Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 12 de 12
Filtrar
Mais filtros








Base de dados
Intervalo de ano de publicação
1.
Nat Commun ; 9(1): 4623, 2018 11 05.
Artigo em Inglês | MEDLINE | ID: mdl-30397201

RESUMO

The interaction between natural killer (NK) cell inhibitory receptors and their cognate ligands constitutes a key mechanism by which healthy tissues are protected from NK cell-mediated lysis. However, self-ligand recognition remains poorly understood within the prototypical NKR-P1 receptor family. Here we report the structure of the inhibitory NKR-P1B receptor bound to its cognate host ligand, Clr-b. NKR-P1B and Clr-b interact via a head-to-head docking mode through an interface that includes a large array of polar interactions. NKR-P1B:Clr-b recognition is extremely sensitive to mutations at the heterodimeric interface, with most mutations severely impacting both Clr-b binding and NKR-P1B receptor function to implicate a low affinity interaction. Within the structure, two NKR-P1B:Clr-b complexes are cross-linked by a non-classic NKR-P1B homodimer, and the disruption of homodimer formation abrogates Clr-b recognition. These data provide an insight into a fundamental missing-self recognition system and suggest an avidity-based mechanism underpins NKR-P1B receptor function.


Assuntos
Lectinas Tipo C/química , Subfamília B de Receptores Semelhantes a Lectina de Células NK/química , Receptores Imunológicos/química , Receptores de Células Matadoras Naturais/química , Animais , Proteínas de Transporte , Cristalografia por Raios X , Células HEK293 , Humanos , Lectinas Tipo C/genética , Camundongos , Camundongos Endogâmicos C57BL , Modelos Moleculares , Mutagênese Sítio-Dirigida , Mutação , Subfamília B de Receptores Semelhantes a Lectina de Células NK/genética , Conformação Proteica , Conformação Proteica em alfa-Hélice , Domínios Proteicos , Receptores Imunológicos/genética , Receptores de Células Matadoras Naturais/genética , Difração de Raios X
2.
J Biol Chem ; 292(26): 10912-10925, 2017 06 30.
Artigo em Inglês | MEDLINE | ID: mdl-28490636

RESUMO

Cytochrome c oxidase (CcO) is the last electron acceptor in the respiratory chain. The CcO core is formed by mitochondrial DNA-encoded Cox1, Cox2, and Cox3 subunits. Cox1 synthesis is highly regulated; for example, if CcO assembly is blocked, Cox1 synthesis decreases. Mss51 activates translation of COX1 mRNA and interacts with Cox1 protein in high-molecular-weight complexes (COA complexes) to form the Cox1 intermediary assembly module. Thus, Mss51 coordinates both Cox1 synthesis and assembly. We previously reported that the last 15 residues of the Cox1 C terminus regulate Cox1 synthesis by modulating an interaction of Mss51 with Cox14, another component of the COA complexes. Here, using site-directed mutagenesis of the mitochondrial COX1 gene from Saccharomyces cerevisiae, we demonstrate that mutations P521A/P522A and V524E disrupt the regulatory role of the Cox1 C terminus. These mutations, as well as C terminus deletion (Cox1ΔC15), reduced binding of Mss51 and Cox14 to COA complexes. Mss51 was enriched in a translationally active form that maintains full Cox1 synthesis even if CcO assembly is blocked in these mutants. Moreover, Cox1ΔC15, but not Cox1-P521A/P522A and Cox1-V524E, promoted formation of aberrant supercomplexes in CcO assembly mutants lacking Cox2 or Cox4 subunits. The aberrant supercomplex formation depended on the presence of cytochrome b and Cox3, supporting the idea that supercomplex assembly factors associate with Cox3 and demonstrating that supercomplexes can be formed even if CcO is inactive and not fully assembled. Our results indicate that the Cox1 C-terminal end is a key regulator of CcO biogenesis and that it is important for supercomplex formation/stability.


Assuntos
Complexo IV da Cadeia de Transporte de Elétrons/metabolismo , Mitocôndrias/enzimologia , Proteínas de Saccharomyces cerevisiae/metabolismo , Saccharomyces cerevisiae/enzimologia , Substituição de Aminoácidos , Complexo IV da Cadeia de Transporte de Elétrons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Mitocôndrias/genética , Proteínas Mitocondriais/genética , Proteínas Mitocondriais/metabolismo , Mutação de Sentido Incorreto , Saccharomyces cerevisiae/genética , Proteínas de Saccharomyces cerevisiae/genética , Fatores de Transcrição/genética , Fatores de Transcrição/metabolismo
3.
mSphere ; 1(3)2016.
Artigo em Inglês | MEDLINE | ID: mdl-27303738

RESUMO

The pathogenic yeast Candida albicans escapes macrophages by triggering NLRP3 inflammasome-dependent host cell death (pyroptosis). Pyroptosis is inflammatory and must be tightly regulated by host and microbe, but the mechanism is incompletely defined. We characterized the C. albicans endoplasmic reticulum (ER)-mitochondrion tether ERMES and show that the ERMES mmm1 mutant is severely crippled in killing macrophages despite hyphal formation and normal phagocytosis and survival. To understand dynamic inflammasome responses to Candida with high spatiotemporal resolution, we established live-cell imaging for parallel detection of inflammasome activation and pyroptosis at the single-cell level. This showed that the inflammasome response to mmm1 mutant hyphae is delayed by 10 h, after which an exacerbated activation occurs. The NLRP3 inhibitor MCC950 inhibited inflammasome activation and pyroptosis by C. albicans, including exacerbated inflammasome activation by the mmm1 mutant. At the cell biology level, inactivation of ERMES led to a rapid collapse of mitochondrial tubular morphology, slow growth and hyphal elongation at host temperature, and reduced exposed 1,3-ß-glucan in hyphal populations. Our data suggest that inflammasome activation by C. albicans requires a signal threshold dependent on hyphal elongation and cell wall remodeling, which could fine-tune the response relative to the level of danger posed by C. albicans. The phenotypes of the ERMES mutant and the lack of conservation in animals suggest that ERMES is a promising antifungal drug target. Our data further indicate that NLRP3 inhibition by MCC950 could modulate C. albicans-induced inflammation. IMPORTANCE The yeast Candida albicans causes human infections that have mortality rates approaching 50%. The key to developing improved therapeutics is to understand the host-pathogen interface. A critical interaction is that with macrophages: intracellular Candida triggers the NLRP3/caspase-1 inflammasome for escape through lytic host cell death, but this also activates antifungal responses. To better understand how the inflammasome response to Candida is fine-tuned, we established live-cell imaging of inflammasome activation at single-cell resolution, coupled with analysis of the fungal ERMES complex, a mitochondrial regulator that lacks human homologs. We show that ERMES mediates Candida escape via inflammasome-dependent processes, and our data suggest that inflammasome activation is controlled by the level of hyphal growth and exposure of cell wall components as a proxy for severity of danger. Our study provides the most detailed dynamic analysis of inflammasome responses to a fungal pathogen so far and establishes promising pathogen- and host-derived therapeutic strategies.

4.
J Biol Chem ; 291(17): 9343-55, 2016 Apr 22.
Artigo em Inglês | MEDLINE | ID: mdl-26929411

RESUMO

Cytochrome c oxidase assembly requires the synthesis of the mitochondria-encoded core subunits, Cox1, Cox2, and Cox3. In yeast, Pet54 protein is required to activate translation of the COX3 mRNA and to process the aI5ß intron on the COX1 transcript. Here we report a third, novel function of Pet54 on Cox1 synthesis. We observed that Pet54 is necessary to achieve an efficient Cox1 synthesis. Translation of the COX1 mRNA is coupled to the assembly of cytochrome c oxidase by a mechanism that involves Mss51. This protein activates translation of the COX1 mRNA by acting on the COX1 5'-UTR, and, in addition, it interacts with the newly synthesized Cox1 protein in high molecular weight complexes that include the factors Coa3 and Cox14. Deletion of Pet54 decreased Cox1 synthesis, and, in contrast to what is commonly observed for other assembly mutants, double deletion of cox14 or coa3 did not recover Cox1 synthesis. Our results show that Pet54 is a positive regulator of Cox1 synthesis that renders Mss51 competent as a translational activator of the COX1 mRNA and that this role is independent of the assembly feedback regulatory loop of Cox1 synthesis. Pet54 may play a role in Mss51 hemylation/conformational change necessary for translational activity. Moreover, Pet54 physically interacts with the COX1 mRNA, and this binding was independent of the presence of Mss51.


Assuntos
Complexo IV da Cadeia de Transporte de Elétrons/biossíntese , Proteínas Mitocondriais/biossíntese , Biossíntese de Proteínas/fisiologia , Proteínas de Ligação a RNA/metabolismo , Proteínas de Saccharomyces cerevisiae/biossíntese , Proteínas de Saccharomyces cerevisiae/metabolismo , Saccharomyces cerevisiae/metabolismo , Regiões 5' não Traduzidas/fisiologia , Complexo IV da Cadeia de Transporte de Elétrons/genética , Proteínas Mitocondriais/genética , RNA Fúngico/genética , RNA Fúngico/metabolismo , Proteínas de Ligação a RNA/genética , Saccharomyces cerevisiae/genética , Proteínas de Saccharomyces cerevisiae/genética , Fatores de Transcrição/genética , Fatores de Transcrição/metabolismo
5.
Proc Natl Acad Sci U S A ; 111(49): 17576-81, 2014 Dec 09.
Artigo em Inglês | MEDLINE | ID: mdl-25422432

RESUMO

αß T-cell receptor (TCR) activation plays a crucial role for T-cell function. However, the TCR itself does not possess signaling domains. Instead, the TCR is noncovalently coupled to a conserved multisubunit signaling apparatus, the CD3 complex, that comprises the CD3εγ, CD3εδ, and CD3ζζ dimers. How antigen ligation by the TCR triggers CD3 activation and what structural role the CD3 extracellular domains (ECDs) play in the assembled TCR-CD3 complex remain unclear. Here, we use two complementary structural approaches to gain insight into the overall organization of the TCR-CD3 complex. Small-angle X-ray scattering of the soluble TCR-CD3εδ complex reveals the CD3εδ ECDs to sit underneath the TCR α-chain. The observed arrangement is consistent with EM images of the entire TCR-CD3 integral membrane complex, in which the CD3εδ and CD3εγ subunits were situated underneath the TCR α-chain and TCR ß-chain, respectively. Interestingly, the TCR-CD3 transmembrane complex bound to peptide-MHC is a dimer in which two TCRs project outward from a central core composed of the CD3 ECDs and the TCR and CD3 transmembrane domains. This arrangement suggests a potential ligand-dependent dimerization mechanism for TCR signaling. Collectively, our data advance our understanding of the molecular organization of the TCR-CD3 complex, and provides a conceptual framework for the TCR activation mechanism.


Assuntos
Complexo Receptor-CD3 de Antígeno de Linfócitos T/química , Motivos de Aminoácidos , Antígenos/química , Membrana Celular/metabolismo , Células HEK293 , Humanos , Ligantes , Microscopia Eletrônica , Modelos Moleculares , Peptídeos/química , Multimerização Proteica , Estrutura Terciária de Proteína , Receptores de Antígenos de Linfócitos T alfa-beta/química , Espalhamento de Radiação , Transdução de Sinais , Linfócitos T/química , Raios X
6.
J Bacteriol ; 195(24): 5577-82, 2013 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-24123815

RESUMO

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.


Assuntos
Acinetobacter baumannii/genética , Dano ao DNA , Enzimas Reparadoras do DNA/genética , Enzimas Reparadoras do DNA/metabolismo , Regulação Bacteriana da Expressão Gênica , Regulon , Acinetobacter baumannii/efeitos dos fármacos , Antibacterianos/metabolismo , Sítios de Ligação , Análise Mutacional de DNA , Ensaio de Desvio de Mobilidade Eletroforética , Perfilação da Expressão Gênica , Análise em Microsséries , Mitomicina/metabolismo , Regiões Promotoras Genéticas , Ligação Proteica
7.
Proc Natl Acad Sci U S A ; 109(49): E3358-66, 2012 Dec 04.
Artigo em Inglês | MEDLINE | ID: mdl-23151513

RESUMO

The controlled biogenesis of mitochondria is a key cellular system coordinated with the cell division cycle, and major efforts in systems biology currently are directed toward understanding of the control points at which this coordination is achieved. Here we present insights into the function, evolution, and regulation of mitochondrial biogenesis through the study of the protein import machinery in the human fungal pathogen, Candida albicans. Features that distinguish C. albicans from baker's yeast (Saccharomyces cerevisiae) include the stringency of metabolic control at the level of oxygen consumption, the potential for ATP exchange through the porin in the outer membrane, and components and domains in the sorting and assembling machinery complex, a molecular machine that drives the assembly of proteins in the outer mitochondrial membrane. Analysis of targeting sequences and assays of mitochondrial protein import show that components of the electron transport chain are imported by distinct pathways in C. albicans and S. cerevisiae, representing an evolutionary rewiring of mitochondrial import pathways. We suggest that studies using this pathogen as a model system for mitochondrial biogenesis will greatly enhance our knowledge of how mitochondria are made and controlled through the course of the cell-division cycle.


Assuntos
Evolução Biológica , Candida albicans/fisiologia , Proteínas de Transporte/metabolismo , Complexo de Proteínas da Cadeia de Transporte de Elétrons/metabolismo , Mitocôndrias/fisiologia , Proteínas Mitocondriais/metabolismo , Modelos Biológicos , Análise por Conglomerados , Biologia Computacional , Eletroforese em Gel de Poliacrilamida , Cadeias de Markov , Proteínas do Complexo de Importação de Proteína Precursora Mitocondrial , Consumo de Oxigênio/fisiologia , Filogenia , Transporte Proteico/fisiologia , Saccharomyces cerevisiae , Especificidade da Espécie
8.
Eukaryot Cell ; 10(11): 1376-83, 2011 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-21926328

RESUMO

Recently, mitochondria have been identified as important contributors to the virulence and drug tolerance of human fungal pathogens. In different scenarios, either hypo- or hypervirulence can result from changes in mitochondrial function. Similarly, specific mitochondrial mutations lead to either sensitivity or resistance to antifungal drugs. Here, we provide a synthesis of this emerging field, proposing that mitochondrial function in membrane lipid homeostasis is the common denominator underlying the observed effects of mitochondria in drug tolerance (both sensitivity and resistance). We discuss how the contrasting effects of mitochondrial dysfunction on fungal drug tolerance and virulence could be explained and the potential for targeting mitochondrial factors for future antifungal drug development.


Assuntos
Antifúngicos/farmacologia , Farmacorresistência Fúngica , Fungos/efeitos dos fármacos , Fungos/patogenicidade , Mitocôndrias/fisiologia , Membranas Mitocondriais/metabolismo , Micoses/tratamento farmacológico , Antifúngicos/metabolismo , Azóis/farmacologia , Candida albicans/efeitos dos fármacos , Candida albicans/metabolismo , Candida albicans/patogenicidade , Candida glabrata/efeitos dos fármacos , Candida glabrata/metabolismo , Candida glabrata/patogenicidade , Cryptococcus neoformans/efeitos dos fármacos , Cryptococcus neoformans/metabolismo , Cryptococcus neoformans/patogenicidade , Descoberta de Drogas , Farmacorresistência Fúngica/genética , Fungos/genética , Fungos/metabolismo , Humanos , Lipídeos de Membrana/metabolismo , Testes de Sensibilidade Microbiana , Mitocôndrias/efeitos dos fármacos , Mitocôndrias/genética , Micoses/microbiologia , Polienos/farmacologia , Saccharomyces cerevisiae/efeitos dos fármacos , Saccharomyces cerevisiae/metabolismo , Saccharomyces cerevisiae/patogenicidade
9.
J Biol Chem ; 285(45): 34382-9, 2010 Nov 05.
Artigo em Inglês | MEDLINE | ID: mdl-20807763

RESUMO

Synthesis of the largest cytochrome c oxidase (CcO) subunit, Cox1, on yeast mitochondrial ribosomes is coupled to assembly of CcO. The translational activator Mss51 is sequestered in early assembly intermediate complexes by an interaction with Cox14 that depends on the presence of newly synthesized Cox1. If CcO assembly is prevented, the level of Mss51 available for translational activation is reduced. We deleted the C-terminal 11 or 15 residues of Cox1 by site-directed mutagenesis of mtDNA. Although these deletions did not prevent respiratory growth of yeast, they eliminated the assembly-feedback control of Cox1 synthesis. Furthermore, these deletions reduced the strength of the Mss51-Cox14 interaction as detected by co-immunoprecipitation, confirming the importance of the Cox1 C-terminal residues for Mss51 sequestration. We surveyed a panel of mutations that block CcO assembly for the strength of their effect on Cox1 synthesis, both by pulse labeling and expression of the ARG8(m) reporter fused to COX1. Deletion of the nuclear gene encoding Cox6, one of the first subunits to be added to assembling CcO, caused the most severe reduction in Cox1 synthesis. Deletion of the C-terminal 15 amino acids of Cox1 increased Cox1 synthesis in the presence of each of these mutations, except pet54. Our data suggest a novel activity of Pet54 required for normal synthesis of Cox1 that is independent of the Cox1 C-terminal end.


Assuntos
Complexo IV da Cadeia de Transporte de Elétrons/biossíntese , Mitocôndrias/enzimologia , Proteínas de Saccharomyces cerevisiae/biossíntese , Saccharomyces cerevisiae/enzimologia , Sequência de Aminoácidos , Complexo IV da Cadeia de Transporte de Elétrons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Mitocôndrias/genética , Proteínas Mitocondriais/genética , Proteínas Mitocondriais/metabolismo , Proteínas de Ligação a RNA/genética , Proteínas de Ligação a RNA/metabolismo , Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/crescimento & desenvolvimento , Proteínas de Saccharomyces cerevisiae/genética , Proteínas de Saccharomyces cerevisiae/metabolismo , Deleção de Sequência , Fatores de Transcrição/genética , Fatores de Transcrição/metabolismo , Transcrição Gênica/fisiologia
10.
Mol Biol Cell ; 20(20): 4371-80, 2009 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-19710419

RESUMO

Functional interactions of the translational activator Mss51 with both the mitochondrially encoded COX1 mRNA 5'-untranslated region and with newly synthesized unassembled Cox1 protein suggest that it has a key role in coupling Cox1 synthesis with assembly of cytochrome c oxidase. Mss51 is present at levels that are near rate limiting for expression of a reporter gene inserted at COX1 in mitochondrial DNA, and a substantial fraction of Mss51 is associated with Cox1 protein in assembly intermediates. Thus, sequestration of Mss51 in assembly intermediates could limit Cox1 synthesis in wild type, and account for the reduced Cox1 synthesis caused by most yeast mutations that block assembly. Mss51 does not stably interact with newly synthesized Cox1 in a mutant lacking Cox14, suggesting that the failure of nuclear cox14 mutants to decrease Cox1 synthesis, despite their inability to assemble cytochrome c oxidase, is due to a failure to sequester Mss51. The physical interaction between Mss51 and Cox14 is dependent upon Cox1 synthesis, indicating dynamic assembly of early cytochrome c oxidase intermediates nucleated by Cox1. Regulation of COX1 mRNA translation by Mss51 seems to be an example of a homeostatic mechanism in which a positive effector of gene expression interacts with the product it regulates in a posttranslational assembly process.


Assuntos
Complexo IV da Cadeia de Transporte de Elétrons/biossíntese , Regulação Fúngica da Expressão Gênica/fisiologia , Mitocôndrias/enzimologia , Proteínas de Saccharomyces cerevisiae/biossíntese , Proteínas de Saccharomyces cerevisiae/fisiologia , Saccharomyces cerevisiae/metabolismo , Fatores de Transcrição/fisiologia , Regiões 5' não Traduzidas , Complexo IV da Cadeia de Transporte de Elétrons/genética , Genes Reporter , Genes Sintéticos , Homeostase , Proteínas de Membrana/fisiologia , Proteínas Mitocondriais/fisiologia , Biossíntese de Proteínas/fisiologia , Mapeamento de Interação de Proteínas , Processamento de Proteína Pós-Traducional/fisiologia , Subunidades Proteicas , RNA Fúngico/genética , RNA Fúngico/metabolismo , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Proteínas Recombinantes de Fusão/fisiologia , Saccharomyces cerevisiae/genética , Proteínas de Saccharomyces cerevisiae/genética , Fatores de Transcrição/genética
11.
Curr Top Med Chem ; 8(15): 1335-50, 2008.
Artigo em Inglês | MEDLINE | ID: mdl-18991722

RESUMO

Human mitochondrial DNA (mtDNA) codes for 13 polypeptides which constitute the central core of the oxidative phosphorylation (OXPHOS) complexes. The machinery for mitochondrial protein synthesis has a dual origin: a full set of tRNAs, as well as the 12S and 16S rRNAs are encoded in the mitochondrial genome, while most factors necessary for translation are encoded by nuclear genes. The mitochondrial translation apparatus is highly specialized in expressing membrane proteins, and couples the synthesis of proteins to the insertion into the mitochondrial inner membrane. In recent years it has become clear that defects of mitochondrial translation and protein assembly cause several mitochondrial disorders. Since direct studies on protein synthesis in human mitochondria are still a relatively difficult task, we owe our current knowledge of this field to the large amount of genetic and biochemical studies performed in the yeast Saccharomyces cerevisiae. These studies have allowed the identification of several genes involved in mitochondrial protein synthesis and assembly, and have provided insights into the conserved mechanisms of mitochondrial gene expression. In the present review we will discuss the most recent advances in the understanding of the mechanisms and factors that govern mammalian mitochondrial translation/protein insertion, as well as known pathologies associated with them.


Assuntos
Doenças Mitocondriais/metabolismo , Biossíntese de Proteínas , Humanos , Doenças Mitocondriais/genética , Doenças Mitocondriais/patologia , Fosforilação Oxidativa , Iniciação Traducional da Cadeia Peptídica/genética , Biossíntese de Proteínas/genética , Ribossomos/genética , Ribossomos/metabolismo
12.
J Biol Chem ; 283(3): 1472-1479, 2008 Jan 18.
Artigo em Inglês | MEDLINE | ID: mdl-18039654

RESUMO

Pet309 is a protein essential for respiratory growth. It is involved in translation of the yeast mitochondrial COX1 gene, which encodes subunit I of the cytochrome c oxidase. Pet309 is also involved in stabilization of the COX1 mRNA. Mutations in a similar human protein, Lrp130, are associated with Leigh syndrome, where cytochrome c oxidase activity is affected. The sequence of Pet309 reveals the presence of at least seven pentatricopeptide repeats (PPRs) located in tandem in the central portion of the protein. Proteins containing PPR motifs are present in mitochondria and chloroplasts and are in general involved in RNA metabolism. Despite the increasing number of proteins from this family found to play essential roles in mitochondria and chloroplasts, little is understood about the mechanism of action of the PPR domains present in these proteins. In a series of in vivo analyses we constructed a pet309 mutant lacking the PPR motifs. Although the stability of the COX1 mRNA was not affected, synthesis of Cox1 was abolished. The deletion of one PPR motif at a time showed that all the PPR motifs are required for COX1 mRNA translation and respiratory growth. Mutations of basic residues in PPR3 caused reduced respiratory growth. According to a molecular model, these residues are facing a central cavity that could be involved in mRNA-binding activity, forming a possible path for this molecule on Pet309. Our results show that the RNA metabolism function of Pet309 is found in at least two separate domains of the protein.


Assuntos
Complexo IV da Cadeia de Transporte de Elétrons/genética , Proteínas de Membrana/química , Proteínas de Membrana/metabolismo , Biossíntese de Proteínas , Estabilidade de RNA , RNA Mensageiro/metabolismo , Proteínas de Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/enzimologia , Motivos de Aminoácidos , Aminoácidos , Complexo IV da Cadeia de Transporte de Elétrons/biossíntese , Regulação Fúngica da Expressão Gênica , Mitocôndrias/metabolismo , Proteínas Mitocondriais , Modelos Moleculares , Mutagênese , Fatores de Iniciação de Peptídeos , Estrutura Terciária de Proteína , Transporte Proteico , RNA Fúngico/metabolismo , RNA Mitocondrial , Sequências Repetitivas de Aminoácidos , Saccharomyces cerevisiae/citologia , Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/crescimento & desenvolvimento , Proteínas de Saccharomyces cerevisiae/biossíntese , Proteínas de Saccharomyces cerevisiae/química , Proteínas de Saccharomyces cerevisiae/metabolismo , Relação Estrutura-Atividade
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA