Design and synthesis of a sulphur containing Schiff base drug: DNA binding studies and theoretical calculations.

The Schiff base compound MTA ((E)-5-methyl-N'-((5-methylthiophen-2-yl)methylene)-1H-pyrazole-3-carbohydrazide) derived from 2-thiophenecarboxaldehyde and 5-methylpyrazole-3-carbohydrazide has been designed to develop new sulphur containing DNA targeted molecule. The MTA has been characterized by elemental analyses, 1H-NMR, single crystal X-ray diffraction studies as well as by geometry optimization of using DFT/B3LYP. The interaction of MTA with Calf thymus DNA (CT-DNA) was studied by spectroscopic and calorimetric techniques. The synthesized compound was found to bind with CT-DNA through groove binding mode, and the binding constant was estimated to be (4.15 ± 0.08) × 104 M-1. The negative ΔG0 and positive ΔS0 values obtained from the calorimetric technique confirmed the spontaneity of the binding of MTA with DNA.Communicated by Ramaswamy H. Sarma.

A simple Cu(II) complex of phenolic oxime: synthesis, crystal structure, supramolecular interactions, DFT calculation and catecholase activity study.

A copper (II) complex [Cu(4-MeO-salox)2](1) based on saloxime ligand was synthesized and characterized using single crystal X-ray diffraction studies. The geometry was further emphasized by DFT optimization. The complex was found to be pseudo-macrocyclic mononuclear having square planer geometry. The complex 1 shows two types of supramolecular hydrogen bonding interactions and forms the multi-dimensional framework with the help of CH∙∙∙O, OH∙∙∙O and π∙∙∙π(chelate) interactions. The complex 1 performs as efficient catalyst in catecholase activiy having good turnover number (TON), k cat = 22.97 h-1 where TON is the number of catechol molecules converted into quinone by catalyst molecule i.e 1 in a unit time.

Adaptable DNA-Interactive Probe Proficient at Selective Turn-On Sensing for Al3+: Insight from the Crystal Structure, Photophysical Studies, and Molecular Logic Gate.

The synthesized Schiff base ligand 3-hydroxy-N'-(2-hydroxy-3-methoxybenzylidene)-2-naphthohydrazide (H2NPV) is structurally characterized by single-crystal X-ray diffraction (XRD) and exhibits weak fluorescence in the excited state owing to the effect of excited-state-induced proton transfer (ESIPT). However, in the presence of Al3+, the ESIPT is blocked and chelation-enhanced fluorescence (CHEF) is induced because of complexation with the cations, resulting in turn-on emission for Al3+. The probe H2NPV selectively detects Al3+ among the various metal ions, and the detection limit is found to be 1.70 µM. The composition and modes of complex coordination were determined by spectroscopic, theoretical studies and molecular logic gate applications. Finally, DNA binding studies were performed by spectroscopic and calorimetric methods to elucidate possible bioactivity of H2NPV.

Biophysical and Thermodynamic Investigations on the Differentiation of Fluorescence Response towards Interaction of DNA: A Pyrene-Based Receptor versus Its Fe(III) Complex.

The Fe(III) complex [Fe(L)(NO3)(H2O)]+ (1) was prepared using a structurally characterized Schiff base ligand, 1-((pyren-1-ylimino) methyl) naphthalen-2-ol (HL), to develop an optical probe for fluorimetric recognition of DNA. An electrospray ionization-mass spectrometry (ESI-MS) study was carried out to ascertain the composition of 1 and the geometry of 1 was optimized by density functional theory (DFT) calculations. Compared to the strong intrinsic fluorescence of the ligand (HL), 1 was only weakly fluorescent. The interaction of 1 with DNA was investigated through different biophysical techniques. The fluorescence emission of 1 appeared to increase progressively in the presence of calf thymus (CT) DNA and this was utilized for the fluorimetric recognition of DNA. In comparison with 1, in the presence of DNA, the ligand HL showed quenching in its emission. The selectivity of 1 towards DNA was also confirmed in the presence of a large number of environmentally pertinent anions (NO3-, SO42-, Cl-, Br-, I-, OAC-, PO43-, ClO4-, HCO3-, H2PO4-, HPO42-, CO32-). Comprehensive DNA-binding experiments also showed that complex (1) and HL interacted with CT-DNA with different efficacies; the affinity of 1 was about six times higher than that of HL. Calorimetric studies showed that the 1-DNA association progressed with large positive entropy changes. In contrast, the association of HL with DNA was an enthalpy-driven process. Molecular docking results confirmed that the binding of 1 with CT-DNA progressed by intercalation and other noncovalent interactions.

Effect of bovine serum albumin on tartrate-modified manganese ferrite nano hollow spheres: spectroscopic and toxicity study.

The emerging category of magneto-fluorescent tartrate-modified MnFe2O4 nano hollow spheres (T-MnFe2O4 NHSs) can be considered as promising candidates for biomedical applications. The interaction of bovine serum albumin (BSA) with T-MnFe2O4 NHSs has been studied using several spectroscopic techniques, which suggest that the interaction occurs by an electrostatic mechanism. Furthermore, BSA enhances the charge transfer transition from the tartrate ligand to the metal ions along with the d-d transition of Fe3+ ions on NHSs surfaces at different pH. Very strong salt bridge formation occurs between the lysine of the BSA surface and the tartrate in basic medium (pH 10), followed by the acidic (pH 3) and neutral medium (pH 7), respectively. Systematic fluorescence microscopic analysis reveals that BSA significantly enhances the contrast of T-MnFe2O4 NHSs in UV and blue light excitation because of the extended charge transfer from BSA to T-MnFe2O4 NHSs. Our report demonstrates great potential in the field of nanotechnology and biomedical applications. In vitro toxicity analysis using RAW 264.7 celline and in vivo studies on Wister rats revealed that the T-MnFe2O4 NHSs are benign. Furthermore, T-MnFe2O4 NHSs also appear to be an antimicrobial agent. Therefore, T-MnFe2O4 NHSs can be explored for future therapeutic applications.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

A ward round proforma improves documentation and communication.

This article present the results of an audit cycle which evaluated the quality of inpatient ward round documentation in a busy district general hospital before and after the implementation of a standardized proforma which was specifically designed for trauma and orthopaedic patients. In each cycle, 20 case notes were examined and the data analysed to examine three main areas: Diagnosis, management and/or discharge plan Objective assessments including neurovascular status, weight-bearing status, surgical wound review, observations, results of investigations and decision from the daily trauma meeting Logistics of the documentation such as legibility, date and time, name and grade of the doctor and contact number. This audit demonstrated that using a ward round proforma can significantly enhance the quality of documentation and improve communication between multidisciplinary team members.

Rapid detection of hydrazine in a naphthol-fused chromenyl loop and its effectiveness in human lung cancer cells: tuning remarkable selectivity via the reaction altered pathway supported by theoretical studies.

Our designed and synthesized chemosensor naphthalene based chromenyl derivative (NAC) [1-(3-hydroxy-3 methyl-3H-benzo[f]chromen-2-yl) ethanone] has been used for fast (<30 s, DL = 0.22 ppb) and selective detection of N2H4 by a new way via the chromenyl ring opening followed by the pyrazole ring formation giving a strong blue fluorescence. The DFT study and the real application in different water samples along with the dipstick method in low cost devices have also been performed here. Human lung cancer cells (NCI-H460) have been used for hydrazinolysis of the NAC in vivo system for detection by the appearance of blue fluorescence and also for the MTT assay showing its remarkable cancer sensitivity.

DNA binding and nuclease activity of an oxovanadium valinato-Schiff base complex.

A new oxovanadium complex [VO(sal-l-val)(phen)] (sal-l-val=Schiff base derived from salicylaldehyde and l-valine; phen=1,10-phenanthroline) has been designed and synthesized with the aim of developing potential DNA nuclease. The interaction of DNA with this structurally characterized oxovanadium complex has been studied by various physicochemical tools like UV-vis, fluorescence, viscosity and circular dichroism (CD). The intrinsic binding constant of the complex with DNA is determined by electronic absorption studies and calculated to be (4.74 ± 0.02)× 10(5)M(-1). The spectroscopic studies and the viscosity measurements indicate that the complex binds calf thymus DNA (CT-DNA) by intercalative mode. The ability of the complex to induce DNA cleavage was studied by gel electrophoresis techniques. The complex has been found to promote cleavage of pUC19 plasmid DNA from the super coiled (SC) form I to nicked coiled (NC) relaxed form II with good efficiency.