RESUMO
The oscillator of the cyanobacterial circadian clock relies on the ability of the KaiB protein to switch reversibly between a stable ground-state fold (gsKaiB) and an unstable fold-switched fold (fsKaiB). Rare fold-switching events by KaiB provide a critical delay in the negative feedback loop of this post-translational oscillator. In this study, we experimentally and computationally investigate the temperature dependence of fold switching and its mechanism. We demonstrate that the stability of gsKaiB increases with temperature compared to fsKaiB and that the Q10 value for the gsKaiB â fsKaiB transition is nearly three times smaller than that for the reverse transition. Simulations and native-state hydrogen-deuterium exchange NMR experiments suggest that fold switching can involve both subglobally and near-globally unfolded intermediates. The simulations predict that the transition state for fold switching coincides with isomerization of conserved prolines in the most rapidly exchanging region, and we confirm experimentally that proline isomerization is a rate-limiting step for fold switching. We explore the implications of our results for temperature compensation, a hallmark of circadian clocks, through a kinetic model.
RESUMO
Coronavirus pandemic has caused a vast number of deaths worldwide. Thus creating an urgent need to develop effective counteragents against novel coronavirus disease (COVID-19). Many antiviral drugs have been repurposed for treatment but implicated minimal recovery, which further advanced the need for clearer insights and innovation to derive effective therapeutics. Strategically, Noscapine, an approved antitussive drug with positive effects on lung linings may show favorable outcomes synergistically with antiviral drugs in trials. Hence, we have theoretically examined the combinatorial drug therapy by culminating the existing experimental results with in silico analyses. We employed the antitussive noscapine in conjugation with antiviral drugs (Chloroquine, Umifenovir, Hydroxychloroquine, Favlplravir and Galidesivir). We found that Noscapine-Hydroxychloroquine (Nos-Hcq) conjugate has strong binding affinity for the main protease (Mpro) of SARS-CoV-2, which performs key biological function in virus infection and progression. Nos-Hcq was analyzed through molecular dynamics simulation. The MD simulation for 100 ns affirmed the stable binding of conjugation unprecedentedly through RMSD and radius of gyration plots along with critical reaction coordinate binding free energy profile. Also, dynamical residue cross-correlation map with principal component analysis depicted the stable binding of Nos-Hcq conjugate to Mpro domains with optimal secondary structure statistics of complex dynamics. Also, we reveal the drugs with stable binding to major domains of Mpro can significantly improve the work profile of reaction coordinates, drug accession and inhibitory regulation of Mpro. The designed combinatorial therapy paves way for further prioritized in vitro and in vivo investigations for drug with robust binding against Mpro of SARS-CoV-2.
Assuntos
Antitussígenos , COVID-19 , Noscapina , Antivirais/uso terapêutico , Quimioinformática , Humanos , Simulação de Acoplamento Molecular , Inibidores de Proteases , SARS-CoV-2RESUMO
Development of effective counteragents against the novel coronavirus disease (COVID-19) caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) strains, requires clear insights and information for understanding the immune responses associated with it. This global pandemic has pushed the healthcare system and restricted the movement of people and succumbing of the available therapeutics utterly warrants the development of a potential vaccine to contest the deadly situation. In the present study, highly efficacious, immunodominant cytotoxic T-lymphocyte (CTL) epitopes were predicted by advanced immunoinformatics assays using the spike glycoprotein of SARS-CoV2, generating a robust and specific immune response with convincing immunological parameters (Antigenicity, TAP affinity, MHC binder) engendering an efficient viral vaccine. The molecular docking studies show strong binding of the CTL construct with MHC-1 and host membrane specific TLR2 receptors. The molecular dynamics simulation in an explicit system confirmed the stable and robust binding of CTL epitope with TLR2. Steep magnitude RMSD variation and compelling residual fluctuations existed in terminal residues and various loops of the ß linker segments of TLR2-epitope (residues 105-156 and 239-254) to about 0.4 nm. The reduced Rg value (3.3 nm) and stagnant SASA analysis (275 nm/S2/N after 8 ns and 5 ns) for protein surface and its orientation in the exposed and buried regions suggests more compactness due to the strong binding interaction of the epitope. The CTL vaccine candidate establishes a high capability to elicit the critical immune regulators, like T-cells and memory cells as proven by the in silico immunization assays and can be further corroborated through in vitro and in vivo assays.
Assuntos
Vacinas contra COVID-19/imunologia , COVID-19/imunologia , Biologia Computacional , SARS-CoV-2/imunologia , Linfócitos T Citotóxicos/imunologia , COVID-19/terapia , Biologia Computacional/métodos , Simulação por Computador , Epitopos de Linfócito T/imunologia , Humanos , Imunogenicidade da Vacina , Modelos Moleculares , Glicoproteína da Espícula de Coronavírus/imunologia , Receptor 2 Toll-Like/imunologiaRESUMO
While the world is tackling one of the direst health emergencies, it has come to light that in the fight against viruses, preparedness is everything. A disease with the initial symptoms of the common flu has the capacity to disrupt the life of 7.8 billion people and thus no infection and especially no virus can be ignored. Hence, we have designed the high bio-recognizing DNA aptamer for diagnosis and therapeutics role against glycoprotein-B (gB) of Human Herpes Virus-5 (HHV-5). HHV-5 is linked with epidemiological and asymptomatic diseases leading to high mortality. Herein, we report potent aptamer (5'CTCGCTTACCCCTGGGTGTGCGGG3') which has high specificity to gB with energy score -523.28 kJ/mol, more than reference aptamer L19 (-363.50 kJ/mol). The stable binding of aptamer with gB was confirmed with atomic fluctuations 0.1 to 1.8 Å through anisotropic network analysis. Aptamer formed stem-loop conformation (-1.0 kcal/mol) by stochastic simulation and found stable with physicochemical properties. Importantly, aptamer was found biologically significant with consisting of putative transcription factors in its vicinity (SP1, GATA1, AP2, NF1) and also possesses homology with exonic sequence of SGSH gene which indicated regulatory role in blockade of viruses. Inaddition, we also proposed plausible mechanism of action of aptamer as antiviral therapeutics.
Assuntos
Aptâmeros de Nucleotídeos , Citomegalovirus , Antivirais/farmacologia , HumanosRESUMO
In the current situation, the importance of vaccines for viral diseases has become the need of the hour. The scientific community in the field of virology has taken it upon themselves to develop vaccines for viral infections before an epidemic or pandemic situation arises. Human herpes virus-5 is an emerging situation that has alarming cases with major health concerns, including congenital impairments and infections leading to cancer states. Vaccination is the route most likely to succeed in the battleground with viral infections and consequences. Hence in the present manuscript, we have formulated the multiepitope subunit vaccine and optimized it with the advanced computational immunological framework. As a result, we report the subunit vaccine for HHV-5, comprised of promiscuous cytotoxic T-lymphocytes epitopes, helper T-lymphocytes, and B-cell epitopes engineered with putative adjuvants to ensure the strong immune response. The formulated subunit vaccine depicted high antigenicity and immunogenicity along with sustainable physicochemical characteristics. Molecular dynamics simulation analyses revealed the strong binding of the vaccine with MHC receptors (MHC-1 and MHC-2) and the virus progression specific membrane receptor TLR2 for a 100 ns MD simulation run. The interacting trajectory analysis of the vaccine showed stable binding with minimal deviations through RMSD, RMSF, and secondary structure confinement plot analyses for a long span of 100 ns. Interestingly, the vaccine showed robust immune response statistics for a prolonged time with evoking T-cell and B-cell populations with other vital players of the immune system, through the machine learning-based immune simulation approach. This study paved the way to a multiepitope vaccine for HHV-5 employing the immunoinformatics networks.
RESUMO
Immunotherapy is a breakthrough approach for cancer treatment and prevention. By exploiting the fact that cancer cells have overexpression of tumor antigens responsible for its growth and progression, which can be identified and removed by boosting the immune system. In silico techniques have provided efficient ways for developing preventive measures to ward off cancer. Herein, we have designed a potent cytotoxic T-lymphocyte epitope to elicit a desirable immune response against carcinogenic melanoma-associated antigen-A11. Potent epitope was predicted using reliable algorithms and characterized by advanced computational avenue CABS molecular dynamics simulation, for full flexible binding with HLA-A*0201 and androgen receptor to large-scale rearrangements of the complex system. Results showed the potent immunogenic construct (KIIDLVHLL), from top epitopes using five algorithms. Molecular docking analyses showed the strong binding of epitope with HLA-A*0201 and androgen receptor with docking score of -780.6 and -641.06 kcal/mol, respectively. Molecular dynamics simulation analysis revealed strong binding of lead epitope with androgen receptor by involvement of 127 elements through atomic-model study. Full flexibility study showed stable binding of epitope with an average root mean square deviation (RMSD) 2.21 Å and maximum RMSD value of 6.48 Å in optimal cluster density area. The epitope also showed remarkable results with radius of gyration 23.0777 Å, world population coverage of 39.08% by immune epitope database, and transporter associated with antigen processing (TAP) affinity IC50 value of 2039.65 nm. Moreover, in silico cloning approach confirmed the expression and translation capacity of the construct within a suitable expression vector. The present study paves way for a potential immunogenic construct for prevention of cancer.
Assuntos
Antígenos de Neoplasias/uso terapêutico , Vacinas Anticâncer/uso terapêutico , Citotoxicidade Imunológica , Desenho de Fármacos , Epitopos de Linfócito T , Proteínas de Neoplasias/uso terapêutico , Neoplasias/terapia , Linfócitos T Citotóxicos/imunologia , Algoritmos , Antígenos de Neoplasias/genética , Antígenos de Neoplasias/imunologia , Antígenos de Neoplasias/metabolismo , Vacinas Anticâncer/genética , Vacinas Anticâncer/imunologia , Vacinas Anticâncer/metabolismo , Antígeno HLA-A2/imunologia , Antígeno HLA-A2/metabolismo , Humanos , Imunogenicidade da Vacina , Simulação de Acoplamento Molecular , Simulação de Dinâmica Molecular , Proteínas de Neoplasias/genética , Proteínas de Neoplasias/imunologia , Proteínas de Neoplasias/metabolismo , Neoplasias/imunologia , Neoplasias/metabolismo , Neoplasias/patologia , Ligação Proteica , Receptores Androgênicos/imunologia , Receptores Androgênicos/metabolismo , Linfócitos T Citotóxicos/metabolismo , Vacinas de Subunidades Antigênicas/genética , Vacinas de Subunidades Antigênicas/imunologia , Vacinas de Subunidades Antigênicas/metabolismo , Vacinas de Subunidades Antigênicas/uso terapêuticoRESUMO
Originating in the city of Wuhan in China in December 2019, COVID-19 has emerged now as a global health emergency with a high number of deaths worldwide. COVID-19 is caused by a novel coronavirus, referred to as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), resulting in pandemic conditions around the globe. We are in the battleground to fight against the virus by rapidly developing therapeutic strategies in tackling SARS-CoV-2 and saving human lives from COVID-19. Scientists are evaluating several known drugs either for the pathogen or the host; however, many of them are reported to be associated with side effects. In the present study, we report the molecular binding mechanisms of the natural alkaloid, noscapine, for repurposing against the main protease of SARS-CoV-2, a key enzyme involved in its reproduction. We performed the molecular dynamics (MD) simulation in an explicit solvent to investigate the molecular mechanisms of noscapine for stable binding and conformational changes to the main protease (Mpro) of SARS-CoV-2. The drug repurposing study revealed the high potential of noscapine and proximal binding to the Mpro enzyme in a comparative binding pattern analyzed with chloroquine, ribavirin, and favipiravir. Noscapine binds closely to binding pocket-3 of the Mpro enzyme and depicted stable binding with RMSD 0.1-1.9 Å and RMSF profile peak conformational fluctuations at 202-306 residues, and a Rg score ranging from 21.9 to 22.4 Å. The MM/PB (GB) SA calculation landscape revealed the most significant contribution in terms of binding energy with ΔPB -19.08 and ΔGB -27.17 kcal/mol. The electrostatic energy distribution in MM energy was obtained to be -71.16 kcal/mol and depicted high free energy decomposition (electrostatic energy) at 155-306 residues (binding pocket-3) of Mpro by a MM force field. Moreover, the dynamical residue cross-correlation map also stated that the high pairwise correlation occurred at binding residues 200-306 of the Mpro enzyme (binding pocket-3) with noscapine. Principal component analysis depicted the enhanced movement of protein atoms with a high number of static hydrogen bonds. The obtained binding results of noscapine were also well correlated with the pharmacokinetic parameters of antiviral drugs.
Assuntos
Betacoronavirus , Reposicionamento de Medicamentos , Noscapina , Inibidores de Proteases , Proteínas não Estruturais Virais , Betacoronavirus/química , Betacoronavirus/enzimologia , Betacoronavirus/metabolismo , COVID-19 , Infecções por Coronavirus/virologia , Humanos , Simulação de Acoplamento Molecular , Simulação de Dinâmica Molecular , Noscapina/química , Noscapina/metabolismo , Pandemias , Peptídeo Hidrolases/química , Peptídeo Hidrolases/metabolismo , Pneumonia Viral/virologia , Inibidores de Proteases/química , Inibidores de Proteases/metabolismo , SARS-CoV-2 , Proteínas não Estruturais Virais/química , Proteínas não Estruturais Virais/metabolismoRESUMO
Chalcone, a privileged structure, is considered as an effective template in the field of medicinal chemistry for potent drug discovery. In the present study, a privileged template chalcone was designed, synthesized, and characterized by various spectroscopic techniques (NMR, high-resolution mass spectrometry, Fourier transform infrared (FT-IR) spectroscopy, UV spectroscopy, and single-crystal X-ray diffraction). The mechanism of binding of chalcone with bovine serum albumin (BSA) was determined by multispectroscopic techniques and computational methods. Steady-state fluorescence spectroscopy suggests that the intrinsic fluorescence of BSA was quenched upon the addition of chalcone by the combined dynamic and static quenching mechanism. Time-resolved spectroscopy confirms complex formation. FT-IR and circular dichroism spectroscopy suggested the presence of chalcone in the BSA molecule microenvironment and also the possibility of rearrangement of the native structure of BSA. Moreover, molecular docking studies confirm the moderate binding of chalcone with BSA and the molecular dynamics simulation analysis shows the stability of the BSA-drug complex system with minimal deformability fluctuations and potential interaction by the covariance matrix. Moreover, pharmacodynamics and pharmacological analysis show good results through Lipinski rules, with no toxicity profile and high gastrointestinal absorptions by boiled egg permeation assays. This study elucidates the mechanistic profile of the privileged chalcone scaffold to be used in therapeutic applications.
RESUMO
Acute encephalitis syndrome outbreak has emerged as a major health concern on both national and international scales. Brain inflammation/infections caused by Japanese encephalitis virus (JEV) can lead to death. The cases are growing in numbers globally, and this emergent health concern requires an effective and viable vaccine to strengthen the body's immune system against this deadly virus. Proteomic analyses of JEV revealed the envelope protein as a potential target for vaccine development by patient samples analysis. Hence, in this study, we aimed to design a multiepitope subunit vaccine for acute encephalitis using the advanced structural biology and immunoinformatics approaches. We report the multiepitope subunit vaccine consisted of the putative T-cell epitope (MHC-1 and MHC-2 restricted) and B-cell epitope and with high antigenicity and immunogenicity. The TAP affinity epitopes along with adjuvants were engineered to the vaccine, to ensure the ease transportation inside the host and elicitation of a strong immune response. The specificity of vaccine construct was evaluated by molecular docking with major histocompatibility complex (MHC) receptors and host membrane receptor TLR2. High docking scores and a close interaction to the binding groove of receptors confirmed the potency and specificity of the vaccine. Also, molecular dynamics simulation studies confirmed the stable interaction of vaccine with TLR2 for a long run (100 ns), which showed the prolonged elicitation of the strong immune response. Peptide dynamics studies showed the flexible, strong, and stable binding of vaccine with minimal deviation in root-mean-square deviation (RMSD), root-mean-square fluctuation (RMSF), and secondary structure estimation (SSE) plots till 100 ns simulation run. The in silico immune simulation approach based on the position-specific scoring matrix and machine learning methods resulted in the strong immune response reinforcement statistics of immune cells (T-cells, B-cells population, and memory cells) in response to vaccine candidate. The favorable results and well-correlated data of varied in silico techniques paved for a potent multiepitope vaccine and helped us to propose the mechanism of action of designed vaccine and generation of the immune response against acute encephalitis syndrome.
Assuntos
Encefalite Japonesa/imunologia , Epitopos/imunologia , Vacinas de Subunidades Antigênicas/imunologia , Doença Aguda , HumanosRESUMO
COVID-19 has been declared as a global health emergency and exposed the world to a deadly virus, which has dramatically changed the lives of humans for an unknown period of time. In the battleground with the virus, we have employed an immunoinformatics framework to design a robust vaccine as an insurance plan for the future. The pathogenic sequence with cryptic epitope taken from patients in Wuhan, China, was harnessed to design a promiscuous cytotoxic T-lymphocyte, helper T-lymphocyte, and B-cell epitope based subunit vaccine, engineered with adjuvants and conformational linkers. The reported vaccine has high antigenicity and immunogenicity profiles with potential TAP affinity, which ensures elevated antigen processing capability. It has strong binding with major histocompatibility complex (MHC) receptors (MHC-1 and MHC-2) and virus-specific membrane receptor TLR-2, with scores of -1010.7, -1035.7, and -1076.3 kcal mol-1, respectively. Molecular dynamics simulation analysis was used to assess the stable binding with TLR-2 with minimal atomic motions through a deformation plot, covariance matrix, and elastic network. Importantly, an in silico immunization assay showed the reliable elicitation of key players in terms of immune cells together with memory cells to evoke adaptive immune responses upon administration of the construct. In view of favorable outcomes, we also propose a plausible vaccine mechanism to elicit an immune response to fight coronavirus.
RESUMO
In present investigation, an attempt was undertaken to modify the C-9 position of noscapine (Nos), an opium alkaloid to yield 9 -hydroxy methyl and 9 -carbaldehyde oxime analogues for augmenting anticancer potential. The synthesis of 9-hydroxy methyl analogue of Nos was carried out by Blanc reaction and 9-carbaldehyde oxime was engineered by oxime formation method and characterized using FT-IR, 1H NMR, 13C NMR, mass spectroscopy, and so on techniques. In silico docking techniques informed that 9-hydroxy methyl and 9-carbaldehyde oxime analogues of Nos had higher binding energy score as compared to Nos. The IC50 of Nos was estimated to be 46.8 µM signficantly (P < 0.05) higher than 8.2 µM of 9-carbaldehyde oxime and 4.6 µM of 9-hydroxy methyl analogue of Nos in U87, human glioblastoma cells. Moreover, there was significant (P < 0.05) difference between the IC50 of 9-carbaldehyde oxime and 9-hydroxy methyl analogue of Nos. Consistent to in vitro cytotoxicity data, 9-hydroxy methyl analogue of Nos induced significantly (P < 0.05) higher degree of apoptosis of 84.6% in U87 cells as compared to 78.5% and 64.3% demonstrated by 9-carbaldehyde oxime and Nos, respectively. Thus the higher therapeutic efficacy of 9-hydroxy methyl analogue of Nos may be credited to higher solubility and inhibitory constant (K).
Assuntos
Antineoplásicos/farmacologia , Microtúbulos/efeitos dos fármacos , Microtúbulos/metabolismo , Noscapina/farmacologia , Apoptose/efeitos dos fármacos , Linhagem Celular Tumoral , Humanos , Espectroscopia de Ressonância Magnética , Noscapina/análogos & derivados , Oximas/metabolismo , Espectroscopia de Infravermelho com Transformada de FourierRESUMO
The mankind relies on the use of antibiotics for a healthy life. The epidemic-like emergence of drug-resistant bacterial strains is increasingly becoming one of the leading causes of morbidity and mortality, which gives rise to design a potential antimicrobial peptide (AMP). Here, we have designed the potential AMP using the extensive dynamics simulation since protein-peptide interactions are linked to large conformational changes. Therefore, we have employed the advanced computational avenue CABS molecular docking method that enabled the flexible peptide-protein molecular docking with a large-scale rearrangement of the protein. Lead AMP was investigated against the wild-type (WT) and mutant-PBP5 (MT-PBP5) proteins (antiresistance property). AMP20 showed strong interactions with wtPBP5 and mtPBP5 and involvement of a large number of elements in interactions determined through an atomic model study. Full flexibility analysis showed the stable interaction of AMP20 with both the wild-type and mutant form of PBP5 with root-mean-square deviation (RMSD) values of â¼4.51 and 4.85 Å, respectively. Moreover, peptide dynamics showed involvement of all residues of AMP20 through contact map analysis, and extensive simulation confirmed the stable interaction of AMP20, with lower values of RMSD, radius of gyration, and root-mean-square fluctuation. This study paves the way for a potential approach to design the AMP with amino acid walking and large-scale conformational rearrangements of amino acids.
RESUMO
It would be of great significance to introduce a new biocompatible Layered Double Hydroxide (LDH) for the efficient remediation of wastewater. Herein, we designed a facile, biocompatible and environmental friendly layered double hydroxide (LDH) of NiFeTi for the very first time by the hydrothermal route. The materialization of NiFeTi LDH was confirmed by FTIR, XRD and Raman studies. BET results revealed the high surface area (106 m2/g) and the morphological studies (FESEM and TEM) portrayed the sheets-like structure of NiFeTi nanoparticles. The material so obtained was employed as an efficient adsorbent for the removal of organic dyes from synthetic waste water. The dye removal study showed >96% efficiency for the removal of methyl orange, congo red, methyl blue and orange G, which revealed the superiority of material for decontamination of waste water. The maximum removal (90%) of dyes was attained within 2 min of initiation of the adsorption process which supported the ultrafast removal efficiency. This ultrafast removal efficiency was attributed to high surface area and large concentration of -OH and CO32- groups present in NiFeTi LDH. In addition, the reusability was also performed up to three cycles with 96, 90 and 88% efficiency for methyl orange. Furthermore, the biocompatibility test on MHS cell lines were also carried which revealed the non-toxic nature of NiFeTi LDH at lower concentration (100% cell viability at 15.6 µg/ml). Overall, we offer a facile surfactant free method for the synthesis of NiFeTi LDH which is efficient for decontamination of anionic dyes from water and also non-toxic.
RESUMO
Lysozyme is a well-characterized protein in terms of its structure, dynamics, and functions. It has thus emerged as a potential target to understand protein-drug interactions. The aim of our study is to gain a biophysical outlook on the interaction of lysozyme (Lyz), a well-known model protein, with Noscapine, a potent tubulin-binding anticancer drug. Noscapine (Nos) is effective against a wide range of cancer and shows low toxicity and few side effects. We report the underlying mechanism of complex formation between Nos and Lyz using spectroscopic and advanced computational avenues. The spectroscopic techniques, that is, absorption and steady-state and time-resolved fluorescence, proved that Lyz-Nos forms a complex, and the quenching mechanism was of the static type. The binding constant was in the order of 103 indicative of moderate binding, while the stoichiometry of the protein-drug complex was 1:1 at 298 K. The secondary structural analysis using CD and UV thermal denaturation further confirmed the conformational changes in the protein upon binding with Nos. Molecular dynamics simulation studies confirmed the stable binding with minimum deviations in RMSD. The above conclusions are significant to the development of the pharmacokinetics and pharmacodynamic properties of Nos, and its successful interaction with a versatile protein like Lyz will help in overcoming its previous limitations.
RESUMO
Heme is central to functions of many biologically important enzymes (hemoproteins). It is an assembly of four porphyrin rings joined through methylene bridges with a central Fe (II). Heme is present in all cells, and its synthesis and degradation balance its amount in the cell. The deregulations of heme networks and incorporation in hemoproteins lead to pathogenic state. This article addresses the detailed structure, biosynthesis, degradation, and transportation associated afflictions to heme. The article is followed by its roles in various diseased conditions where it is produced mainly as the cause of increased hemolysis. It manifests the symptoms in diseases as it is a pro-oxidant, pro-inflammatory and pro-hemolytic agent. We have also discussed the genetic defects that tampered with the biosynthesis, degradation, and transportation of heme. In addition, a brief about the largest hemoprotein group of enzymes- Cytochrome P450 (CYP450) has been discussed with its roles in drug metabolism.
Assuntos
Sistema Enzimático do Citocromo P-450/metabolismo , Interações Medicamentosas , Efeitos Colaterais e Reações Adversas Relacionados a Medicamentos , Heme/química , Animais , Heme/metabolismo , Heme/toxicidade , HumanosRESUMO
Antibiotic resistance is not only a global public health threat but also a huge economic burden to our society that urgently needs to be addressed by improved antibiotics and continuing development of novel molecules to treat resistant bacterial infections. Nowadays combination therapies offer a competent approach to counteract antibiotic resistance in bacteria. Better knowledge of mechanisms of antibiotic resistance has lead to the finding of new alternatives to antibiotic therapy. Hence, in this article, we report a novel series of indoline derivatives and their computational study as potent antimicrobials. The present study investigates the indoline based derived library interaction with DNA gyrase B enzyme to be used as a potential antimicrobial drug. Computational approaches were employed to carry out the molecular interactions and pharmacological studies. In this study, we have compared indoline with its derivatives and have found that compound 13 (1m) resulted in the strong binding with the highest score (-9.02 kcal/mol) in the designed library where indoline showed (-6.43 kcal/mol). Furthermore, molecular dynamics simulation run also confirmed the strongest interaction of a compound and target protein with less RMSD and RMSF deviation of the complex. Notably, the compound was also found to possess the good pharmacological properties and pharmacokinetic properties.
Assuntos
Antibacterianos/síntese química , Antibacterianos/farmacologia , Desenho de Fármacos , Indóis/química , Inibidores da Topoisomerase II/síntese química , Inibidores da Topoisomerase II/farmacologia , Antibacterianos/química , Proteínas de Bactérias , DNA Topoisomerases/genética , DNA Topoisomerases/metabolismo , Sistemas de Liberação de Medicamentos , Regulação Bacteriana da Expressão Gênica/efeitos dos fármacos , Regulação Enzimológica da Expressão Gênica/efeitos dos fármacos , Modelos Moleculares , Estrutura Molecular , Ligação Proteica , Conformação Proteica , Inibidores da Topoisomerase II/químicaRESUMO
Bromo-Noscapine (BrNs) is a tubulin-binding cytotoxic agent with significant activity against breast and lung cancer. The mechanistic interaction insight into the binding of bovine serum albumin (BSA) with BrNs can provide critical information about the pharmacodynamics and pharmacokinetics properties. Here, various spectroscopic techniques and computational methods were employed to understand the dynamics of BrNs and BSA interaction. The intrinsic fluorescence of BSA was quenched by BrNs through a static quenching procedure. The stoichiometry of BrNs-BSA complex was 1:1 and binding constant of the complex was in the order of 103 M-1 at 298 K. Based on thermodynamic analysis, it was deduced that binding process of the BrNs with BSA was spontaneous and exothermic, and the major forces between BrNs and BSA were van der waals forces and hydrogen bonding. Moreover, results of FT-IR, CD, UV spectra concluded significant conformational change in BSA on binding with BrNs. The in vitro findings were further confirmed by in silico assays. Molecular docking showed strong interactions with score of -8.08 kcal/mol. Molecular dynamics simulation analysis also suggested the stable binding with lower deviation in RMSD and RMSF values through persistent long simulation run. This study suggests optimal efficiency of diffusion of the BrNs into the bloodstream for the treatment of cancer.
Assuntos
Simulação de Acoplamento Molecular , Noscapina/química , Soroalbumina Bovina/química , Termodinâmica , Animais , Sítios de Ligação , Bovinos , Dicroísmo Circular , Biologia Computacional , Ligação de Hidrogênio , Estrutura Molecular , Noscapina/metabolismo , Ligação Proteica , Soroalbumina Bovina/metabolismo , Espectrofotometria Ultravioleta , Espectroscopia de Infravermelho com Transformada de FourierRESUMO
Fluoroquinolone (FQ) antibiotics are an important class of synthetic antibacterial agents. These are the most extensively used drugs for treating bacterial infections in the field of both human and veterinary medicine. Herein, the antibacterial and pharmacological properties of four fluoroquinolones: lomefloxacin, norfloxacin, ciprofloxacin, and ofloxacin have been studied. The objective of this study was to analyze the antibacterial characteristics of the different fluoroquinolones. Also, the pharmacological properties of the compounds including the Lipinski rule of five, absorption, distribution, metabolism, and excretion, LD50, drug likeliness, and toxicity were evaluated. We found that among all four FQ molecules, ofloxacin showed the highest antibacterial activity through in silico assays with a strong interaction (â38.52 kJ/mol) with the antibacterial target protein (topoisomerase-II DNA gyrase enzyme). The pharmacological and pharmacokinetic analysis also showed that the compounds ciprofloxacin, ofloxacin, lomefloxacin and norfloxacin have good pharmacological properties. Notably, ofloxacin was found to possess an IGC50 (concentration needed to inhibit 50% growth) value of 0.286 µg/L against the Tetrahymena pyriformis protozoa. It also tested negative for the Ames toxicity test, showing its non-carcinogenic character.
RESUMO
Development of nanoparticles (NPs) as a part of cancer therapeutics has given rise to a new field of research - cancer nanomedicine. In comparison to traditional anti-cancer drugs, NPs provide a targeted approach which prevents undesirable effects. In this communication, we have reviewed the role of gold and silver NPs (AgNPs) in the cancer nanomedicine. The preparation of gold NPs (AuNPs) and AgNPs can be grouped into three categories - physical, chemical and biological. Among the three approaches, the biological approach is growing and receiving more attention due to its safe and effective production. In this review, we have discussed important methods for synthesis of gold and AgNPs followed by techniques employed in characterization of their physicochemical properties, such as UV-visible spectroscopy, electron microscopy (TEM and SEM) and size and surface analysis (DLS). The mechanism of formation of these NPs in an aqueous medium through various stages - reduction, nucleation and growth has also been reviewed briefly. Finally, we conclude our review with the application of these NPs as anti-cancer agents and numerous mechanisms by which they render cancer cell toxicity.