RESUMO
In agricultural countries, Agro-industrial residues are better treated with a circular production logic. This article analyzes the morphological, physical, mechanical, thermal, and chemical characteristics of the coconut fiber and endocarp in Portoviejo and Rocafuerte Cities, Ecuador, to establish a baseline of knowledge that can help to incorporate coconut residues into a matrix of a new material. Interviews were conducted to coconut producers in Portoviejo and Rocafuerte and a random sample of the residues was collected from these locations. Analyses were performed using the SEM, TGA and FRX tests. Concerning the fiber, it was observed a tubular morphology with concentric microfibrils, specific weight 0.69 g/cm3, tensile strength 228 MPa, modulus of elasticity 3.03 GPa, thermal behavior with important mass losses at 330 °C, in the calcinations to obtain oxides as SiO2, SO3, Al2O3, Fe2O3 at 600 °C and 650 °C. The endocarp has a morphology of superimposed and consolidated smooth layers, specific weight 1.29 g/cm3, loss of mass at 339 °C and in calcinations at 800 °C. This study can help to address solid vegetable waste managing challenges in coconut producing cities.
RESUMO
INTRODUCTION: Uveitis is the inflammation of the middle layer of the eye, the uvea, and is a major cause of blindness. None of the instruments used in clinical practice are, in themselves, sufficient to evaluate the course of uveitis. Therefore, it is necessary to develop instruments enabling standardized measurement of inflammatory activity. We developed a composite disease activity index for patients with uveitis known as UVEDAI, which considers the overall activity of the eye. The objective of this study was to validate the composite index of ocular inflammation, UVEDAI. METHODS: A multicenter cross-sectional study involving eight Spanish tertiary hospitals. Sixty-two patients aged ≥ 18 years with acute uveitis were recruited. Participants gave informed consent before participating in the study. A full ophthalmological examination was performed by two ophthalmologists to determine inflammatory activity: one used the UVEDAI score and the other used clinical judgment. The ophthalmologists did not share their findings with each other to avoid introducing bias into the analysis. Construct validity was established by means of factor analysis. The criterion validity of the index was determined using an ordinal multivariate regression model, in which the dependent variable was the degree of uveal inflammation (mild, moderate, or high/severe). Cut-off points were determined for the UVEDAI and for the receiver operating characteristic (ROC) curves. RESULTS: Sixty-two patients were included. Total variance with the three components accounted for 80.32% of the construct validity. Each of the three components identified one type of eye involvement. The discriminatory capacity of UVEDAI was 0.867 (95% CI 0.778; 0.955 p < 0.001) for mild versus moderate-high and 0.946 (95% CI 0.879; 1.000 p < 0.001) for high versus mild-moderate. CONCLUSIONS: The variables included in UVEDAI enable ocular inflammatory activity to be described with a high degree of accuracy. The index may be used to evaluate and classify this activity with considerable discriminatory power.
RESUMO
Introducción. La pandemia por COVID-19 ha llevado a modificar la estructura asistencial en los hospitales alrededor del mundo, buscando la mejor forma de adaptarse para responder al incremento de pacientes infectados por el virus, sin desatender las necesidades de los pacientes no afectados por el mismo. El objetivo de este trabajo es describir la percepción de la comunidad quirúrgica sobre el impacto que ha tenido la pandemia COVID-19 en los servicios de cirugía en Colombia.Métodos. Estudio de corte transversal descriptivo mediante encuesta estructurada compuesta por 10 preguntas de selección múltiple y 8 preguntas con ítems tipo Likert. Se distribuyó electrónicamente a residentes de cirugía general, cirujanos generales o sub-especialistas que tuvieran práctica clínica en Colombia. Resultados. Se incluyeron 464 participantes, 27.8 % fueron mujeres y 45.3 % cirujanos generales. Alrededor de la mitad residían en Bogotá (51.4 %) o trabajaban en un hospital universitario privado (48.3 %). El 78.8% de los encuestados consideraron que las recomendaciones de seguridad son efectivas y 76.6% se sienten seguros realizando procedimientos con ellas. Sin embargo, el 63% consideran que estas se cumplen parcialmente. Hasta el momento, 20% de los participantes reportó haber tenido contacto directo con pacientes COVID-19 positivos. Finalmente, la mayoría (93%) están de acuerdo con la cancelación de procedimientos electivos y están dispuestos a ser reubicados en otros servicios en caso de ser necesario. Conclusiones. Para el inicio de la fase de mitigación en Colombia existe consenso en la percepción del impacto de la pandemia COVID-19 en los servicios de cirugía. No se observó una variabilidad significativa respecto al nivel de entrenamiento ni al tipo de institución hospitalaria
Introduction: The COVID-19 pandemic has led to changes in the care structure in hospitals around the world, seeking the best way to adapt in response to the increase in patients infected with the virus, without neglecting the needs of patients not affected by it. The objective of this study is to describe the perception of the surgical community on the impact that the COVID-19 pandemic has had on the surgical services in Colombia.Methods: Descriptive cross-sectional study using a structured survey consisting of 10 multiple-choice questions and 8 questions with Likert-type items. It was distributed electronically to residents of general surgery, general surgeons, or sub-specialists who had clinical practice in Colombia.Results: 464 participants were included, 27.8% were women and 45.3% were general surgeons. About half resided in Bogotá (51.4%) or worked in a private university hospital (48.3%). 78.8% of the respondents considered that the safety recommendations are effective and 76.6% feel safe performing procedures with them. However, 63% con-sider that these are partially met. So far, 20% of participants reported having had direct contact with COVID-19 positive patients. Finally, the majority (93%) agree to the cancellation of elective procedures and are willing to be relocated to other services if necessary.Conclusions: There is a consensus in the perception of the COVID-19 pandemic impact in the surgery services without observing significant variability regarding the level of training or the type of hospital institution
Assuntos
Humanos , Infecções por Coronavirus , Percepção , Inquéritos e Questionários , PandemiasRESUMO
OBJECTIVES: To determine the safety and clinical benefit of therapeutic plasma exchange (TPE) as rescue therapy in children with acute inflammatory demyelinating CNS syndromes and to identify baseline prognostic indicators of treatment improvement. METHODS: This single-center retrospective pediatric cohort included all consecutive patients admitted to our hospital over the period from 2003 to 2017 because of a steroid-refractory acute CNS event presumed to be inflammatory who required TPE. Functional status assessment to identify improvement included the following performance category scales: visual outcome, bladder control, gait, and Expanded Disability Status Scale (EDSS). These assessments were performed before and after TPE in every patient. RESULTS: Sixty-five children requiring TPE to treat 78 CNS attacks were included for analysis. Median age at TPE was 10.5 years (1.9-18 years); 45% were girls. Seropositivity (aquaporin-4 water channel-immunoglobulin G [IgG] or myelin oligodendrocyte glycoprotein-IgG) was found in 20 of 42 (48%) patients. Attack phenotypes leading to TPE were optic neuritis (ON) in 42%, longitudinally extensive transverse myelitis (LETM) in 31%, ON + LETM in 15%, and other combined syndromes in 11%. Overall, moderate to marked neurologic improvement was observed in 72% of children at the end of TPE and in 88.5% at 6 months of follow-up. Lower baseline scores on the EDSS, visual outcome, and gait scales were found to be independent prognostic indicators of treatment benefit. Sex, age at onset and at TPE, attack phenotype, disease duration, and time from attack onset to TPE initiation were not significantly associated with treatment outcome. Adverse events were observed in 31 of 524 (5.9%) procedures, being severe in 4. CONCLUSIONS: TPE was an effective rescue therapy associated with functional improvement. No therapeutic window for TPE initiation was identified in this pediatric cohort. Overall frequency of adverse events was low; however, serious events should be anticipated and avoided. CLASSIFICATION OF EVIDENCE: This study provides Class IV evidence that for children with acute inflammatory demyelinating CNS syndromes, TPE leads to functional improvement.
Assuntos
Doenças Autoimunes Desmielinizantes do Sistema Nervoso Central/terapia , Troca Plasmática , Adolescente , Aquaporina 4/imunologia , Autoanticorpos/imunologia , Criança , Pré-Escolar , Doenças Autoimunes Desmielinizantes do Sistema Nervoso Central/imunologia , Doenças Autoimunes Desmielinizantes do Sistema Nervoso Central/fisiopatologia , Feminino , Humanos , Lactente , Modelos Logísticos , Masculino , Esclerose Múltipla/imunologia , Esclerose Múltipla/fisiopatologia , Esclerose Múltipla/terapia , Glicoproteína Mielina-Oligodendrócito/imunologia , Mielite Transversa/imunologia , Mielite Transversa/fisiopatologia , Mielite Transversa/terapia , Neuromielite Óptica/imunologia , Neuromielite Óptica/fisiopatologia , Neuromielite Óptica/terapia , Neurite Óptica/imunologia , Neurite Óptica/fisiopatologia , Neurite Óptica/terapia , Prognóstico , Estudos Retrospectivos , Índice de Gravidade de Doença , Resultado do TratamentoRESUMO
Obesity, overweight and overall inadequate habits have alarmingly increased across the world over the past four decades. More worrisome is the increase in the number of obese children and adolescents. Obesity in childhood in a Public Health problem worldwide, and its association with other diseases, both in childhood and in adult life, as well as its high prevalence, makes it essential to develop early and precise intervention from different areas. The TAS program, (Tú y Alicia por la Salud-Alice and you for Health), aims to promote healthy eating and physical activity through cooking and active leisure. An educational intervention was carried out in the classroom, measured by food surveys and the Physical Activity Questionnaire for Adolescents PAQ-A questionnaire (before and after) in 2,516 students aged 13 and 14 yrs. from 79 schools distributed in the 17 Autonomous Regions in Spain. Overall, adolescents do not comply with the dietary guidelines and recommendations for physical activity by the Spanish Society of Community Nutrition (SENC) and the World Health Organization (WHO), respectively. In the vast majority of the participants, intake of fruit and vegetables was less than recommended, while the consumption of meat, pastries, snacks and fried foods exceeded recommendations. As for physical activity, there was a generalized lack of attention and little dedication to non-sedentary activities. In conclusion, Spanish adolescents show low adherence to recommendations given by SENC and WHO.
La obesidad, el sobrepeso y, en general, los malos hábitos han aumentado en todo el mundo de manera alarmante en las últimas cuatro décadas. Y lo más preocupante es el aumento del número de niños y adolescentes con sobrepeso y obesidad. La obesidad infantil es un problema de salud pública mundial, y su asociación con otras enfermedades, tanto en la niñez como en la vida adulta, así como su elevada prevalencia, hacen que sea imprescindible una intervención precisa y a temprana edad desde diferentes ámbitos.El programa TAS (Tú y Alícia por la Salud) tiene como objetivo promover una alimentación saludable y una actividad física suficiente a través de la cocina y del ocio activo. Se realizó una intervención educativa en el aula, que se midió mediante encuestas alimentarias y el cuestionario Physical Activity Questionnaire for Adolescents PAQ-A (antes y después) a 2.516 estudiantes de 13-14 años de 79 escuelas distribuidas en las 17 comunidades autónomas de España.En general, los adolescentes no cumplen con las recomendaciones alimentarias y de actividad física de la Sociedad Española de Nutrición Comunitaria (SENC) y de la Organización Mundial de la Salud (OMS), respectivamente. En la gran mayoría de los participantes, la ingesta de frutas y verduras fue menor de lo recomendado, mientras que el consumo de carne, bollería, pastelería, snacks y alimentos fritos fue excesivo. En cuanto a la actividad física, se observó una falta generalizada y una escasa dedicación a actividades no sedentarias. En conclusión, los adolescentes españoles presentan baja adherencia a las recomendaciones dadas por la SENC y por la OMS.
Assuntos
Fenômenos Fisiológicos da Nutrição do Adolescente , Exercício Físico , Comportamento Alimentar , Promoção da Saúde/métodos , Adolescente , Feminino , Humanos , Estilo de Vida , Masculino , Obesidade/prevenção & controle , Sobrepeso/prevenção & controle , Espanha , Inquéritos e QuestionáriosRESUMO
New water soluble, enantiopure arene ruthenium compound SRuSN-(1R,4S)-[(η6-p-cymene)Ru{ĸNH(Bn),ĸNOH}Cl]Cl (Bnâ¯=â¯benzyl, 1a') has been synthesized. The novel compound along with that previously described RRuRN-(1S,4R)-[(η6-p-cymene)Ru{ĸNH(Bn),ĸNOH}Cl]Cl (1a) was evaluated by polarimetry, ultra-violet and circular dichroism spectroscopy. The structure of novel ruthenium derivative 1a' was determined by single crystal X-ray crystallography. Both enantiomers have been tested against several cancer cell lines in vitro: prostate PC-3, lung A-549, pancreas MIA PaCa-2, colorectal HCT-116, leukemia Jurkat and cervical HeLa. Both enantiomers are active and versatile cytotoxic agents, showing IC50 values from 2 to 12 times lower than those found for cisplatin in the different cell lines evaluated. The mechanism of cell death induced by the metal compounds was analyzed in A-549 and Jurkat cell lines. Derivatives 1a and 1a' induced apoptotic cell death of A-549 cells while dose-dependent cell death mechanisms have been found in the Jurkat cell line. Compound-DNA interactions have been investigated by equilibrium dialysis, Fluorescence Resonance Energy Transfer (FRET) melting assays and viscometric titrations, revealing moderate binding affinity of 1a and 1a' towards duplex DNA. Finally, the efficacy of 1a in a preliminary in vivo assay of PC-3 xenografts in nude mice has been evaluated, resulting in a promising inhibition of tumor growth by 45%. Analysis of tumor tissue also showed a significant decrease of levels of crucial molecules in the invasive phenotype of PC-3 cells.
Assuntos
Oximas/química , Rutênio/química , Células A549 , Animais , Linhagem Celular Tumoral , Células HeLa , Humanos , Substâncias Intercalantes/química , Camundongos Nus , Estereoisomerismo , ÁguaRESUMO
Objective The health needs of older adults constitute challenges for health monitoring and care, resulting in increased costs. The present study therefore sought to analyze the health status of the elderly to enable targeting and intervention, in the pursuit of healthy aging for all. Method A quantitative observational cross-sectional study using a primary source was performed in 2012. A total of 4,248 adults aged over 60 years of age residing in the nine regions of Antioquia, Colombia, and the capital city were surveyed. Univariate, bivariate and multivariate analysis was performed of statistical and epidemiological measures, based on confidence intervals and statistical tests under 5%. Results One in four individuals had a risk of depression, one in three were at risk of anxiety, eight out of ten had cognitive impairment, mainly mild, and the same proportion were at nutritional risk. The elderly persons suffered from all types of abuse, notably psychological. Conclusions Thehealth status ofelderly personsis more affectedbymental than physical healthrisks, indicatingthatpublic policy anda better distribution ofresourcesshould be aimed at seeking animprovement in qualityof life anddignified aging, differentiated byregion.
Objetivo Las necesidades de salud de los adultos mayores se constituyen en retos por los requerimientos de atención, cuidado e incremento de costos, por eso se buscó analizar el estado de salud del adulto mayor que posibilite la focalización e intervención oportuna, en la búsqueda de un envejecimiento saludable para todos. Método Bajo un enfoque cuantitativo, se realizó un estudio observacional, descriptivo transversal de fuente primaria, encuestando a 4.248 adultos mayores de 60 años de edad, residentes en las nueve subregiones del departamento de Antioquia, Colombia y la ciudad capital en el segundo semestre del año 2012. Se realizaron análisis univariados, bivariados y multivariados, en el cálculos de medidas estadísticas y epidemiológicas, intervalos de confianza y pruebas estadísticas menores del 5%. Resultados Uno de cada cuatro presentaron riesgo de depresión, uno de cada tres tenían riesgo de ansiedad, ocho de cada diez presentaron deterioro cognitivo, principalmente leve, y riesgo nutricional en igual proporción. Se evidenció todo tipo de maltrato contra los adultos mayores, siendo mayor el psicológico. Conclusiones El estado de salud de la persona mayor se ve más afectado por los riesgos en la salud mental que en la física, que permiten el direccionamiento de las políticas públicas y una mejor distribución de recursos en la búsqueda del mejoramiento en su calidad de vida y un envejecimiento digno, diferenciando por la región de residencia.
RESUMO
We report in this article the interactions of five N-(1,10-phenanthrolin-5-yl)-ß-glycopyranosylamine copper(II) complexes with G-quadruplex DNA. Specifically, the interactions of these compounds with a human telomeric oligonucleotide have been assessed by fluorescence-based assays (FRET melting and G4-FID), circular dichroism and competitive equilibrium dialysis experiments. The metal complexes bind and stabilize G-quadruplex DNA structures with apparent association constants in the order of 10(4)-10(5)M(-1) and the affinity observed is dependent on the ionic conditions utilized and the specific nature of the carbohydrate moiety tethered to the 1,10-phenanthroline system. The compounds showed only a slight preference to bind G-quadruplex DNA over duplex DNA when the quadruplex DNA was folded in sodium ionic conditions. However, the binding affinity and selectivity, although modest, were notably increased when the G-quadruplex DNA was folded in the presence of potassium metal ions. Moreover, the study points towards a significant contribution of groove and/or loop binding in the recognition mode of quadruplex structures by these non-classical quadruplex ligands. The results reported herein highlight the potential and the versatility of carbohydrate bis-phenanthroline metal-complex conjugates to recognize G-quadruplex DNA structures.
Assuntos
Amino Açúcares/química , Complexos de Coordenação/química , Cobre/química , Quadruplex G , Fenantrolinas/química , Amino Açúcares/síntese química , Dicroísmo Circular , Complexos de Coordenação/síntese química , Transferência Ressonante de Energia de Fluorescência , Humanos , Ligantes , Oligodesoxirribonucleotídeos/química , Fenantrolinas/síntese química , Cloreto de Potássio/química , Cloreto de Sódio/química , Telômero/químicaRESUMO
Dentro de la clasificación de linfomas cutáneos primarios de células B se encuentra el linfoma de células B tipo pierna. El mismo se presenta más frecuentemente en mujeres de edad avanzada. Existen diferentes opciones terapéuticas para este linfoma. Presenta regular pronóstico. Presentamos una paciente de 58 años con una lesión tumoral en antebrazo izquierdo. Con la clínica, la histopatología y la inmunohistoquímica se realizó el diagnóstico de linfoma B primitivo cutáneo difuso de células grandes de la pierna localizado en el antebrazo. Realizó tratamiento con quimioterapia con CHOP, pero debido a la mala respuesta al mismo, se decidió la amputación del antebrazo izquierdo...
Assuntos
Adulto , Feminino , Linfoma não Hodgkin , Pele , Antebraço , Perna (Membro) , NeoplasiasRESUMO
El objetivo del estudio fue evaluar las actitudes y conocimientos de 40 participantes pertenecientes a diferentes esferas sociales frente a las intervenciones neurocientíficas en ensanchamiento o mejoramiento cognitivo. Esto, con el fin de explorar en qué medida encuentran moralmente aceptable los desarrollos biotecnológicos en las neurociencias del comportamiento. Se realizó un análisis cuantitativo y cualitativo. No se encontraron diferencias en la actitud hacia las intervenciones según el nivel de conocimiento. Por último, se observó una tendencia central en lo que respecta a las percepciones éticas sobre estas intervenciones, a pesar de encontrar diferencias de aceptabilidad moral en los diferentes grupos.
This study was aimed to assess attitudes and knowledge of 40 people from different social status toward the scientific interventions in cognitive neuroenhancement. It is in order to inquire about the moral acceptance of the biotechnologically viable in behavioral neuroscience. Both, quantitative and qualitative analyses were performed. No differences in attitude towards interventions according to the level of knowledge were presented. Finally a central tendency was observed toward the ethical perceptions about the mentioned interventions, in spite of having found moral differences in moral acceptability among the different groups.
RESUMO
Algunos trabajos de investigación informan que cierto número de niños superdotados muestran problemas de adaptación social y habilidades sociales e interpersonales, mientras que otros consideran que esto no ocurre. Partiendo de lo anterior, Neihart, Reis, Robinson y Moon (2002) hablan de enfoque de resiliencia versus enfoque de riesgo. En este trabajo se considera el beneficio de aplicar programas de entrenamiento en habilidades interpersonales en niños superdotados para prevenir posibles problemas. Por ello, se pretende valorar la eficacia de un programa de entrenamiento en resolución de problemas interpersonales en esta población. En esta investigación participaron 40 niños superdotados de edades comprendidas entre 7 y 13 años, divididos en un grupo tratamiento y un grupo control de lista de espera. Los resultados mostraron diferencias significativas en las medidas de valoración directa en el grupo tratamiento tras la aplicación del programa. También se detectaron diferencias significativas entre el grupo tratamiento y el grupo control en las medidas postratamiento a favor del primero, y se confirmó la relación del potencial de aprendizaje de los niños con los beneficios obtenidos. En definitiva, el programa de entrenamiento se muestra eficaz en la mejora de las habilidades de solución de problemas interpersonales evaluadas en niños superdotados.
Certain research studies report that a number of gifted children show social adaptation issues, as well as problems with social and interpersonal skills, while others consider that this does not occur. In this regard, Neihart, Reis, Robinson and Moon (2002) speaks of a resilience approach versus a risk approach. From the risk viewpoint, this paper presents the benefits of applying training programs in interpersonal skills as to prevent potential problems in gifted children. For this reason, we aim to evaluate the effectiveness of a training program for solving interpersonal problems in this population. Participants include 40 gifted children aged 7 to 13, divided into a treatment group and a control - waitlisted - group. Program application results show significant differences in direct assessment measurements in the treatment group. An increase in effect sizes between the treatment group and the control group is also detected, in favor of the former, and a relationship between the children's learning potential and the benefits obtained is also confirmed. In short, the training program proves effective in interpersonal problem-solving skill improvement in children with high intellectual capacity.
RESUMO
A series of ethylenediamine platinum(II) complexes connected through semi-rigid chains of 1,2-bis(4-pyridyl)ethane to DNA intercalating subunits (naphthalene, anthracene or phenazine) has been synthesized, and their interactions with calf thymus (CT) DNA have been evaluated by viscometric titrations and equilibrium dialysis experiments. The parent ligands that contain anthracene or phenazine chromophores showed a monointercalative mode of DNA interaction (especially the anthracene derivative), with apparent association constants in the order of 10(4) M(-1). The corresponding platinum(II) complexes bind CT DNA through bisintercalation, as established by the significant increase of DNA contour length inferred from viscosity measurements, and the association constants are in the order of 10(5) M(-1). The naphthalene derivatives, however, exhibit a mixed mode of interaction, which suggests a partial contribution of both intercalation and groove binding for the ligand, and monointercalation in the case of the platinum(II) complex. Competition dialysis experiments carried out on the intercalative compounds have revealed a moderate selectivity towards GC DNA sequences for the derivatives containing the anthracene chromophore.
Assuntos
DNA/química , Etilenodiaminas/química , Etilenodiaminas/síntese química , Substâncias Intercalantes/química , Substâncias Intercalantes/síntese química , Compostos Organoplatínicos/química , Compostos Organoplatínicos/síntese química , Animais , Bovinos , CinéticaRESUMO
El objetivo de la presente revisión es presentar un panorama del desarrollo de dos modelos explicativos: la teoría de la mente y la teoría de la alteración de la función ejecutiva en los trastornos del espectro autista (TEA). Para ello, parte de una descripción de las manifestaciones clínicas del TEA y de sus bases neuroanatómicas. Se concluye, que los dos modelos ofrecen explicaciones que bien podrían complementarse para ofrecer un marco explicativo integral. Finalmente, se hace una presentación de algunos enfoques terapéuticos que han mostrado su efectividad en este trastorno.
The aim of this review is to present an overview of the development of two explicative theories: the theory of mind and the impaired executive funtion in autism. Thus, the review begins with a description of the clinical manifestations of autism and its neuroanatomical basis. As a conclusion, both models offer complementary theories that could be integrated in order to provide a comprehensive explanatory framework. Finally, the article introduces some therapeutic approaches that have being effective when dealing with this disorder.
Assuntos
Humanos , Transtorno AutísticoRESUMO
Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2 percent w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100 percent were found, predictive positive and negative values were of 100 percent respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method) provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.