Identification of carboxymethyl (CM)-binding proteins derived from Lolium multiflorum pollen extract and antibody reactivity in Brazilian allergic patients.

Lolium multiflorum grass is the major pollen allergen source in the southern region of Brazil, but most of its allergens remain poorly characterized. The aim of this study was to investigate antibody reactivity to L. multiflorum crude and carboxymethyl-ligand extracts in allergic patients and healthy individuals. Ion exchange carboxymethyl (CM) chromatography (CM-Sepharose) was used to isolate proteins (S2) from L. multiflorum crude extract (S1), which were assessed by SDS-PAGE. S1- and S2-specific IgE and IgG4 levels were measured by ELISA using sera from 55 atopic and 16 non-atopic subjects. Reactive polypeptide bands in S1 and S2 were detected by immunoblotting, and the most prominent bands in S2 were analyzed by mass spectrometry (MS-MS). Similar IgE and IgG4 levels were observed to both S1 (IgE median absorbance: 1.22; IgG4 median absorbance: 0.68) and S2 (IgE median absorbance: 1.26; IgG4 median absorbance: 0.85) in atopic subjects. S1 and S2 had positive correlations for IgE and IgG4 (IgE: r=0.9567; IgG4: r=0.9229; P<0.0001) levels. Homology between S1 and S2 was confirmed by IgE (84%) and IgG4 (83%) inhibition. Immunoblotting revealed that the 29-32 kDa band was recognized by 100% of atopic subjects in both S1 and S2. MS-MS analysis identified similarity profile to groups 1 and 5 grass allergens. This study revealed that carboxymethyl-ligand fraction played an important role for pollen allergy diagnosis by containing clinically relevant allergens and constituted a promising candidate for allergen-specific immunotherapy.

Identification of carboxymethyl (CM)-binding proteins derived from Lolium multiflorum pollen extract and antibody reactivity in Brazilian allergic patients

Lolium multiflorum grass is the major pollen allergen source in the southern region of Brazil, but most of its allergens remain poorly characterized. The aim of this study was to investigate antibody reactivity to L. multiflorum crude and carboxymethyl-ligand extracts in allergic patients and healthy individuals. Ion exchange carboxymethyl (CM) chromatography (CM-Sepharose) was used to isolate proteins (S2) from L. multiflorum crude extract (S1), which were assessed by SDS-PAGE. S1- and S2-specific IgE and IgG4 levels were measured by ELISA using sera from 55 atopic and 16 non-atopic subjects. Reactive polypeptide bands in S1 and S2 were detected by immunoblotting, and the most prominent bands in S2 were analyzed by mass spectrometry (MS-MS). Similar IgE and IgG4 levels were observed to both S1 (IgE median absorbance: 1.22; IgG4 median absorbance: 0.68) and S2 (IgE median absorbance: 1.26; IgG4 median absorbance: 0.85) in atopic subjects. S1 and S2 had positive correlations for IgE and IgG4 (IgE: r=0.9567; IgG4: r=0.9229; P<0.0001) levels. Homology between S1 and S2 was confirmed by IgE (84%) and IgG4 (83%) inhibition. Immunoblotting revealed that the 29-32 kDa band was recognized by 100% of atopic subjects in both S1 and S2. MS-MS analysis identified similarity profile to groups 1 and 5 grass allergens. This study revealed that carboxymethyl-ligand fraction played an important role for pollen allergy diagnosis by containing clinically relevant allergens and constituted a promising candidate for allergen-specific immunotherapy.

Genome sequences of chikungunya virus isolates circulating in midwestern Brazil.

Chikungunya virus (CHIKV) is a reemerging arbovirus of the family Togaviridae that causes CHIKV fever, a disease that can extend from weeks to years depending on whether clinical signs of arthralgia persist. CHIKV is mainly transmitted by Aedes aegypti mosquitoes and possibly reached the Americas in 2013, causing an outbreak in Brazil in 2015. So far, two evolutionary lineages of CHIKV have been reported in Brazil: the Asian and the East-Central-South African (ECSA) lineages. In this study, six CHIKV isolates circulating in midwestern Brazil (Mato Grosso state) were isolated from patient sera, and their complete genomes were sequenced using a high-throughput sequencing platform. All of these isolates shared high nucleotide sequence similarity with CHIKV isolates from northeastern Brazil and were found to belong to the ECSA lineage. These CHIKV isolates did not contain the A226V or L210Q mutations that are associated with increased transmissibility by A. albopictus, suggesting that the CHIKV isolates circulating in midwestern Brazil are predominantly transmitted by A. aegypti.

The complete genome of the tospovirus Zucchini lethal chlorosis virus.

BACKGROUND: Zucchini lethal chlorosis virus (ZLCV) causes significant losses in the production of cucurbits in Brazil. This virus belongs to the genus Tospovirus (family Bunyaviridae) and seems to be exclusively transmitted by Frankliniella zucchini (Thysanoptera). Tospoviruses have a tripartite and single-stranded RNA genome classified as S (Small), M (Medium) and L (Large) RNAS. Although ZLCV was identified as a member of the genus Tospovirus in 1999, its complete genome had not been sequenced until now. FINDINGS: We sequenced the full-length genome of two ZLCV isolates named ZLCV-SP and ZLCV-DF. The phylogenetic analysis showed that ZLCV-SP and ZLCV-DF clustered with the previously reported isolate ZLCV-BR09. Their proteins were closely related, except the non-structural protein (NSm), which was highly divergent (approximately 90 % identity). All viral proteins clustered similarly in our phylogenetic analysis, excluding that these ZLCV isolates have originated from reassortment events of different tospovirus species. CONCLUSION: Here we report for the first time the complete genome of two ZLCV isolates that were found in the field infecting zucchini and cucumber.

The movement proteins (NSm) of distinct tospoviruses peripherally associate with cellular membranes and interact with homologous and heterologous NSm and nucleocapsid proteins.

Tospovirus is the only genus containing virus species which infect plants in the Bunyaviridae family. The aims of this study were to understand the in vivo membrane association of the movement protein (NSm) of the tospovirus species Bean necrotic mosaic virus, Chrysanthemum stem necrosis virus, Tomato chlorotic spot virus and Tomato spotted wilt virus and the homologous and heterologous interactions among NSm and nucleocapsid protein (N). The results obtained by bimolecular fluorescence complementation (BiFC) assay and chemical treatments after membrane fractionation revealed that the four NSm proteins are associated with the biological membranes with the N- and C-termini oriented to the cytoplasm. BiFC analysis for protein-protein interactions showed: i) dimer formation for all NSm and N proteins; ii) interaction between NSm and the cognate N and iii) heterologous interactions between the NSm and N proteins. The implications of these interactions in the life cycle of tospoviruses are discussed.

The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

First Report of Johnsongrass mosaic virus (JGMV) Infecting Pennisetum purpureum in Brazil.

Tropical grass and legume species used as pasture grasses for cattle feeding cover over 25% of the agricultural area in Brazil. In recent years, plants showing virus-like symptoms have been observed in the main pasture grass growing areas. Plants of Pennisetum purpureum line CNPGL 00211 showing typical virus mosaic symptoms on leaves and growth reduction were collected in Bahia State, Brazil. Flexuous elongated potyvirus-like particles were observed in the leaf-dip preparation of diseased plants by electron microscopy. In addition, the virus was mechanically transmitted using a standard procedure for potyviruses (4) and produced similar symptoms in inoculated P. purpureum plants. For further molecular identification, total RNA was extracted from frozen symptomatic leaves following the guanidine thiocyanate method (3). cDNA synthesis was performed using oligonucleotide, OligodT50M10 and PCR was carried out using Potyvirus degenerate primers PY11 (5'-GGNAAYAAYAGYGGNCARCC-3') (2) and M10 (5'-AAGCAGTGTTATCAACGCAGA-3'). The amplified fragments of the expected size (approximately 2 kb comprising part of the NIb protein gene, the entire coat protein [CP] gene, and the 3' nontranslated region) were separated using agarose gel electrophoresis, excised, and cloned into plasmid vector pGEMT-Easy (Promega) according to the manufacturer's instructions. Four selected clones were sequenced (Macrogen, South Korea). The sequenced 2.0-kb fragment (GenBank Accession No. KC333416) was compared with sequences available in GenBank and the highest nucleotide identity of 79% was observed with Johnsongrass mosaic virus (JGMV) isolated in Australia (4). According to the Potyvirus species demarcation convention based on CP identity (1), the virus isolate from P. purpureum belongs to the JGMV species. However, the amino acid sequence of the N-terminus of the CP of the Bahia isolate is distinct from JGMV sequences reported in GenBank. The phylogenetic analysis of the CP confirmed the difference since this Bahia isolate was located in a clearly distinct branch separate from all JGMV isolates. To our knowledge, this is the first report of a JGMV in Brazil infecting tropical grass in the main pasture areas. References: (1) M. J. Adams et al. Arch. Virol. 150: 459, 2005. (2) J. Chen et al. Arch. Virol. 146:757. 2001. (3) P. Chomczynski and N. Sacchi. Nature Protocols 1:581, 2006. (4) H. K. Laidlaw et al. Arch. Virol. 149:1633, 2004.

A distinct tymovirus infecting Cassia hoffmannseggii in Brazil.

Leaves of Cassia hoffmannseggii, a wild fabaceous species found in the Atlantic Forest, with a severe mosaic symptom were collected in Pernambuco State, Brazil. By transmission electron microscopy, two types of virus particles were found: the first was recognized as particles of a potyvirus, which was later identified as Cowpea aphid-borne mosaic virus; and the second was isometric and present in high concentration. The observation of vesicles at the periphery of chloroplasts suggested a tymovirus infection, which was confirmed by subsequent assays. A serological assay against several tymovirus antisera resulted in positive reaction of this tymo-like virus with an antiserum of Passion fruit yellow mosaic virus. By means of RT-PCR and using degenerated primers for the conserved region of RNA-dependent RNA polymerase (RdRp) gene of tymoviruses, a specific DNA fragment was amplified and sequenced. Based on this sequence, a specific forward primer was synthesized and successfully used to amplify the 3' terminal genome region, containing the partial RdRp gene and the complete coat protein (CP) sequences. The CP was 188 amino acids (aa) long, and the highest CP aa identity was observed with Kennedya yellow mosaic virus (61 %). Based on the current ICTV demarcation criterion, this isolate was considered as a distinct tymovirus and tentatively named as Cassia yellow mosaic-associated virus.

Molecular characterization of the RNA-dependent RNA polymerase from groundnut ringspot virus (genus Tospovirus, family Bunyaviridae).

Groundnut ringspot virus is a negative-sense single-stranded RNA virus that belongs to the genus Tospovirus and is the prevalent member of this genus in Brazil. This work presents the nucleotide sequence of the L RNA, with a single open reading frame of 2873 amino acids in the complementary strand corresponding to the RNA-dependent RNA polymerase (L protein), as well as the characterization of conserved domains of the L protein by in silico analysis. Phylogenetic analysis of different L protein domains confirmed that GRSV is a member of the American clade, and comparison with a N-protein indicates that phylogeny based on L protein sequences may be more reliable than that based on the N protein.

Genomic diversity of sweet potato geminiviruses in a Brazilian germplasm bank.

Begomoviruses cause major diseases of sweet potato worldwide impairing considerably the yields of this important food staple. Since sweet potato plants are vegetatively propagated and globally transported, they are prone to accumulate and disseminate geminiviruses. Effective diagnostic tools are, therefore, desirable. We studied the genomic diversity of geminiviruses present in naturally-infected sweet potato accessions belonging to a Brazilian germplasm bank collection. Fifty-five samples from different sweet potato accessions displaying geminivirus-like symptoms were analyzed by combining rolling circle amplification (RCA) with restriction fragment length polymorphism (RFLP) and sequencing. The restriction enzyme MspI (HpaII) revealed diverse band patterns in 55 samples and digestion with BamHI, SstI or PstI resulted in full-length sweet potato geminivirus DNAs of about 3 kb in 46 samples. In addition, smaller fragments were identified as either viral "Defective DNAs" (D-DNAs) or mitochondrial plasmid DNAs. The diversity of sweet potato-associated geminiviruses was found to be very high under Brazilian conditions. Representative viral full-length DNAs have been cloned and sequenced yielding two new tentative species, three strains and several variants of previously described sweet potato geminiviruses. Sequence comparisons identified footprints of recombination in their genomes underscoring the risk of generating new geminiviruses in vegetatively propagated germplasm bank material. The sites of recombination were found in conjunction with predicted hairpin structures. We propose diagnostic routines to screen germplasm bank material for geminiviruses by the rapid and reliable RCA/RFLP as the technique of choice.

Multiple Resistance to Meloidogyne spp. and to Bipartite and Monopartite Begomovirus spp. in Wild Solanum (Lycopersicon) Accessions.

The Ty-1 locus confers tolerance to monopartite and bipartite Begomovirus spp. (genus Begomovirus, family Geminiviridae) and this phenotype is improved in homozygous tomato lines. However, the gene Mi (Meloidogyne spp. resistance) is in repulsion phase linkage with Ty-1, which hampers the large-scale development of multiresistant inbred lines. Seventy-one Solanum (section Lycopersicon) accessions were whitefly inoculated with the bipartite Begomovirus sp. Tomato rugose mosaic virus (ToRMV) and simultaneously infested with a mixture of Meloidogyne incognita and M. javanica under greenhouse conditions in Brazil. Accessions were then transplanted into a nematode-infested field with natural ToRMV infection. A severity index was used to evaluate ToRMV reaction. Nematode evaluation was done by counting the number of galls per root system. Seventeen accessions with Meloidogyne spp. and ToRMV resistance were selected and evaluated in Spain against three monopartite Begomovirus spp. associated with the tomato yellow leaf curl virus disease, using infectious clones. Systemic infection was monitored by DNA hybridization. Five S. peruvianum accessions (PI-306811, PI-365951, LA-1609, LA-2553, and CNPH-1194) displayed nematode and broad-spectrum resistance to all Begomovirus spp. tested in both continents. From the breeding standpoint, accessions combining resistance to Meloidogyne spp. and to bipartite and monopartite Begomovirus spp. would be useful for the development of elite lines expressing all traits in homozygous condition.

Phenotypic expression, stability, and inheritance of a recessive resistance to monopartite begomoviruses associated with tomato yellow leaf curl disease in tomato.

Tomato-infecting begomoviruses comprise a complex of monopartite and bipartite virus species that cause severe yield and quality losses worldwide. Therefore, the availability of wide spectrum resistance for begomovirus control is desirable. However, limited sources of resistance are available. In this study, three tomato inbred lines with resistance to bipartite begomoviruses of Brazil were tested for resistance to monopartite begomoviruses associated with the tomato yellow leaf curl disease (TYLCD). Stable resistance to Tomato yellow leaf curl virus was observed either by inoculation with Bemisia tabaci or with Agrobacterium tumefaciens using an infectious clone. The resistance resulted in a complete absence of TYLCD symptoms and restricted virus accumulation. Further studies performed with the line '468-1-1-12' indicated that the resistance was also effective against three other virus species associated with TYLCD, indicating wide spectrum resistance of this source. Quantitative genetics analyses suggested that a major recessive locus with epistatic interactions is controlling the resistance to TYLCD in '468-1-1-12', which could facilitate introgression of this trait into elite tomato lines. The resistance was stable under field conditions with high TYLCD pressure. Mild symptoms could be observed in these conditions, and recovery from disease and from virus infection suggested an active host antiviral defense mechanism. The differential reaction of '468-1-1-12' against a number of TYLCD-associated viruses and artificial chimeras between them allowed to identify a region of the virus genome that presumably contains a virus determinant for breaking the resistance to infection observed in '468-1-1-12'.

Molecular diversity of ecologically distinct Mal de Río Cuarto virus isolates based on restriction fragment length polymorphism (RFLPs) and genome sequence analysis of segments 1, 7, 9 and 10.

Viruses of the species Mal de Río Cuarto virus (genus Fijivirus, family Reoviridae) cause significant economic losses in maize in Argentina. Genetic changes in the virus genome leading to better adaptation to diverse ecological conditions were postulated that would account for the increasing MRCV variability. The genomic differences between MRCV isolates from four ecologically different areas (Río Cuarto, RC; Pergamino, P; Jesús María, JM; and Tafí del Valle, TV) were studied. RT-PCR-amplified fragments comprising four genomic segments (Seg1, Seg7, Seg9 and Seg10) of MRCV isolates were compared by RFLPs and nucleotide sequences. The segments were chosen based on the proteins they encode: RNA-dependent-RNA polymerase, proteins putatively associated with tubular structures and viroplasm and the major outer capsid protein, respectively. Genetic comparison suggested that JM and TV isolates were genetically similar, but RC and P were different. Therefore, they were clustered in three genetic groups (JM = TV, RC and P). Together, nucleotide and amino acid sequence identities of the genomic segments were often above 96%. Seg1 was more variable (viral polymerase), whereas Seg7 (putative tubular structure) was the most conserved. Phylogeny analysis showed that MRCV isolates could be clustered in 'mountain area' and 'high production area' groups according to their geographical occurrence.

Responses of IgE, IgG1, and IgG4 to concanavalin A-binding Blomia tropicalis antigens in allergic patients.

Blomia tropicalis (Bt) and Dermatophagoides pteronyssinus (Dp) are the prevalent house dust mites in tropical countries and are associated with allergic diseases. Glycosylated antigens are highly immunogenic and involved in different pathologies. We evaluated the presence of IgE, IgG1, and IgG4 to concanavalin A-binding antigens (Bt-Con-A) isolated from Bt-total extract in sera of allergic and non-allergic subjects. Bt-total and Bt-Con-A extracts were evaluated by SDS-PAGE and ELISA for reacting with IgE, IgG1, and IgG4 in sera of 121 patients with allergic rhinitis and 36 non-allergic individuals. All subjects were skin prick tested with Bt-total extract and inhibition tests were performed for IgE, IgG1, and IgG4 using both extracts (Bt-total and Bt-Con-A). Skin prick test showed that 58% of the patients were sensitized to Bt (Bt+), with 52% reactive to both mites (Bt and Dp) and 6% to Bt only. A broad spectrum of proteins (14-152 kDa) was visualized in Bt-total and components >27 kDa for the Bt-Con-A extract. ELISA showed a similar profile of IgE, IgG1 and IgG4 levels in response to Bt-total and Bt-Con-A extracts in different groups, although Bt+ patients showed a lower IgG4 reactivity to Bt-Con-A extract. Specific IgG1 levels were higher in Bt+ patients than in control subjects, and IgG4 levels showed no significant difference among groups. ELISA inhibition showed a partial IgE and total IgG1 and IgG4 cross-reactivity with Dp extract for Bt-total and Bt-Con-A extracts. We conclude that Con-A-binding components isolated from Bt constitute major allergens and are involved in both allergen sensitization (IgE response) and homeostasis maintenance (IgG1 and IgG4 responses).

Responses of IgE, IgG1, and IgG4 to concanavalin A-binding Blomia tropicalis antigens in allergic patients

Blomia tropicalis (Bt) and Dermatophagoides pteronyssinus (Dp) are the prevalent house dust mites in tropical countries and are associated with allergic diseases. Glycosylated antigens are highly immunogenic and involved in different pathologies. We evaluated the presence of IgE, IgG1, and IgG4 to concanavalin A-binding antigens (Bt-Con-A) isolated from Bt-total extract in sera of allergic and non-allergic subjects. Bt-total and Bt-Con-A extracts were evaluated by SDS-PAGE and ELISA for reacting with IgE, IgG1, and IgG4 in sera of 121 patients with allergic rhinitis and 36 non-allergic individuals. All subjects were skin prick tested with Bt-total extract and inhibition tests were performed for IgE, IgG1, and IgG4 using both extracts (Bt-total and Bt-Con-A). Skin prick test showed that 58 percent of the patients were sensitized to Bt (Bt+), with 52 percent reactive to both mites (Bt and Dp) and 6 percent to Bt only. A broad spectrum of proteins (14-152 kDa) was visualized in Bt-total and components >27 kDa for the Bt-Con-A extract. ELISA showed a similar profile of IgE, IgG1 and IgG4 levels in response to Bt-total and Bt-Con-A extracts in different groups, although Bt+ patients showed a lower IgG4 reactivity to Bt-Con-A extract. Specific IgG1 levels were higher in Bt+ patients than in control subjects, and IgG4 levels showed no significant difference among groups. ELISA inhibition showed a partial IgE and total IgG1 and IgG4 cross-reactivity with Dp extract for Bt-total and Bt-Con-A extracts. We conclude that Con-A-binding components isolated from Bt constitute major allergens and are involved in both allergen sensitization (IgE response) and homeostasis maintenance (IgG1 and IgG4 responses).

Pepper yellow mosaic virus, a new potyvirus in sweetpepper, Capsicum annuum.

A potyvirus was found causing yellow mosaic and veinal banding in sweetpepper in Central and Southeast Brazil. The sequence analysis of the 3' terminal region of the viral RNA revealed a coat protein of 278 amino acids, followed by 275 nucleotides in the 3'-untranslated region preceding a polyadenylated tail. The virus shared 77.4% coat protein amino acid identity with Pepper severe mosaic virus, the closest Potyvirus species. The 3'-untranslated region was highly divergent from other potyviruses. Based on these results, the virus found in sweetpepper plants could be considered as a new potyvirus. The name Pepper yellow mosaic virus (PepYMV) is suggested.

Sequence diversity of NS(M) movement protein of tospoviruses.

In order to determine the diversity of the movement protein (NS(M)) among tospoviruses, the NSM genes of five distinct tospovirus species occurring in Brazil (Tomato chlorotic spot virus, Groundnut ring spot virus, Chrysanthemum stem necrosis virus, Zucchini lethal chlorosis virus and Iris yellow spot virus) were cloned, sequenced and compared with NS(M) sequences of other available tospoviruses. The 'D-motif', a conserved region present in the majority of '30K superfamily' virus movement proteins, is present in all NSM amino acid sequences available. In addition to the 'D-motif', a conserved phospholipase A2 motif was found. The NSM amino acid sequence comparisons among tospovirus species revealed several conserved regions located in the internal part of the protein and diverse domains mainly located in the amino-terminus. Prediction of secondary structure showed similar patterns among all NS(M) proteins analyzed. Considering the geographical prevalence and phylogenetic analysis of N and NS(M) proteins, tospoviruses were tentatively clustered in 'American' and 'Eurasian' groups. Both phylogenetic trees may reflect the natural evolution of tospovirus species within distinct ecological niches. The sequence information obtained in this work would facilitate functional analysis of NS(M) during the tospovirus infection process.