. MATERIALS AND METHODS: Cartilage from the medial and lateral tibial plateau of 6-month and 12-month old Hartley guinea pigs were used for this study. Histological analysis was performed with hematoxylin-eosin (HE) and toluidine blue staining. Safranin-O staining was used to quantify proteoglycan (PG) loss and the extent of cartilage damage by Modified Mankin score. Distribution of IGF-1 was demonstrated with in situ hybridization techniques. IGF-1 mRNA levels were assessed using Real-time PCR. RESULTS: Histological loss of chondrocytes, and cartilage matrix and decreased IGF-1 distribution were demonstrated in a temporal and spatial manner. Compared to the 6-month old samples, the 12-month specimens had significantly cartilage degeneration and less cartilage matrix and PGs staining. Decreased level of IGF-1 was also observed in the 12-month samples. These observations were more pronounced in the medial tibial plateau when compared to the lateral plateau. CONCLUSIONS: The decreased level of IGF-1 may play a critical role for maintaining the balance between catabolic and anabolic processes in cartilage metabolism during the development of osteoarthritis. Thus, the increase of IGF-1 may be applicable to developing OA therapy.

Decreased γ-aminobutyric acid levels in the brainstem in patients with possible sleep bruxism: A pilot study.

BACKGROUND: An increasing number of studies have indicated that the central and autonomic nervous systems play roles in the genesis of sleep bruxism (SB). The role of specific neurochemicals in SB has been a subject of interest. OBJECTIVE: In this study, we use proton magnetic resonance spectroscopy (1 H-MRS) to determine whether the levels of γ-aminobutyric acid (GABA) and glutamate (Glu) are different in the brainstem and bilateral cortical masticatory area (CMA) between possible sleep bruxism (SB) patients and controls, and discuss whether the brainstem or cortical networks which may affect the central masticatory pathways are under the genesis of SB. METHODS: Twelve possible SB patients and twelve age- and gender-matched controls underwent 1 H-MRS using the "MEGA-Point Resolved Spectroscopy Sequence" (MEGA-PRESS) technique in the brainstem and bilateral CMA. Proton magnetic resonance spectroscopy data were processed using LCModel. Because the signal detected by MEGA-PRESS includes contributions from GABA, macromolecules (primarily proteins) and homocarnosine, the GABA signal is referred to as "GABA+". The glutamate complex (Glx) signal contains both glutamate (Glu) and glutamine (Gln), which mainly reflect glutamatergic metabolism. RESULTS: Edited spectra were successfully obtained from the bilateral CMA in all subjects. There were no significant differences in neurochemical levels between the left and right CMA in possible SB patients and controls. In the brainstem, significantly lower GABA+ levels were found in possible SB patients than in controls (P = .011), whereas there was no significant difference (P = .307) in Glx levels between the 2 groups. CONCLUSIONS: SB patients may possess abnormalities in the GABAergic system of brainstem networks.

Bone turnover alterations across the menopausal transition in south-eastern Chinese women [corrected].

OBJECTIVES: To explore the serum levels of bone resorption marker C-terminal telopeptide of type I collagen (CTX) and bone formation marker N-amino terminal propeptide of type I collagen (PINP) in Chinese women across the menopausal transition and the correlation between follicle stimulating hormone (FSH), luteinizing hormone (LH) and estradiol with the bone turnover markers. METHODS: A cross-sectional study was conducted on 464 healthy Chinese women, separated into pre-, peri- and postmenopausal groups based on their menstruation changes. The serum levels of CTX, PINP, FSH, LH, and estradiol were measured. RESULTS: The serum levels of CTX and PINP were significantly higher in women in the peri- and postmenopausal groups. The serum levels of FSH were significantly correlated with the serum levels of PINP in premenopausal women. Both serum FSH and LH were positively correlated with serum CTX in perimenopausal women and postmenopausal women. Estradiol was inversely correlated with CTX in the perimenopausal group. Multiple linear regression models show the serum FSH levels were independently related to the bone turnover markers CTX and PINP. CONCLUSIONS: The elevated serum levels of FSH were independent risk factors for bone loss in peri- and postmenopausal women, and measurement of the serum FSH levels in mid-age women with irregular menses could be used in early diagnosis of postmenopausal osteoporosis.

Elevated plasma sphingomyelin (d18:1/22:0) is closely related to hepatic steatosis in patients with chronic hepatitis C virus infection.

Hepatic steatosis affects disease progression in patients with chronic hepatitis C virus (HCV) infection. We investigated the plasma sphingolipid profile in patients with chronic hepatitis C (CHC) and whether there was an association between HCV-related steatosis and plasma sphingolipids. We used high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) to analyze plasma sphingolipids in 120 interferon-naïve, non-diabetic, and non-obese CHC patients. Hepatic steatosis was defined as ≥5 % hepatocytes with fat based on histopathological analysis. Blood biochemical indicators and HCV load and genotype were also determined. Thirty-six (30.0 %) of 120 patients presented with hepatic steatosis Grades 1-3. Forty-four plasma sphingolipids were detected. Plasma sphingomyelin (SM) (d18:1/22:0) and ceramide (Cer) (d18:1/24:0)-1-P correlated with steatosis grade (r = 0.22, p = 0.015; r = -0.23, p = 0.012, respectively). SM (d18:1/22:0) [odds ratio (OR) = 1.12] and Cer (d18:1/24:0)-1-P (OR = 0.88) were independent factors for the presence of hepatic steatosis in CHC patients. The area under the curve (AUC) of SM (d18:1/22:0) and Cer (d18:1/24:0)-1-P was 0.637 and 0.638, respectively, to identify the presence of steatosis. Further analysis for genotype 2 CHC showed that only SM (d18:1/22:0) was independently linked to steatosis (OR = 1.21). The AUC of SM (d18:1/22:0) to identify hepatic steatosis in genotype 2 CHC was 0.726. Its sensitivity and negative predictive value reached 0.813 and 0.886, respectively. This study suggested that altered plasma SM (d18:1/22:0) was closely related to hepatic steatosis in chronic HCV infection, especially with genotype 2. Experimental studies are needed to determine further the underlying mechanisms responsible for these associations.

Short leukocyte telomere length predicts poor prognosis and indicates altered immune functions in colorectal cancer patients.

BACKGROUND: Numerous studies indicate that the leukocyte telomere length is associated with the risk of cancers, including colorectal cancer (CRC). However, the prognostic value of leukocyte telomere length in CRC patients has not been investigated. PATIENTS AND METHODS: Relative telomere length (RTL) of peripheral blood leukocytes (PBLs) from 571 CRC patients receiving surgical resection was measured using a polymerase chain reaction-based method. The Cox proportional hazards ratio model and the Kaplan-Meier curve were used to estimate the association between RTL and the clinical outcome of CRC patients in the training set (90 patients) and the testing set (86 patients). Finally, an independent cohort of 395 patients was used as an external validation set. The immunophenotype of PBLs and the plasma concentration of several immune-related cytokines were determined by flow cytometry and enzyme-linked immunosorbent assay, respectively. RESULTS: Patients with shorter RTL had significantly poorer overall survival and relapse-free survival than those with longer RTL in the training, testing and validation sets. Furthermore, leukocyte RTL and Tumor-Node-Metastasis (TNM) stage exhibited a significant joint effect in the prognosis prediction of combined CRC patients, indicating that patients with both short RTL and advanced stages had the worst prognosis, when compared with other subgroups. In addition, patients with short RTL showed the higher percentage of CD4(+) T cell and the lower percentage of B cell in peripheral blood mononuclear cells, as well as the lower concentration of plasma transforming growth factor-ß1, suggesting a possibility that the immune functions changed with RTL alteration. CONCLUSIONS: Our study for the first time demonstrates that leukocyte RTL is an independent prognostic marker complementing TNM stage and associated with the immune functions in CRC patients.

First Report of Grapevine leaf roll-associated virus-2 and -3 in Ohio Vineyards.

Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5'-ACCTGGTTGAACGAGATCGCTT and 1R: 5'-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5'-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5'-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5'-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5'-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5'-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5'-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5'-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5'-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5'-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.

A high-mobility two-dimensional electron gas at the spinel/perovskite interface of γ-Al2O3/SrTiO3.

The discovery of two-dimensional electron gases at the heterointerface between two insulating perovskite-type oxides, such as LaAlO(3) and SrTiO(3), provides opportunities for a new generation of all-oxide electronic devices. Key challenges remain for achieving interfacial electron mobilities much beyond the current value of approximately 1,000 cm(2) V(-1) s(-1) (at low temperatures). Here we create a new type of two-dimensional electron gas at the heterointerface between SrTiO(3) and a spinel γ-Al(2)O(3) epitaxial film with compatible oxygen ions sublattices. Electron mobilities more than one order of magnitude higher than those of hitherto-investigated perovskite-type interfaces are obtained. The spinel/perovskite two-dimensional electron gas, where the two-dimensional conduction character is revealed by quantum magnetoresistance oscillations, is found to result from interface-stabilized oxygen vacancies confined within a layer of 0.9 nm in proximity to the interface. Our findings pave the way for studies of mesoscopic physics with complex oxides and design of high-mobility all-oxide electronic devices.